Molybdenum Supply Alleviates the Cadmium Toxicity in Fragrant Rice by Modulating Oxidative Stress and Antioxidant Gene Expression
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Husbandry and Growth Conditions
2.2. Morphological Traits
2.3. Measurement of Photosynthetic Pigments
2.4. Determination of Cadmium and Molybdenum Concentrations
2.5. Soluble Protein and Proline Determination
2.6. Measurement of H2O2, MDA and Electrolyte Leakage
2.7. Measurement of Enzymatic and Non-Enzymatic Antioxidants
2.8. Total RNA Extraction and qRT-PCR Analysis
2.9. Statistical Analysis
3. Results
3.1. Effects of Mo Application on Plant Growth and Photosynthetic Pigments Contents under Cd Toxicity
3.2. Molybdenum and Cadmium Concentrations in Plant Parts
3.3. Effect of Mo on the S-Protein and Proline Contents under Cd Toxicity
3.4. Influence of Molybdenum and Cadmium on the Contents of H2O2, MDA and EL in Rice Plants
3.5. Effects of Mo Supplementation on Enzymatic and Non-Enzymatic Antioxidant Activities in Cd-Stressed Rice Seedlings
3.6. Effect of Mo and Cd on Antioxidant Gene Expressions
3.7. Correlation Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Shanying, H.; Xiaoe, Y.; Zhenli, H.; Baligar, V.C. Morphological and physiological responses of plants to cadmium toxicity: A review. Pedosphere 2017, 27, 421–438. [Google Scholar]
- Sarwar, N.; Ishaq, W.; Farid, G.; Shaheen, M.R.; Imran, M.; Geng, M.; Hussain, S. Zinc–cadmium interactions: Impact on wheat physiology and mineral acquisition. Ecotoxicol. Environ. Saf. 2015, 122, 528–536. [Google Scholar] [CrossRef]
- Hussain, S.; Khaliq, A.; Noor, M.A.; Tanveer, M.; Hussain, H.A.; Hussain, S.; Shah, T.; Mehmood, T. Metal Toxicity and Nitrogen Metabolism in Plants: An Overview. In Carbon and Nitrogen Cycling in Soil; Springer: Berlin/Heidelberg, Germany, 2020; pp. 221–248. [Google Scholar]
- Hussain, S.; Khan, F.; Cao, W.; Wu, L.; Geng, M. Seed priming alters the production and detoxification of reactive oxygen intermediates in rice seedlings grown under sub-optimal temperature and nutrient supply. Front. Plant Sci. 2016, 7, 439. [Google Scholar] [CrossRef] [Green Version]
- Kevresan, S.; Petrovic, N.; Popovic, M.; Kandrac, J. Nitrogen and protein metabolism in young pea plants as affected by different concentrations of nickel, cadmium, lead, and molybdenum. J. Plant Nutr. 2001, 24, 1633–1644. [Google Scholar] [CrossRef]
- Cao, F.; Wang, R.; Cheng, W.; Zeng, F.; Ahmed, I.M.; Hu, X.; Zhang, G.; Wu, F. Genotypic and environmental variation in cadmium, chromium, lead and copper in rice and approaches for reducing the accumulation. Sci. Total Environ. 2014, 496, 275–281. [Google Scholar] [CrossRef] [PubMed]
- Grant, C.; Clarke, J.; Duguid, S.; Chaney, R. Selection and breeding of plant cultivars to minimize cadmium accumulation. Sci. Total Environ. 2008, 390, 301–310. [Google Scholar] [CrossRef] [PubMed]
- Uraguchi, S.; Mori, S.; Kuramata, M.; Kawasaki, A.; Arao, T.; Ishikawa, S. Root-to-shoot Cd translocation via the xylem is the major process determining shoot and grain cadmium accumulation in rice. J. Exp. Bot. 2009, 60, 2677–2688. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bertoli, A.C.; Cannata, M.G.; Carvalho, R.; Bastos, A.R.R.; Freitas, M.P.; dos Santos Augusto, A. Lycopersicon esculentum submitted to Cd-stressful conditions in nutrition solution: Nutrient contents and translocation. Ecotoxicol. Environ. Saf. 2012, 86, 176–181. [Google Scholar] [CrossRef] [PubMed]
- Khan, A.; Khan, S.; Alam, M.; Khan, M.A.; Aamir, M.; Qamar, Z.; Rehman, Z.U.; Perveen, S. Toxic metal interactions affect the bioaccumulation and dietary intake of macro-and micro-nutrients. Chemosphere 2016, 146, 121–128. [Google Scholar] [CrossRef]
- Ismael, M.A.; Elyamine, A.M.; Zhao, Y.Y.; Moussa, M.G.; Rana, M.S.; Afzal, J.; Imran, M.; Zhao, X.H.; Hu, C.X. Can selenium and molybdenum restrain cadmium toxicity to pollen grains in Brassica napus? Int. J. Mol. Sci. 2018, 19, 2163. [Google Scholar] [CrossRef] [Green Version]
- Rana, M.S.; Hu, C.X.; Shaaban, M.; Imran, M.; Afzal, J.; Moussa, M.G.; Elyamine, A.M.; Bhantana, P.; Saleem, M.H.; Syaifudin, M. Soil phosphorus transformation characteristics in response to molybdenum supply in leguminous crops. J. Environ. Manag. 2020, 268, 110610. [Google Scholar] [CrossRef] [PubMed]
- Rana, M.S.; Sun, X.; Imran, M.; Ali, S.; Shaaban, M.; Moussa, M.G.; Khan, Z.; Afzal, J.; Binyamin, R.; Bhantana, P. Molybdenum-induced effects on leaf ultra-structure and rhizosphere phosphorus transformation in Triticum aestivum L. Plant Physiol. Biochem. 2020. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.; Hu, C.; Tan, Q.; Liu, J.; Liu, H. Effects of molybdenum on expression of cold-responsive genes in abscisic acid (ABA)-dependent and ABA-independent pathways in winter wheat under low-temperature stress. Ann. Bot. 2009, 104, 345–356. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Imran, M.; Hu, C.; Hussain, S.; Rana, M.S.; Riaz, M.; Afzal, J.; Aziz, O.; Elyamine, A.M.; Ismael, M.A.F.; Sun, X. Molybdenum-induced effects on photosynthetic efficacy of winter wheat (Triticum aestivum L.) under different nitrogen sources are associated with nitrogen assimilation. Plant Physiol. Biochem. 2019, 141, 154–163. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Hu, C.; Zhao, X.; Tan, Q.; Sun, X.; Cao, A.; Cui, M.; Zhang, Y. Molybdenum improves antioxidant and osmotic-adjustment ability against salt stress in Chinese cabbage (Brassica campestris L. ssp. Pekinensis). Plant Soil 2012, 355, 375–383. [Google Scholar] [CrossRef]
- Wu, S.; Hu, C.; Tan, Q.; Xu, S.; Sun, X. Nitric oxide mediates molybdenum-induced antioxidant defense in wheat under drought stress. Front. Plant Sci. 2017, 8, 1085. [Google Scholar] [CrossRef]
- Imran, M.; Sun, X.; Hussain, S.; Ali, U.; Rana, M.S.; Rasul, F.; Shaukat, S.; Hu, C. Molybdenum Application Regulates Oxidative Stress Tolerance in Winter Wheat Under Different Nitrogen Sources. J. Soil Sci. Plant Nutr. 2020, 1–11. [Google Scholar] [CrossRef]
- Rizwan, M.; Mostofa, M.G.; Ahmad, M.Z.; Imtiaz, M.; Mehmood, S.; Adeel, M.; Dai, Z.; Li, Z.; Aziz, O.; Zhang, Y. Nitric oxide induces rice tolerance to excessive nickel by regulating nickel uptake, reactive oxygen species detoxification and defense-related gene expression. Chemosphere 2018, 191, 23–35. [Google Scholar] [CrossRef]
- Saleem, M.H.; Ali, S.; Rehman, M.; Rana, M.S.; Rizwan, M.; Kamran, M.; Imran, M.; Riaz, M.; Soliman, M.H.; Elkelish, A. Influence of phosphorus on copper phytoextraction via modulating cellular organelles in two jute (Corchorus capsularis L.) varieties grown in a copper mining soil of Hubei Province, China. Chemosphere 2020, 126032. [Google Scholar] [CrossRef]
- Saleem, M.H.; Ali, S.; Rehman, M.; Hasanuzzaman, M.; Rizwan, M.; Irshad, S.; Shafiq, F.; Iqbal, M.; Alharbi, B.M.; Alnusaire, T.S. Jute: A Potential Candidate for Phytoremediation of Metals—A Review. Plants 2020, 9, 258. [Google Scholar] [CrossRef] [Green Version]
- Ali, N.; Hadi, F. CBF/DREB transcription factor genes play role in cadmium tolerance and phytoaccumulation in Ricinus communis under molybdenum treatments. Chemosphere 2018, 208, 425–432. [Google Scholar] [CrossRef] [PubMed]
- Bryant, R.; McClung, A. Volatile profiles of aromatic and non-aromatic rice cultivars using SPME/GC–MS. Food Chem. 2011, 124, 501–513. [Google Scholar] [CrossRef]
- Kanu, A.S.; Ashraf, U.; Mo, Z.; Baggie, I.; Charley, C.S.; Tang, X. Calcium amendment improved the performance of fragrant rice and reduced metal uptake under cadmium toxicity. Environ. Sci. Pollut. Res. 2019, 26, 24748–24757. [Google Scholar] [CrossRef] [PubMed]
- Kanu, A.S.; Ashraf, U.; Mo, Z.; Fuseini, I.; Mansaray, L.R.; Duan, M.; Pan, S.; Tang, X. Cadmium uptake and distribution in fragrant rice genotypes and related consequences on yield and grain quality traits. J. Chem. 2017, 2017, 1405878. [Google Scholar] [CrossRef]
- Yoshida, S.; Forno, D.A.; Cock, J.H. Laboratory Manual for Physiological Studies of Rice; International Rice Research Institute: Los Baños, Philippines, 1971. [Google Scholar]
- Filipiak-Szok, A.; Kurzawa, M.; Szłyk, E. Determination of toxic metals by ICP-MS in Asiatic and European medicinal plants and dietary supplements. J. Trace Elem. Med. Biol. 2015, 30, 54–58. [Google Scholar] [CrossRef]
- Liu, L.; Xiao, W.; Li, L.; Li, D.-M.; Gao, D.-S.; Zhu, C.-y.; Fu, X.-L. Effect of exogenously applied molybdenum on its absorption and nitrate metabolism in strawberry seedlings. Plant Physiol. Biochem. 2017, 115, 200–211. [Google Scholar] [CrossRef]
- Imran, M.; Sun, X.; Hussain, S.; Ali, U.; Rana, M.S.; Rasul, F.; Saleem, M.H.; Moussa, M.G.; Bhantana, P.; Afzal, J. Molybdenum-Induced Effects on Nitrogen Metabolism Enzymes and Elemental Profile of Winter Wheat (Triticum aestivum L.) Under Different Nitrogen Sources. Int. J. Mol. Sci. 2019, 20, 3009. [Google Scholar] [CrossRef] [Green Version]
- Bates, L.S.; Waldren, R.P.; Teare, I. Rapid determination of free proline for water-stress studies. Plant Soil 1973, 39, 205–207. [Google Scholar] [CrossRef]
- Valentovic, P.; Luxova, M.; Kolarovic, L.; Gasparikova, O. Effect of osmotic stress on compatible solutes content, membrane stability and water relations in two maize cultivars. Plant Soil Environ. 2006, 52, 184. [Google Scholar]
- Wu, S.; Hu, C.; Tan, Q.; Nie, Z.; Sun, X. Effects of molybdenum on water utilization, antioxidative defense system and osmotic-adjustment ability in winter wheat (Triticum aestivum) under drought stress. Plant Physiol. Biochem. 2014, 83, 365–374. [Google Scholar] [CrossRef]
- Imran, M.; Sun, X.; Hussain, S.; Rana, M.S.; Saleem, M.H.; Riaz, M.; Tang, X.; Khan, I.; Hu, C. Molybdenum supply increases root system growth of winter wheat by enhancing nitric oxide accumulation and expression of NRT genes. Plant Soil 2020, 1–14. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Bhattacharjee, S.; Mukherjee, A. Influence of cadmium and lead on physiological and biochemical responses of Vigna unguiculata (L). Walp. Seedling germination behaviour, total protein, proline content and protease activity. Pollut. Res. 1994, 13, 269–277. [Google Scholar]
- John, R.; Ahmad, P.; Gadgil, K.; Sharma, S. Heavy metal toxicity: Effect on plant growth, biochemical parameters and metal accumulation by Brassica juncea L. Int. J. Plant Prod. 2009, 3, 66–75. [Google Scholar]
- Korshunova, Y.O.; Eide, D.; Clark, W.G.; Guerinot, M.L.; Pakrasi, H.B. The IRT1 protein from Arabidopsis thaliana is a metal transporter with a broad substrate range. Plant Mol. Biol. 1999, 40, 37–44. [Google Scholar] [CrossRef] [PubMed]
- Wong, C.K.E.; Cobbett, C.S. HMA P-type ATPases are the major mechanism for root-to-shoot Cd translocation in Arabidopsis thaliana. New Phytol. 2009, 181, 71–78. [Google Scholar] [CrossRef]
- Wong, C.K.E.; Jarvis, R.S.; Sherson, S.M.; Cobbett, C.S. Functional analysis of the heavy metal binding domains of the Zn/Cd-transporting ATPase, HMA2, in Arabidopsis thaliana. New Phytol. 2009, 181, 79–88. [Google Scholar] [CrossRef]
- Verret, F.; Gravot, A.; Auroy, P.; Leonhardt, N.; David, P.; Nussaume, L.; Vavasseur, A.; Richaud, P. Overexpression of AtHMA4 enhances root-to-shoot translocation of zinc and cadmium and plant metal tolerance. FEBS Lett. 2004, 576, 306–312. [Google Scholar] [CrossRef] [Green Version]
- Padmaja, K.; Prasad, D.; Prasad, A. Inhibition of chlorophyll synthesis in Phaseolus vulgaris L. seedlings by cadmium acetate. Photosynthetica 1990, 24, 399–405. [Google Scholar]
- Min, Y.; Hu, C.-X.; Wang, Y.-H. Effects of molybdenum on the intermediates of chlorophyll biosynthesis in winter wheat cultivars under low temperature. Agric. Sci. China 2006, 5, 670–677. [Google Scholar]
- Palma, J.M.; Sandalio, L.M.; Corpas, F.J.; Romero-Puertas, M.C.; McCarthy, I.; Luis, A. Plant proteases, protein degradation, and oxidative stress: Role of peroxisomes. Plant Physiol. Biochem. 2002, 40, 521–530. [Google Scholar] [CrossRef]
- Romero-Puertas, M.; Palma, J.; Gómez, M.; Del Rio, L.; Sandalio, L. Cadmium causes the oxidative modification of proteins in pea plants. Plant Cell Environ. 2002, 25, 677–686. [Google Scholar] [CrossRef]
- Ahmad, P.; Hashem, A.; Abd-Allah, E.F.; Alqarawi, A.; John, R.; Egamberdieva, D.; Gucel, S. Role of Trichoderma harzianum in mitigating NaCl stress in Indian mustard (Brassica juncea L.) through antioxidative defense system. Front. Plant Sci. 2015, 6, 868. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Riaz, M.; Yan, L.; Wu, X.; Hussain, S.; Aziz, O.; Wang, Y.; Imran, M.; Jiang, C. Boron alleviates the aluminum toxicity in trifoliate orange by regulating antioxidant defense system and reducing root cell injury. J. Environ. Manag. 2018, 208, 149–158. [Google Scholar] [CrossRef]
- Li, L.; Wei, X.; JI, M.-l.; Chao, Y.; Ling, L.; GAO, D.-s.; FU, X.-l. Effects of molybdenum on nutrition, quality, and flavour compounds of strawberry (Fragaria× ananassa Duch. cv. Akihime) fruit. J. Integr. Agric. 2017, 16, 1502–1512. [Google Scholar] [CrossRef]
- Wu, S.; Hu, C.; Yang, X.; Tan, Q.; Yao, S.; Zhou, Y.; Wang, X.; Sun, X. Alterations of glycerolipidome induced by molybdenum conferred drought tolerance of wheat. J. Exp. Bot. 2020, 71, 5074–5086. [Google Scholar] [CrossRef]
- Alscher, R.G.; Erturk, N.; Heath, L.S. Role of superoxide dismutases (SODs) in controlling oxidative stress in plants. J. Exp. Bot. 2002, 53, 1331–1341. [Google Scholar] [CrossRef]
- Asada, K. Ascorbate peroxidase–a hydrogen peroxide-scavenging enzyme in plants. Physiol. Plant. 1992, 85, 235–241. [Google Scholar] [CrossRef]
- Monostori, P.; Wittmann, G.; Karg, E.; Túri, S. Determination of glutathione and glutathione disulfide in biological samples: An in-depth review. J. Chromatogr. B 2009, 877, 3331–3346. [Google Scholar] [CrossRef]
- Bernard, F.; Brulle, F.; Dumez, S.; Lemiere, S.; Platel, A.; Nesslany, F.; Cuny, D.; Deram, A.; Vandenbulcke, F. Antioxidant responses of Annelids, Brassicaceae and Fabaceae to pollutants: A review. Ecotoxicol. Environ. Saf. 2015, 114, 273–303. [Google Scholar] [CrossRef]
- Parveen, A.; Saleem, M.H.; Kamran, M.; Haider, M.Z.; Chen, J.-T.; Malik, Z.; Rana, M.S.; Hassan, A.; Hur, G.; Javed, M.T. Effect of Citric Acid on Growth, Ecophysiology, Chloroplast Ultrastructure, and Phytoremediation Potential of Jute (Corchorus capsularis L.) Seedlings Exposed to Copper Stress. Biomolecules 2020, 10, 592. [Google Scholar] [CrossRef] [PubMed]
- Saleem, M.H.; Kamran, M.; Zhou, Y.; Parveen, A.; Rehman, M.; Ahmar, S.; Malik, Z.; Mustafa, A.; Anjum, R.M.A.; Wang, B. Appraising growth, oxidative stress and copper phytoextraction potential of flax (Linum usitatissimum L.) grown in soil differentially spiked with copper. J. Environ. Manag. 2020, 257, 109994. [Google Scholar] [CrossRef] [PubMed]
Genes | Strand | 5’ to 3’ Primer Sequences | Annealing Temperature (Tm) | Accession no. |
---|---|---|---|---|
OsSOD | Forward | TGTCAACTGGACCACACTTC | 58 °C | Os07g0665200 |
Reverse | ACTTAAAACGCATGCACTCA | |||
OsPOD | Forward | CGACGATTTCTACGACTACAT | 59 °C | Os10g0109600 |
Reverse | TGATTGAGGAGGTTCTGGT | |||
OsCAT | Forward | GCACAGTTTGACAGGGAG | 55 °C | Os06g51150 |
Reverse | GTCTTTGGACTTGGCTTG | |||
OsAPX | Forward | TACGCCGACTTCTACCAGC | 57 °C | Os07g0694700 |
Reverse | TTTATTACAACCGCCACGA | |||
ACTIN | Forward | TGCCAAGGCTGAGTACGACGA | 58 °C | Os03g50885 |
Reverse | CAAGCAGGAGGACGGCGATA |
Rice Cultivars | Treatments | Plant Growth (cm) | Plant Biomass (g plant−1) | ||
---|---|---|---|---|---|
Shoot Length | Root Length | Fresh Weight | Dry Weight | ||
Guixiangzhan | Mo − Cd− | 21.05 ± 1.09 c | 7.30 ± 0.73 c | 0.59 ± 0.026 c,d | 0.17 ± 0.014 c |
Mo + Cd− | 30.91 ± 1.78 a | 11.31 ± 0.68 a | 1.13 ± 0.084 a | 0.32 ± 0.027 a | |
Mo − Cd+ | 10.71 ± 0.69 d,e | 3.88 ± 0.35 e,f | 0.39 ± 0.038 e,f | 0.11 ± 0.006 d,e | |
Mo + Cd+ | 14.51 ± 1.36 d | 5.34 ± 0.61 d,e | 0.68 ± 0.060 c | 0.18 ± 0.011 c | |
Meixiangzhan-2 | Mo − Cd− | 18.63 ± 1.55 c | 6.25 ± 0.32 c,d | 0.50 ± 0.033 d,e | 0.14 ± 0.011 c,d |
Mo + Cd− | 25.75 ± 2.14 b | 9.01 ± 0.53 b | 0.89 ± 0.106 b | 0.25 ± 0.021 b | |
Mo − Cd+ | 9.76 ± 0.75 e | 3.58 ± 0.31 f | 0.29 ± 0.024 f | 0.08 ± 0.005 e | |
Mo + Cd+ | 12.19 ± 0.84 d,e | 4.69 ± 0.35 e,f | 0.48 ± 0.018 d,e | 0.13 ± 0.008 d |
Rice Cultivars | Treatments | Mo Concentrations (µg g−1 DW) | Cd Concentrations (µg g−1 DW) | ||
---|---|---|---|---|---|
Root | Shoot | Root | Shoot | ||
Guixiangzhan | Mo − Cd− | 0.18 ± 0.01 c | 0.30 ± 0.04 c | 1.98 ± 0.26 d | 0.71 ± 0.05 d |
Mo + Cd− | 2.41 ± 0.17 a,b | 3.44 ± 0.11 a,b | 1.77 ± 0.13 d | 0.69 ± 0.07 d | |
Mo − Cd+ | 0.20 ± 0.02 c | 0.32 ± 0.02 c | 391.73 ± 21.98 a | 68.96 ± 7.10 a,b | |
Mo + Cd+ | 2.68 ± 0.24 a | 3.85 ± 0.43 a | 309.78 ± 26.62 b,c | 51.95 ± 2.74 c | |
Meixiangzhan-2 | Mo − Cd− | 0.15 ± 0.01 c | 0.23 ± 0.03 c | 1.57 ± 0.18 d | 0.69 ± 0.04 d |
Mo + Cd− | 2.29 ± 0.13 b | 3.07 ± 0.07 b | 1.44 ± 0.11 d | 0.72 ± 0.05 d | |
Mo − Cd+ | 0.17 ± 0.01 c | 0.24 ± 0.02 c | 332.77 ± 27.54 b | 78.22 ± 4.91 a | |
Mo + Cd+ | 2.62 ± 0.17 a,b | 3.40 ± 0.22 a,b | 282.50 ± 15.34 c | 64.15 ± 4.98 b |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Imran, M.; Hussain, S.; El-Esawi, M.A.; Rana, M.S.; Saleem, M.H.; Riaz, M.; Ashraf, U.; Potcho, M.P.; Duan, M.; Rajput, I.A.; et al. Molybdenum Supply Alleviates the Cadmium Toxicity in Fragrant Rice by Modulating Oxidative Stress and Antioxidant Gene Expression. Biomolecules 2020, 10, 1582. https://doi.org/10.3390/biom10111582
Imran M, Hussain S, El-Esawi MA, Rana MS, Saleem MH, Riaz M, Ashraf U, Potcho MP, Duan M, Rajput IA, et al. Molybdenum Supply Alleviates the Cadmium Toxicity in Fragrant Rice by Modulating Oxidative Stress and Antioxidant Gene Expression. Biomolecules. 2020; 10(11):1582. https://doi.org/10.3390/biom10111582
Chicago/Turabian StyleImran, Muhammad, Saddam Hussain, Mohamed A. El-Esawi, Muhammad Shoaib Rana, Muhammad Hamzah Saleem, Muhammad Riaz, Umair Ashraf, Mouloumdema Pouwedeou Potcho, Meiyang Duan, Imran Ali Rajput, and et al. 2020. "Molybdenum Supply Alleviates the Cadmium Toxicity in Fragrant Rice by Modulating Oxidative Stress and Antioxidant Gene Expression" Biomolecules 10, no. 11: 1582. https://doi.org/10.3390/biom10111582