Characterization of Third Generation Cephalosporin- and Carbapenem-Resistant Aeromonas Isolates from Municipal and Hospital Wastewater
Abstract
1. Introduction
2. Results
2.1. Identification, AR Profiles and ß-Lactamase Production in Aeromonas isolates
2.2. Detection of ESBL, AmpC and Carbapenemase Genes
2.3. Enterobacterial Repetitive Intergenic Consensus Polymerase Chain Reaction (ERIC-PCR) Fingerprinting
2.4. Conjugal Transfer of Carbapenem Resistance and Genotypic Characterization of Captured Plasmids
3. Discussion
4. Materials and Methods
4.1. Wastewater Sampling
4.2. Isolation of 3GC- and Carbapenem-Resistant Aeromonas
4.3. Identification of Isolates
4.4. Antibiotic Susceptibility Testing and Phenotypic Identification of ESBLs, pAmpC and Carbapenemases
4.5. Genomic and Plasmid DNA Extraction
4.6. Detection of Target ARGs by PCR and Sanger Sequencing of the Amplicons
4.7. Plasmid Replicon Typing
| Target Gene | Primer Name | Primer Nucleotide Sequence (5′–3′) | Amplicon Size (bp) | PCR Conditions | Reference | |
|---|---|---|---|---|---|---|
| Carbapenemases | blaKPC | KPC-F | AGTTCTGCTGTCTTGTCT | 793 | Initial denaturation step at 94 °C for 2:30 min; 30 cycles of 94 °C for 20 s, annealing temperature: 57 °C for blaKPC, blaVIM, blaOXA-48, 55 °C for blaIMP, 58 °C for blaNDM for 25 s; 72 °C for 45 s; final extension 72 °C for 2 min | [67] |
| KPC-R | CTTGTCATCCTTGTTAGGC | |||||
| blaVIM | VIM MJ-F | GGTGAGTATCCGACAGTC | 442 | |||
| VIM-MJ-R | CAGCACCRGGATAGAAGAG | |||||
| blaIMP | IMP MJ-F1 | GGYGTTTATGTTCATACWTC | 235 | |||
| IMP MJ-R1 | GGATYGAGAATTAAGCCACTC | |||||
| blaOXA-48 | OXA-48A | TTGGTGGCATCGATTATCGG | 744 | [68] | ||
| OXA-48B | GAGCACTTCTTTTGTGATGGC | |||||
| blaNDM | NDM-F | TGGCAGCACACTTCCTATC | 813 | [69] | ||
| NDM-R | AGATTGCCGAGCGACTTG | |||||
| blaCTX-M | blaCTX-M-1 | M13U | GGTTAAAAAATCACTGCGTC | 864 | Initial denaturation step at 94 °C for 2:30 min; 30 cycles of 94 °C for 20 s, annealing temperature: 55 °C for 25 s; 72 °C for 45 s; final extension 72 °C for 2 min | [70] |
| M13L | TTGGTGACGATTTTAGCCGC | |||||
| blaCTX-M-2 | M25U | ATGATGACTCAGAGCATTCG | 866 | |||
| M25L | TGGGTTACGATTTTCGCCGC | |||||
| blaCTX-M-9 | M9U | ATGGTGACAAAGAGAGTGCA | 870 | |||
| M9L | CCCTTCGGCGATGATTCTC | |||||
| ESBL-multiplex 1 | blaTEM | TEM-F | GCGGTAAGATCCTTGAGAGT | 620 | Initial denaturation step at 94 °C for 2:30 min; 35 cycles of 94 °C for 30 s, annealing temperature: 55 °C for 30 s; 72 °C for 45 s; final extension 72 °C for 2 min | [67] |
| TEM-R | TACGATACGGGAGGGCTTA | |||||
| blaSHV | SHV-F | TTCGCCTGTGTATTATCTCC | 494 | |||
| SHV-R | CGCCTCATTCAGTTCCG | |||||
| blaPER | PER-F | CTGGGCTCCGATAATGA | 349 | |||
| PER-R | CTGGTCGCCWATGATGA | |||||
| ESBL-multiplex 2 | blaVEB | VEB-F | ATGCCAGAATAGGAGTAGC | 673 | Initial denaturation step at 94 °C for 2:30 min; 35 cycles of 94 °C for 30 s, annealing temperature: 58 °C for 30 s; 72 °C for 45 s; final extension 72 °C for 2 min | |
| VEB-R | AATTGTCCATTCGGTAAAGTAAT | |||||
| blaGES | GES-F | CTAGCATCGGGACACAT | 504 | |||
| GES-R | GACAGAGGCAACTAATTCG | |||||
| blaSME | SME-F | GCTCAGGTATGACATTAGGT | 350 | |||
| SME-R | CCAATCAGCAGGAACACTA | |||||
| AmpC- multiplex | blaFOX | FOX-F | AACATGGGGTATCAGGGAGATG | 190 | Initial denaturation step at 94 °C for 2:30 min; 35 cycles of 94 °C for 30 s, annealing temperature: 55 °C for 30 s; 72 °C for 45 s; final extension 72 °C for 2 min | [71] |
| FOX-R | CAAAGCGCGTAACCGGATTGG | |||||
| blaEBC | EBC-F | TCGGTAAAGCCGATGTTGCGG | 302 | |||
| EBC-R | CTTCCACTGCGGCTGCCAGTT | |||||
| blaCIT | CIT-F | TGGCCAGAACTGACAGGCAAA | 462 | |||
| CIT-R | TTTCTCCTGAACGTGGCTGGC | |||||
| blaACC | ACC-F | AACAGCCTCAGCAGCCGGTTA | 346 | |||
| ACC-R | TTCGCCGCAATCATCCCTAGC | |||||
| blaDHA | DHA-F | AACTTTCACAGGTGTGCTGGGT | 405 | |||
| DHA-R | CCGTACGCATACTGGCTTTGC | |||||
| blaMOX | MOX-F | GCTGCTCAAGGAGCACAGGAT | 520 | |||
| MOX-R | CACATTGACATAGGTGTGGTGC | |||||
| mcr-multiplex | mcr-1 | mcr-1-F | AGTCCGTTTGTTCTTGTGGC | 320 | Initial denaturation step at 94 °C for 15 min; 25 cycles of 94 °C for 30 s, annealing temperature: 58 °C for 1:30 min; 72 °C for 1 min; final extension 72 °C for 10 min | [72] |
| mcr-1-R | AGATCCTTGGTCTCGGCTTG | |||||
| mcr-2 | mcr-2-F | CAAGTGTGTTGGTCGCAGTT | 715 | |||
| mcr-2-R | TCTAGCCCGACAAGCATACC | |||||
| mcr-3 | mcr-3-F | AAATAAAAATTGTTCCGCTTATG | 929 | |||
| mcr-3-R | AATGGAGATCCCCGTTTTT | |||||
| mcr-4 | mcr-4-F | TCACTTTCATCACTGCGTTG | 1116 | |||
| mcr-4-R | TTGGTCCATGACTACCAATG | |||||
| mcr-5 | mcr-5-F | ATGCGGTTGTCTGCATTTATC | 1664 | |||
| mcr-5-R | TCATTGTGGTTGTCCTTTTCTG | |||||
4.8. ERIC-PCR
4.9. Conjugation Assay
4.10. Data Accessibillity
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hernando-Amado, S.; Coque, T.M.; Baquero, F.; Martínez, J.L. Defining and Combating Antibiotic Resistance from One Health and Global Health Perspectives. Nat. Microbiol. 2019, 4, 1432–1442. [Google Scholar] [CrossRef] [Scilit]
- Brown, K.D.; Kulis, J.; Thomson, B.; Chapman, T.H.; Mawhinney, D.B. Occurrence of Antibiotics in Hospital, Residential, and Dairy Effluent, Municipal Wastewater, and the Rio Grande in New Mexico. Sci. Total Environ. 2006, 366, 772–783. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Picão, R.C.; Cardoso, J.P.; Campana, E.H.; Nicoletti, A.G.; Petrolini, F.V.B.; Assis, D.M.; Juliano, L.; Gales, A.C. The Route of Antimicrobial Resistance from the Hospital Effluent to the Environment: Focus on the Occurrence of KPC-Producing Aeromonas spp. and Enterobacteriaceae in Sewage. Diagn. Microbiol. Infect. Dis 2013, 76, 80–85. [Google Scholar] [CrossRef] [Scilit]
- Rizzo, L.; Manaia, C.; Merlin, C.; Schwartz, T.; Dagot, C.; Ploy, M.C.; Michael, I.; Fatta-Kassinos, D. Urban Wastewater Treatment Plants as Hotspots for Antibiotic Resistant Bacteria and Genes Spread into the Environment: A Review. Sci. Total Environ. 2013, 447, 345–360. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Figueira, V.; Vaz-Moreira, I.; Silva, M.; Manaia, C.M. Diversity and Antibiotic Resistance of Aeromonas spp. in Drinking and Waste Water Treatment Plants. Water Res. 2011, 45, 5599–5611. [Google Scholar] [CrossRef] [Scilit]
- Goñi-Urriza, M.; Capdepuy, M.; Arpin, C.; Raymond, N.; Caumette, P.; Quentin, C. Impact of an Urban Effluent on Antibiotic Resistance of Riverine Enterobacteriaceae and Aeromonas spp. Appl. Environ. Microbiol. 2000, 66, 125–132. [Google Scholar] [CrossRef] [Scilit]
- Grilo, M.L.; Sousa-Santos, C.; Robalo, J.; Oliveira, M. The Potential of Aeromonas spp. from Wildlife as Antimicrobial Resistance Indicators in Aquatic Environments. Ecol. Indic. 2020, 115, 106396. [Google Scholar] [CrossRef] [Scilit]
- Varela, A.R.; Nunes, O.C.; Manaia, C.M. Quinolone Resistant Aeromonas spp. as Carriers and Potential Tracers of Acquired Antibiotic Resistance in Hospital and Municipal Wastewater. Sci. Total Environ. 2016, 542, 665–671. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Figueras, M.J.; Guarro, J.; Martinez-Murcia, A. Clinically Relevant Aeromonas Species. Clin. Infect. Dis. 2000, 30, 988–989. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maravić, A.; Skočibušić, M.; Šamanić, I.; Fredotović, Ž.; Cvjetan, S.; Jutronić, M.; Puizina, J. Aeromonas spp. Simultaneously Harbouring blaCTX-M-15, blaSHV-12, blaPER-1 and blaFOX-2, in Wild-Growing Mediterranean Mussel (Mytilus galloprovincialis) from Adriatic Sea, Croatia. Int. J. Food Microbiol. 2013, 166, 301–308. [Google Scholar] [CrossRef] [Scilit]
- Janda, J.M.; Abbott, S.L. The Genus Aeromonas: Taxonomy, Pathogenicity, and Infection. Clin. Microbiol. Rev. 2010, 23, 35–73. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lamy, B.; Kodjo, A.; Laurent, F. Prospective Nationwide Study of Aeromonas Infections in France. J. Clin. Microbiol. 2009, 47, 1234–1237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fernández-Bravo, A.; Figueras, M.J. An Update on the Genus Aeromonas: Taxonomy, Epidemiology, and Pathogenicity. Microorganisms 2020, 8, 129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Piotrowska, M.; Przygodzińska, D.; Matyjewicz, K.; Popowska, M. Occurrence and Variety of β-Lactamase Genes among Aeromonas spp. Isolated from Urban Wastewater Treatment Plant. Front. Microbiol. 2017, 8, 863. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Liu, H.; Zhang, L.; Sun, B. Application of Modified Carbapenem Inactivation Method and Its Derivative Tests for the Detection of Carbapenemase-Producing Aeromonas. Infect. Drug Resist. 2021, 14, 3949–3960. [Google Scholar] [CrossRef] [Scilit]
- Sinclair, H.A.; Heney, C.; Sidjabat, H.E.; George, N.M.; Bergh, H.; Anuj, S.N.; Nimmo, G.R.; Paterson, D.L. Genotypic and Phenotypic Identification of Aeromonas Species and CphA-Mediated Carbapenem Resistance in Queensland, Australia. Diagn. Microbiol. Infect. Dis. 2016, 85, 98–101. [Google Scholar] [CrossRef] [Scilit]
- Wu, C.-J.; Chen, P.-L.; Wu, J.-J.; Yan, J.-J.; Lee, C.-C.; Lee, H.-C.; Lee, N.-Y.; Chang, C.-M.; Lin, Y.-T.; Chiu, Y.-C.; et al. Distribution and Phenotypic and Genotypic Detection of a Metallo-β-Lactamase, CphA, among Bacteraemic Aeromonas Isolates. J. Med. Microbiol. 2012, 61, 712–719. [Google Scholar] [CrossRef] [Scilit]
- Sekizuka, T.; Inamine, Y.; Segawa, T.; Hashino, M.; Yatsu, K.; Kuroda, M. Potential KPC-2 Carbapenemase Reservoir of Environmental Aeromonas hydrophila and Aeromonas caviae Isolates from the Effluent of an Urban Wastewater Treatment Plant in Japan. Environ. Microbiol. Rep. 2019, 11, 589–597. [Google Scholar] [CrossRef] [Scilit]
- Hu, X.; Yu, X.; Shang, Y.; Xu, H.; Guo, L.; Liang, Y.; Kang, Y.; Song, L.; Sun, J.; Yue, F.; et al. Emergence and Characterization of a Novel IncP-6 Plasmid Harboring blaKPC–2 and qnrS2 Genes in Aeromonas taiwanensis Isolates. Front. Microbiol. 2019, 10, 2132. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Qiu, Y.; Fang, C.; Dai, X.; Zhang, L. Genomic Characterization of a Multidrug-Resistant Aeromonas caviae Isolate Carrying a Novel blaKPC-2 -Harbouring Plasmid and an IMP-4-Encoding Phage-like Plasmid. Microbiol. Spectr. 2022, 10, e00840-22. [Google Scholar] [CrossRef] [Scilit]
- Adler, A.; Assous, M.V.; Paikin, S.; Shulman, A.; Miller-Roll, T.; Hillel, S.; Aronov, R.; Carmeli, Y.; Schwaber, M.J. Emergence of VIM-Producing Aeromonas caviae in Israeli Hospitals. J. Antimicrob. Chemother. 2014, 69, 1211–1214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bosch, T.; Schade, R.; Landman, F.; Schouls, L.; van Dijk, K. A blaVIM-1 Positive Aeromonas hydrophila Strain in a near-Drowning Patient: Evidence for Interspecies Plasmid Transfer within the Patient. Future Microbiol. 2019, 14, 1191–1197. [Google Scholar] [CrossRef] [Scilit]
- Walsh, T.R.; Weeks, J.; Livermore, D.M.; Toleman, M.A. Dissemination of NDM-1 Positive Bacteria in the New Delhi Environment and Its Implications for Human Health: An Environmental Point Prevalence Study. Lancet Infect. Dis. 2011, 11, 355–362. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, S.; Tu, J.; Zhang, L.; Chen, Y.; Dong, X.; Chi, X.; Xu, H. Detection of NDM-1-Positive Aeromonas caviae from Bacteremia by Using Whole-Genome Sequencing. Infect. Drug Resist. 2022, 15, 2835–2841. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, X.; Mu, K.; Zhao, Y.; Zhang, J.; Qu, Y.; Hu, D.; Jia, Y.; Dai, P.; Weng, J.; Wang, D.; et al. Emergence of blaNDM– 1-Carrying Aeromonas caviae K433 Isolated from Patient with Community-Acquired Pneumonia. Front. Microbiol. 2022, 13, 825389. [Google Scholar] [CrossRef] [Scilit]
- Chen, Q.; Zhou, W.; Qian, C.; Shen, K.; Zhu, X.; Zhou, D.; Sun, Z.; Lu, W.; Liu, H.; Li, K.; et al. OXA-830, a Novel Chromosomally Encoded Extended-Spectrum Class D β-Lactamase in Aeromonas simiae. Front. Microbiol. 2019, 10, 2732. [Google Scholar] [CrossRef] [Scilit]
- Ye, Y.; Xu, X.-H.; Li, J.-B. Emergence of CTX-M-3, TEM-1 and a New Plasmid-Mediated MOX-4 AmpC in a Multiresistant Aeromonas caviae Isolate from a Patient with Pneumonia. J. Med. Microbiol 2010, 59, 843–847. [Google Scholar] [CrossRef] [Scilit]
- Girlich, D.; Poirel, L.; Nordmann, P. Diversity of Clavulanic Acid-Inhibited Extended-Spectrum β-Lactamases in Aeromonas spp. from the Seine River, Paris, France. Antimicrob. Agents Chemother. 2011, 55, 1256–1261. [Google Scholar] [CrossRef] [Scilit]
- Conte, D.; Palmeiro, J.K.; Bavaroski, A.A.; Rodrigues, L.S.; Cardozo, D.; Tomaz, A.P.; Camargo, J.O.; Dalla-Costa, L.M. Antimicrobial Resistance in Aeromonas Species Isolated from Aquatic Environments in Brazil. J. Appl. Microbiol. 2021, 131, 169–181. [Google Scholar] [CrossRef] [Scilit]
- Mathys, D.A.; Mollenkopf, D.F.; Feicht, S.M.; Adams, R.J.; Albers, A.L.; Stuever, D.M.; Grooters, S.V.; Ballash, G.A.; Daniels, J.B.; Wittum, T.E. Carbapenemase-Producing Enterobacteriaceae and Aeromonas spp. Present in Wastewater Treatment Plant Effluent and Nearby Surface Waters in the US. PLoS ONE 2019, 14, e0218650. [Google Scholar] [CrossRef] [Scilit]
- Shin, H.B.; Yoon, J.; Lee, Y.; Kim, M.S.; Lee, K. Comparison of MALDI-TOF MS, Housekeeping Gene Sequencing, and 16S RRNA Gene Sequencing for Identification of Aeromonas Clinical Isolates. Yonsei Med. J 2015, 56, 550. [Google Scholar] [CrossRef] [Scilit]
- Martone-Rocha, S.; Piveli, R.P.; Matté, G.R.; Dória, M.C.; Dropa, M.; Morita, M.; Peternella, F.A.; Matté, M.H. Dynamics of Aeromonas Species Isolated from Wastewater Treatment System. J. Water Health 2010, 8, 703–711. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Szczuka, E.; Kaznowski, A. Typing of Clinical and Environmental Aeromonas sp. Strains by Random Amplified Polymorphic DNA PCR, Repetitive Extragenic Palindromic PCR, and Enterobacterial Repetitive Intergenic Consensus Sequence PCR. J. Clin. Microbiol. 2004, 42, 220–228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maiti, B.; Raghunath, P.; Karunasagar, I.; Karunasagar, I. Typing of Clinical and Environmental Strains of Aeromonas spp. Using Two PCR Based Methods and Whole Cell Protein Analysis. J. Microbiol. Methods 2009, 78, 312–318. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Latif-Eugenín, F.; Beaz-Hidalgo, R.; Silvera-Simón, C.; Fernandez-Cassi, X.; Figueras, M.J. Chlorinated and Ultraviolet Radiation -Treated Reclaimed Irrigation Water Is the Source of Aeromonas Found in Vegetables Used for Human Consumption. Environ. Res. 2017, 154, 190–195. [Google Scholar] [CrossRef] [Scilit]
- Davin-Regli, A.; Bollet, C.; Chamorey, E.; Colonna D’Istria, V.; Cremieux, A. A Cluster of Cases of Infections Due to Aeromonas hydrophila Revealed by Combined RAPD and ERIC-PCR. J. Med. Microbiol. 1998, 47, 499–504. [Google Scholar] [CrossRef] [Scilit]
- Ebmeyer, S.; Kristiansson, E.; Larsson, D.G.J. CMY-1/MOX-Family AmpC β-Lactamases MOX-1, MOX-2 and MOX-9 Were Mobilized Independently from Three Aeromonas Species. J. Antimicrob. Chemother. 2019, 74, 1202–1206. [Google Scholar] [CrossRef] [Scilit]
- Kämpfer, P.; Christmann, C.; Swings, J.; Huys, G. In Vitro Susceptibilities of Aeromonas Genomic Species to 69 Antimicrobial Agents. Syst. Appl. Microbiol. 1999, 22, 662–669. [Google Scholar] [CrossRef] [Scilit]
- Aravena-Román, M.; Inglis, T.J.J.; Henderson, B.; Riley, T.V.; Chang, B.J. Antimicrobial Susceptibilities of Aeromonas Strains Isolated from Clinical and Environmental Sources to 26 Antimicrobial Agents. Antimicrob. Agents Chemother. 2012, 56, 1110–1112. [Google Scholar] [CrossRef] [Scilit]
- Harnisz, M.; Korzeniewska, E. The Prevalence of Multidrug-Resistant Aeromonas spp. in the Municipal Wastewater System and Their Dissemination in the Environment. Sci. Total Environ. 2018, 626, 377–383. [Google Scholar] [CrossRef] [Scilit]
- Amos, G.C.A.; Hawkey, P.M.; Gaze, W.H.; Wellington, E.M. Waste Water Effluent Contributes to the Dissemination of CTX-M-15 in the Natural Environment. J. Antimicrob. Chemother. 2014, 69, 1785–1791. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Araujo, C.F.M.; Silva, D.M.; Carneiro, M.T.; Ribeiro, S.; Fontana-Maurell, M.; Alvarez, P.; Asensi, M.D.; Zahner, V.; Carvalho-Assef, A.P.D. Detection of Carbapenemase Genes in Aquatic Environments in Rio de Janeiro, Brazil. Antimicrob. Agents Chemother. 2016, 60, 4380–4383. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Montezzi, L.F.; Campana, E.H.; Corrêa, L.L.; Justo, L.H.; Paschoal, R.P.; da Silva, I.L.V.D.; Souza, M.d.C.M.; Drolshagen, M.; Picão, R.C. Occurrence of Carbapenemase-Producing Bacteria in Coastal Recreational Waters. Int. J. Antimicrob. Agents 2015, 45, 174–177. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dolejska, M.; Papagiannitsis, C.C. Plasmid-Mediated Resistance Is Going Wild. Plasmid 2018, 99, 99–111. [Google Scholar] [CrossRef] [Scilit]
- Chen, L.; Mathema, B.; Chavda, K.D.; DeLeo, F.R.; Bonomo, R.A.; Kreiswirth, B.N. Carbapenemase-Producing Klebsiella pneumoniae: Molecular and Genetic Decoding. Trends Microbiol. 2014, 22, 686–696. [Google Scholar] [CrossRef] [Scilit]
- Reyes, J.; Cárdenas, P.; Tamayo, R.; Villavicencio, F.; Aguilar, A.; Melano, R.G.; Trueba, G. Characterization of blaKPC-2 -Harboring Klebsiella pneumoniae Isolates and Mobile Genetic Elements from Outbreaks in a Hospital in Ecuador. Microbial. Drug Resist. 2021, 27, 752–759. [Google Scholar] [CrossRef] [Scilit]
- Kraftova, L.; Finianos, M.; Studentova, V.; Chudejova, K.; Jakubu, V.; Zemlickova, H.; Papagiannitsis, C.C.; Bitar, I.; Hrabak, J. Evidence of an Epidemic Spread of KPC-Producing Enterobacterales in Czech Hospitals. Sci. Rep. 2021, 11, 15732. [Google Scholar] [CrossRef] [Scilit]
- Haines, A.S.; Cheung, M.; Thomas, C.M. Evidence That IncG (IncP-6) and IncU Plasmids Form a Single Incompatibility Group. Plasmid 2006, 55, 210–215. [Google Scholar] [CrossRef] [Scilit]
- Wu, W.; Feng, Y.; Tang, G.; Qiao, F.; McNally, A.; Zong, Z. NDM Metallo-β-Lactamases and Their Bacterial Producers in Health Care Settings. Clin. Microbiol. Rev. 2019, 32, e00115-18. [Google Scholar] [CrossRef] [Scilit]
- Findlay, J.; Perreten, V.; Poirel, L.; Nordmann, P. Molecular Analysis of OXA-48-Producing Escherichia coli in Switzerland from 2019 to 2020. Eur. J. Clin. Microbiol. Infect. Dis. 2022, 41, 1355–1360. [Google Scholar] [CrossRef] [Scilit]
- Loconsole, D.; Accogli, M.; de Robertis, A.L.; Capozzi, L.; Bianco, A.; Morea, A.; Mallamaci, R.; Quarto, M.; Parisi, A.; Chironna, M. Emerging High-Risk ST101 and ST307 Carbapenem-Resistant Klebsiella pneumoniae Clones from Bloodstream Infections in Southern Italy. Ann. Clin. Microbiol. Antimicrob. 2020, 19, 24. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barry, K.E.; Wailan, A.M.; Sheppard, A.E.; Crook, D.; Vegesana, K.; Stoesser, N.; Parikh, H.I.; Sebra, R.; Mathers, A.J. Don’t Overlook the Little Guy: An Evaluation of the Frequency of Small Plasmids Co-Conjugating with Larger Carbapenemase Gene Containing Plasmids. Plasmid 2019, 103, 1–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, L.; Hu, H.; Chavda, K.D.; Zhao, S.; Liu, R.; Liang, H.; Zhang, W.; Wang, X.; Jacobs, M.R.; Bonomo, R.A.; et al. Complete Sequence of a KPC-Producing IncN Multidrug-Resistant Plasmid from an Epidemic Escherichia coli Sequence Type 131 Strain in China. Antimicrob. Agents Chemother. 2014, 58, 2422–2425. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Komeda, T.; Shrestha, S.; Sherchan, J.B.; Tohya, M.; Hishinuma, T.; Sherchand, J.B.; Tada, T.; Kirikae, T. Emergence of a Highly Colistin-Resistant Aeromonas jandaei Clinical Isolate Harbouring Four Genes Encoding Phosphoethanolamine Transferases in Nepal. Int. J. Antimicrob. Agents 2022, 59, 106544. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Xiao, G.; Zhou, W.; Yang, J.; Wang, Y.; Wu, Y.; Cheng, X.; Sun, Z. Various Novel Colistin Resistance Mechanisms Interact to Facilitate Adaptation of Aeromonas hydrophila to Complex Colistin Environments. Antimicrob. Agents Chemother. 2021, 65, e0007121. [Google Scholar] [CrossRef] [Scilit]
- Yin, W.; Li, H.; Shen, Y.; Liu, Z.; Wang, S.; Shen, Z.; Zhang, R.; Walsh, T.R.; Shen, J.; Wang, Y. Novel Plasmid-Mediated Colistin Resistance Gene mcr-3 in Escherichia coli. mBio 2017, 8, e00543-17. [Google Scholar] [CrossRef] [Scilit]
- Ma, S.; Sun, C.; Hulth, A.; Li, J.; Nilsson, L.E.; Zhou, Y.; Börjesson, S.; Bi, Z.; Bi, Z.; Sun, Q.; et al. Mobile Colistin Resistance Gene mcr-5 in Porcine Aeromonas hydrophila. J. Antimicrob. Chemother. 2018, 73, 1777–1780. [Google Scholar] [CrossRef] [Scilit]
- Eichhorn, I.; Feudi, C.; Wang, Y.; Kaspar, H.; Feßler, A.T.; Lübke-Becker, A.; Michael, G.B.; Shen, J.; Schwarz, S. Identification of Novel Variants of the Colistin Resistance Gene mcr-3 in Aeromonas spp. from the National Resistance Monitoring Programme GERM-Vet and from Diagnostic Submissions. J. Antimicrob. Chemother. 2018, 73, 1217–1221. [Google Scholar] [CrossRef] [Scilit]
- Gonzalez-Avila, L.U.; Loyola-Cruz, M.A.; Hernández-Cortez, C.; Bello-López, J.M.; Castro-Escarpulli, G. Colistin Resistance in Aeromonas spp. Int. J. Mol. Sci. 2021, 22, 5974. [Google Scholar] [CrossRef] [Scilit]
- Weisburg, W.G.; Barns, S.M.; Pelletier, D.A.; Lane, D.J. 16S Ribosomal DNA Amplification for Phylogenetic Study. J. Bacteriol. 1991, 173, 697–703. [Google Scholar] [CrossRef] [Scilit]
- European Committee on Antimicrobial Susceptibility Testing. Breakpoint tables for interpretation of MICs and zone diameters. In The European Committee on Antimicrobial Susceptibility Testing; Version 10.0; Universidade de Cabo Verde: Praia, Cabo Verde, 2020. [Google Scholar]
- Gupta, G.; Tak, V.; Mathur, P. Detection of AmpC β Lactamases in Gram-Negative Bacteria. J. Lab. Physicians 2014, 6, 001–006. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nordmann, P.; Poirel, L. Emerging Carbapenemases in Gram-Negative Aerobes. Clin. Microbiol. Infect. 2002, 8, 321–331. [Google Scholar] [CrossRef] [Scilit]
- Carattoli, A.; Bertini, A.; Villa, L.; Falbo, V.; Hopkins, K.L.; Threlfall, E.J. Identification of Plasmids by PCR-Based Replicon Typing. J. Microbiol. Methods 2005, 63, 219–228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- García-Fernández, A.; Fortini, D.; Veldman, K.; Mevius, D.; Carattoli, A. Characterization of Plasmids Harbouring qnrS1, qnrB2 and qnrB19 Genes in Salmonella. J. Antimicrob. Chemother. 2009, 63, 274–281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Poirel, L.; Bonnin, R.A.; Nordmann, P. Genetic Features of the Widespread Plasmid Coding for the Carbapenemase OXA-48. Antimicrob. Agents Chemother. 2012, 56, 559–562. [Google Scholar] [CrossRef] [Scilit]
- Jelić, M. Mechanisms of Antimicrobial Resistance in Carbapenem-Resistant Enterobacteriaceae; University of Zagreb: Zagreb, Croatia, 2018. [Google Scholar]
- Poirel, L.; Héritier, C.; Tolün, V.; Nordmann, P. Emergence of Oxacillinase-Mediated Resistance to Imipenem in Klebsiella pneumoniae. Antimicrob. Agents Chemother. 2004, 48, 15–22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Revathi, G.; Siu, L.K.; Lu, P.-L.; Huang, L.-Y. First Report of NDM-1-Producing Acinetobacter baumannii in East Africa. Int. J. Infect. Dis. 2013, 17, e1255–e1258. [Google Scholar] [CrossRef] [Scilit]
- Saladin, M.; Cao, V.T.B.; Lambert, T.; Donay, J.-L.; Herrmann, J.-L.; Ould-Hocine, Z.; Verdet, C.; Delisle, F.; Philippon, A.; Arlet, G. Diversity of CTX-M Î2-Lactamases and Their Promoter Regions from Enterobacteriaceae Isolated in Three Parisian Hospitals. FEMS Microbiol. Lett. 2002, 209, 161–168. [Google Scholar] [CrossRef] [Scilit]
- Pérez-Pérez, F.J.; Hanson, N.D. Detection of Plasmid-Mediated AmpC β-Lactamase Genes in Clinical Isolates by Using Multiplex PCR. J. Clin. Microbiol. 2002, 40, 2153–2162. [Google Scholar] [CrossRef] [Scilit]
- Rebelo, A.R.; Bortolaia, V.; Kjeldgaard, J.S.; Pedersen, S.K.; Leekitcharoenphon, P.; Hansen, I.M.; Guerra, B.; Malorny, B.; Borowiak, M.; Hammerl, J.A.; et al. Multiplex PCR for Detection of Plasmid-Mediated Colistin Resistance Determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for Surveillance Purposes. Eurosurveillance 2018, 23, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Versalovic, J.; Koeuth, T.; Lupski, J.R. Distribution of Repetitive DNA Sequences in Eubacteria and Application to Fingerpriting of Bacterial Genomes. Nucleic. Acids Res. 1991, 19, 6823–6831. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heras, J.; Domínguez, C.; Mata, E.; Pascual, V.; Lozano, C.; Torres, C.; Zarazaga, M. GelJ—A Tool for Analyzing DNA Fingerprint Gel Images. BMC Bioinform. 2015, 16, 270. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gekenidis, M.-T.; Kläui, A.; Smalla, K.; Drissner, D. Transferable Extended-Spectrum β-Lactamase (ESBL) Plasmids in Enterobacteriaceae from Irrigation Water. Microorganisms 2020, 8, 978. [Google Scholar] [CrossRef] [Scilit]
- Martin, B.; Humbert, O.; Camara, M.; Guenzi, E.; Walker, J.; Mitchell, T.; Andrew, P.; Prudhomme, M.; Alloing, G.; Hakenbeck, R.; et al. A Highly Conserved Repeated DNA Element Located in the Chromosome of Streptococcus pneumoniae. Nucleic Acids Res. 1992, 20, 3479–3483. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| Species | Isolates | Transconjugants | |||||
|---|---|---|---|---|---|---|---|
| ID | Source | ARGs Detected on Genomic DNA | ARGs Detected on Plasmid DNA | Plasmid Replicons Detected | ARGs Detected on Plasmid DNA | Plasmid Replicons Detected | |
| A. caviae | A36 | TWW | KPC-2 | KPC-2 | ColE, | ||
| A1 | TWW | KPC-2 | KPC-2 | ColE, R | |||
| A4 | TWW | KPC-2 | KPC-2 | ColE, R | |||
| A9 | TWW | KPC-2 | KPC-2 | ColE, R | |||
| A11 | TWW | KPC-2 | KPC-2 | ColE, R | |||
| A23 | TWW | KPC-2 | KPC-2 | ColE, R | |||
| A3 | TWW | KPC-2 | KPC-2 | ColE, R, P | |||
| A20 | TWV | KPC-2 | KPC-2 | ColE, R | |||
| A31 | TWW | KPC-2 | KPC-2 | ColE, R, HI1 | |||
| A6 | TWW | KPC-2 | KPC-2 | ColE, U, HI1, L/M, FrepB, K | |||
| A19 | TWW | KPC-2 | KPC-2 | ColE, U | |||
| A30 | TWW | KPC-2 | KPC-2 | ColE | |||
| A2 * | TWW | KPC-2 | KPC-2 | ColE, N, Y | KPC-2 | ColE, N | |
| A15 | TWW | KPC-2 | KPC-2 | ColE, K | |||
| A32 | TWW | KPC-2 | KPC-2 | ColE, K | |||
| A38 | TWW | KPC-2 | KPC-2 | ColE, K | |||
| A8 | TWW | KPC-2 | KPC-2 | K | |||
| A18 | H | KPC-2 | KPC-2 | - | |||
| A21 | TWW | KPC-2 | KPC-2 | P | |||
| A12 | TWW | KPC-2, VIM-2 | KPC-2, VIM-2 | - | |||
| A35 | TWW | KPC-2, VIM-2 | KPC-2, VIM-2 | ColE, R, HI1 | |||
| A37 | TWW | KPC-2, VIM-2 | KPC-2, VIM-2 | ColE, HI1, N | |||
| A29 | TWW | KPC-2, VIM-2 | KPC-2, VIM-2 | ColE, | |||
| A28 | TWW | KPC-2, VIM-2 | KPC-2, VIM-2 | ColE, U | |||
| A10 | TWW | KPC-2, VIM-2 | KPC-2, VIM-2 | U | |||
| A24 * | TWW | NDM-1 | NDM-1 | ColE | - | ColE | |
| A14 | TWW | CTX-M-15, TEM-1, GES-5, ACC | CTX-M-15, TEM-1 | W, P | |||
| A22 | TWW | TEM-1, GES-5, FOX, CIT, MOX | TEM-1, FOX, CIT, MOX | ColE, I1-1y, FIA, W, Y, FrepB | |||
| A26 | TWW | TEM-1, MOX | TEM-1, MOX | ColE, W | |||
| A34 | TWW | OXA-48; TEM-1, GES-5, MOX | TEM-1, MOX | ColE, Y, FrepB | |||
| A5 | TWW | KPC-2 | - | - | |||
| A13 | TWW | VIM-2, ACC | - | - | |||
| A17 | TWW | GES-5, CIT, MOX | CIT, MOX | - | |||
| A33 | TWW | GES-5, MOX, FOX | MOX | - | |||
| A27 | TWW | NDM-1, FOX | - | - | |||
| A7 | TWW | - | - | - | |||
| A16 | TWW | - | - | - | |||
| A25 | TWW | - | - | - | |||
| A. hydrophila | A39 | TWW | KPC-2 | KPC-2 | ColE, U, K, FrepB | ||
| A40 | TWW | KPC-2 | KPC-2 | ColE, U, K, FrepB | |||
| A42 | TWW | KPC-2 | KPC-2 | ColE, R | |||
| A45 | TWW | KPC-2 | KPC-2 | ColE, R | |||
| A48 | TWW | KPC-2 | KPC-2 | ColE, U | |||
| A49 | TWW | KPC-2 | KPC-2 | ColE | |||
| A41 | TWW | KPC-2 | KPC-2 | - | |||
| A46 | TWW | VEB-9 | - | - | |||
| A47 | TWW | MOX | - | - | |||
| A44 | TWW, | - | - | - | |||
| A43 | H | - | - | - | |||
| A. media | A51 | TWW | KPC-2 | KPC-2 | ColE, | ||
| A50 | TWW | KPC-2 | KPC-2 | ColE, R, U | |||
| A56 | TWW | KPC-2 | KPC-2 | ColE, R, U | |||
| A55 | TWW | KPC-2, IMP-13 | KPC-2 | ColE, R, U | |||
| A54 | TWW | KPC-2, GES-5 | KPC-2, GES-5 | - | |||
| A52 | TWW | TEM-1, GES-5 | TEM-1, GES-5 | ColE, | |||
| A53 | TWW | SHV-12, GES-5 | SHV-12 | ColE, FIC | |||
| A. veronii | A63 | TWW | KPC-2 | KPC-2 | ColE, U, K, FrepB | ||
| A60 | H | KPC-2 | KPC-2 | R, U, L/M, FrepB | |||
| A62 | H | - | - | - | |||
| A57 | H | - | - | - | |||
| A58 | H | - | - | - | |||
| A59 | H | - | - | - | |||
| A61 | TWW | - | - | - | |||
| A. salmonicida | A64 * | TWW | KPC-2 | KPC-2 | ColE, K | KPC-2 | ColE |
| A. rivipollensis | A65 | TWW | CIT | - | - | ||
| A. eucrenophila | A66 | TWW | - | - | - | ||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Drk, S.; Puljko, A.; Dželalija, M.; Udiković-Kolić, N. Characterization of Third Generation Cephalosporin- and Carbapenem-Resistant Aeromonas Isolates from Municipal and Hospital Wastewater. Antibiotics 2023, 12, 513. https://doi.org/10.3390/antibiotics12030513
Drk S, Puljko A, Dželalija M, Udiković-Kolić N. Characterization of Third Generation Cephalosporin- and Carbapenem-Resistant Aeromonas Isolates from Municipal and Hospital Wastewater. Antibiotics. 2023; 12(3):513. https://doi.org/10.3390/antibiotics12030513
Chicago/Turabian StyleDrk, Sara, Ana Puljko, Mia Dželalija, and Nikolina Udiković-Kolić. 2023. "Characterization of Third Generation Cephalosporin- and Carbapenem-Resistant Aeromonas Isolates from Municipal and Hospital Wastewater" Antibiotics 12, no. 3: 513. https://doi.org/10.3390/antibiotics12030513
APA StyleDrk, S., Puljko, A., Dželalija, M., & Udiković-Kolić, N. (2023). Characterization of Third Generation Cephalosporin- and Carbapenem-Resistant Aeromonas Isolates from Municipal and Hospital Wastewater. Antibiotics, 12(3), 513. https://doi.org/10.3390/antibiotics12030513

