One-Pot Colorimetric Nucleic Acid Test Mediated by Silver Nanoparticles for DNA Extraction and Detection
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Preparation of Bacterial Samples
2.3. Synthesis and Characterization of PEI-AgNPs
2.4. Live/Dead Bacterial Viability Assay
2.5. Extraction of Genomic DNA
2.6. LAMP Reaction
2.7. Colorimetric Detection
2.8. Fabrication and Operation of the One-Pot Colorimetric NAT Platform
3. Results and Discussion
3.1. Synthesis and Characterization of PEI-AgNPs
3.2. Effect of PEI-AgNPs on Cell Lysis
3.3. DNA Extraction Performance
3.4. Sodium Ascorbate-Induced AgNPs for LAMP Colorimetric Detection
3.5. Selectivity and Sensitivity of the One-Pot Colorimetric NAT Platform
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Wang, Q.; Wang, H.; Yang, X.; Wang, K.; Liu, F.; Zhao, Q.; Liu, P.; Liu, R. Multiplex detection of nucleic acids using a low cost microfluidic chip and a personal glucose meter at the point-of-care. Chem. Commun. 2014, 50, 3824–3826. [Google Scholar] [CrossRef] [Scilit]
- Ganguli, A.; Ornob, A.; Yu, H.; Damhorst, G.; Chen, W.; Sun, F.; Bhuiya, A.; Cunningham, B.; Bashir, R. Hands-free smartphone-based diagnostics for simultaneous detection of Zika, Chikungunya, and Dengue at point-of-care. Biomed. Microdevices 2017, 19, 73. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Metsky, H.C.; Freije, C.A.; Kosoko-Thoroddsen, T.-S.F.; Sabeti, P.C.; Myhrvold, C. CRISPR-based surveillance for COVID-19 using genomically-comprehensive machine learning design. bioRxiv 2020. [Google Scholar] [CrossRef] [Scilit]
- Muto, Y.; Matubara, H.; Tanizawa, T.; Nabeya, Y.; Kawahira, H.; Akai, T.; Hoshino, I.; Hayashi, H. Rapid diagnosis of micrometastasis of gastric cancer using reverse transcription loop-mediated isothermal amplification. Oncol. Rep. 2011, 26, 789–794. [Google Scholar] [PubMed]
- Shkodenko, L.; Laushkina, V.; Rubel, M.; Sergeeva, E. Finger-Actuated Microfluidic Platform for Colorimetric Isothermal Diagnostics of Neisseria meningitidis and Herpes Simplex Virus. Russ. J. Bioorganic Chem. 2024, 50, 544–553. [Google Scholar] [CrossRef] [Scilit]
- Rodriguez-Mateos, P.; Ngamsom, B.; Ameyo, D.; Wakaba, P.; Shiluli, C.; Iles, A.; Gitaka, J.; Pamme, N. Integrated microscale immiscible phase extraction and isothermal amplification for colorimetric detection of Neisseria gonorrhoeae. Anal. Bioanal. Chem. 2023, 415, 5129–5137. [Google Scholar] [CrossRef] [Scilit]
- Abou El-Nour, K.M.; Eftaiha, A.A.; Al-Warthan, A.; Ammar, R.A. Synthesis and applications of silver nanoparticles. Arab. J. Chem. 2010, 3, 135–140. [Google Scholar] [CrossRef] [Scilit]
- Mughal, S.S. Role of silver nanoparticles in colorimetric detection of biomolecules. Biomed. Nurs. 2019, 5, 31–47. [Google Scholar] [CrossRef] [Scilit]
- Menichetti, A.; Mavridi-Printezi, A.; Mordini, D.; Montalti, M. Effect of size, shape and surface functionalization on the antibacterial activity of silver nanoparticles. J. Funct. Biomater. 2023, 14, 244. [Google Scholar] [CrossRef] [Scilit]
- Prabhu, S.; Poulose, E.K. Silver nanoparticles: Mechanism of antimicrobial action, synthesis, medical applications, and toxicity effects. Int. Nano Lett. 2012, 2, 32. [Google Scholar] [CrossRef] [Scilit]
- Sondi, I.; Salopek-Sondi, B. Silver nanoparticles as antimicrobial agent: A case study on E. coli as a model for Gram-negative bacteria. J. Colloid Interface Sci. 2004, 275, 177–182. [Google Scholar] [CrossRef] [PubMed]
- Lara, H.H.; Garza-Treviño, E.N.; Ixtepan-Turrent, L.; Singh, D.K. Silver nanoparticles are broad-spectrum bactericidal and virucidal compounds. J. Nanobiotechnol. 2011, 9, 30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, S.; Zheng, J. Antibacterial activity of silver nanoparticles: Structural effects. Adv. Healthc. Mater. 2018, 7, 1701503. [Google Scholar] [CrossRef] [Scilit]
- Goswami, G.; Boruah, H.; Gautom, T.; Hazarika, D.J.; Barooah, M.; Boro, R.C. Chemically synthesized silver nanoparticles as cell lysis agent for bacterial genomic DNA isolation. Adv. Nat. Sci. Nanosci. Nanotechnol. 2017, 8, 045015. [Google Scholar] [CrossRef] [Scilit]
- Min, J.H.; Woo, M.-K.; Yoon, H.Y.; Jang, J.W.; Wu, J.H.; Lim, C.-S.; Kim, Y.K. Isolation of DNA using magnetic nanoparticles coated with dimercaptosuccinic acid. Anal. Biochem. 2014, 447, 114–118. [Google Scholar] [CrossRef] [Scilit]
- Gan, W.; Gu, Y.; Han, J.; Li, C.-X.; Sun, J.; Liu, P. Chitosan-modified filter paper for nucleic acid extraction and “in situ PCR” on a thermoplastic microchip. Anal. Chem. 2017, 89, 3568–3575. [Google Scholar] [CrossRef] [Scilit]
- Lungu, C.N.; Diudea, M.V.; Putz, M.V.; Grudziński, I.P. Linear and branched PEIs (polyethylenimines) and their property space. Int. J. Mol. Sci. 2016, 17, 555. [Google Scholar] [CrossRef] [Scilit]
- Lee, H.J.; Lee, S.G.; Oh, E.J.; Chung, H.Y.; Han, S.I.; Kim, E.J.; Seo, S.Y.; Do Ghim, H.; Yeum, J.H.; Choi, J.H. Antimicrobial polyethyleneimine-silver nanoparticles in a stable colloidal dispersion. Colloids Surf. B Biointerfaces 2011, 88, 505–511. [Google Scholar] [CrossRef] [Scilit]
- Trinh, T.N.D.; La, H.C.; Lee, N.Y. Fully integrated and foldable microdevice encapsulated with agarose for long-term storage potential for point-of-care testing of multiplex foodborne pathogens. ACS Sens. 2019, 4, 2754–2762. [Google Scholar] [CrossRef] [Scilit]
- Trinh, K.T.L.; Stabler, R.A.; Lee, N.Y. Fabrication of a foldable all-in-one point-of-care molecular diagnostic microdevice for the facile identification of multiple pathogens. Sens. Actuators B Chem. 2020, 314, 128057. [Google Scholar] [CrossRef] [Scilit]
- Ravindran, A.; Chandran, P.; Khan, S.S. Biofunctionalized silver nanoparticles: Advances and prospects. Colloids Surf. B Biointerfaces 2013, 105, 342–352. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ben Moshe, A.; Markovich, G. Synthesis of single crystal hollow silver nanoparticles in a fast reaction-diffusion process. Chem. Mater. 2011, 23, 1239–1245. [Google Scholar] [CrossRef] [Scilit]
- Raja, D.A.; Shah, M.R.; Malik, M.I. Polyethyleneimine stabilized silver nanoparticles as an efficient and selective colorimetric assay for promethazine. Anal. Chim. Acta 2022, 1223, 340216. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ou, F.; McGoverin, C.; Swift, S.; Vanholsbeeck, F. Rapid evaluation of bacterial viability using the optrode—A near real time portable fluorimeter. In Proceedings of the Australian Conference on Optical Fibre Technology, Sydney, Australia, 5–8 September 2016; p. AW3C.6. [Google Scholar]
- Liu, Z.; Wang, Y.; Zu, Y.; Fu, Y.; Li, N.; Guo, N.; Liu, R.; Zhang, Y. Synthesis of polyethylenimine (PEI) functionalized silver nanoparticles by a hydrothermal method and their antibacterial activity study. Mater. Sci. Eng. C 2014, 42, 31–37. [Google Scholar] [CrossRef] [Scilit]
- Evanoff, D.D., Jr.; Chumanov, G. Synthesis and optical properties of silver nanoparticles and arrays. ChemPhysChem 2005, 6, 1221–1231. [Google Scholar] [CrossRef] [Scilit]
- Boulos, L.; Prevost, M.; Barbeau, B.; Coallier, J.; Desjardins, R. LIVE/DEAD® BacLight™: Application of a new rapid staining method for direct enumeration of viable and total bacteria in drinking water. J. Microbiol. Methods 1999, 37, 77–86. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wilson, K. Preparation of genomic DNA from bacteria. Curr. Protoc. Mol. Biol. 2001, 56, 2–4. [Google Scholar] [CrossRef] [Scilit]
- Nam, G.; Rangasamy, S.; Purushothaman, B.; Song, J.M. The application of bactericidal silver nanoparticles in wound treatment. Nanomater. Nanotechnol. 2015, 5, 23. [Google Scholar] [CrossRef] [Scilit]
- Agnihotri, S.; Mukherji, S.; Mukherji, S. Immobilized silver nanoparticles enhance contact killing and show highest efficacy: Elucidation of the mechanism of bactericidal action of silver. Nanoscale 2013, 5, 7328–7340. [Google Scholar] [CrossRef] [Scilit]
- Kou, X.; Zhang, W.; Zhang, W. Quantifying the interactions between PEI and double-stranded DNA: Toward the understanding of the role of PEI in gene delivery. ACS Appl. Mater. Interfaces 2016, 8, 21055–21062. [Google Scholar] [CrossRef] [Scilit]
- Dashti, A.A.; Jadaon, M.M.; Abdulsamad, A.M.; Dashti, H.M. Heat treatment of bacteria: A simple method of DNA extraction for molecular techniques. Kuwait Med. J. 2009, 41, 117–122. [Google Scholar]
- Zhu, X.; Zhao, J.; Hu, A.; Pan, J.; Deng, G.; Hua, C.; Zhu, C.; Liu, Y.; Yang, K.; Zhu, L. A novel microfluidic device integrated with chitosan-modified capillaries for rapid ZIKV detection. Micromachines 2020, 11, 186. [Google Scholar] [CrossRef] [Scilit]
- Błasiak, J.; Kowalik, J. Protective action of sodium ascorbate against the DNA-damaging effect of malaoxon. Pestic. Biochem. Physiol. 1999, 65, 110–118. [Google Scholar] [CrossRef] [Scilit]
- Lu, S.; Luo, Y.; Turner, E.; Feng, H. Efficacy of sodium chlorite as an inhibitor of enzymatic browning in apple slices. Food Chemistry 2007, 104, 824–829. [Google Scholar] [CrossRef] [Scilit]
- Ali, T.H.; Mandal, A.M.; Heidelberg, T.; Hussen, R.S.D.; Goh, E.W. Ionic magnetic core–shell nanoparticles for DNA extraction. RSC Adv. 2020, 10, 38818–38830. [Google Scholar] [CrossRef] [Scilit]
- Seyyedi, N.; Farjadian, F.; Farhadi, A.; Rafiei Dehbidi, G.; Ranjbaran, R.; Zare, F.; Ali Okhovat, M.; Nikouyan, N.; Behzad-Behbahani, A. High yield gold nanoparticle-based DNA isolation method for human papillomaviruses genotypes from cervical cancer tissue samples. IET Nanobiotechnol. 2020, 14, 555–562. [Google Scholar] [CrossRef] [Scilit]
- Hieu, N.M.; Nam, N.H.; Huyen, N.T.; Van Anh, N.T.; Nghia, P.T.; Khoa, N.B.; Toan, N.L.; Luong, N.H. Synthesis of SiO2-Coated Fe3O4 Nanoparticles Using Ultrasound and Its Application in DNA Extraction from Formalin-Fixed, Paraffin-Embedded Human Cancer Tissues. J. Electron. Mater. 2017, 46, 3738–3747. [Google Scholar] [CrossRef] [Scilit]
- Yilmaz, E.; Baghban, N.; Soylak, M. Solid-phase extraction (SPE) of salmon sperm DNA using a polyaniline@ molybdenum (IV) sulfide@ multiwalled carbon nanotubes (MWCNTs) nanocomposite with spectrophotometric detection. Anal. Lett. 2023, 56, 1632–1645. [Google Scholar] [CrossRef] [Scilit]










| Target Gene | Primer Name | Primer Sequences (5′-3′) |
|---|---|---|
| esp gene (Enterococcus faecium) | F3 | CCAGAACACTTATGGAACAG |
| B3 | GTTGGGCTTTGTGACCTG | |
| FIP | CGTGTCTCCGCTCTCTTCTTTTTATTT-GCAAGATATTGATGGTG | |
| BIP | ATCGGGAAACCTGAATTAGAAGAA-GAACTCGTGGATGAATACTTTC | |
| LB | TGATGTTGACACAACAGTTAAGGG | |
| hlyA gene (Listeria monocytogenes) | F3 | TTGCGCAACAAACTGAAGC |
| B3 | GCTTTTACGAGAGCACCTGG | |
| FIP | CGTGTTTCTTTTCGATTGGCGTCTTTTTTTCATCCATGGCACCACC | |
| BIP | CCACGGAGATGCAGTGACAAATGTTTTGGATTTCTTCTTTTTCTCCACAAC | |
| LB | GCCAAGAAAAGGTTACAAAGATGG |
| Method | Advantages | Disadvantages | Reference |
|---|---|---|---|
| Magnetic nanoparticles | - High binding efficiency | - Use of magnets | [36] |
| - Easy magnetic separation | - Higher cost | ||
| Gold nanoparticles (AuNPs) | - Tunable surface | - Expensive | [37] |
| - High sensitivity | - Complex synthesis | ||
| Silica-coated nanoparticles | - High DNA purity | - Time consuming | [38] |
| - Wide applicability | - Relatively expensive | ||
| Carbon nanotubes (CNTs) | - High surface area | - Difficult for purification | [39] |
| - Strong adsorption | - Potential for cytotoxicity | ||
| PEI-AgNP-coated GF membrane | - Simple, low-cost, instrument-free | - Limited binding capacity | This study |
| - Fast extraction |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, S.K.; Trinh, K.T.L.; Lee, N.Y. One-Pot Colorimetric Nucleic Acid Test Mediated by Silver Nanoparticles for DNA Extraction and Detection. Biosensors 2025, 15, 271. https://doi.org/10.3390/bios15050271
Park SK, Trinh KTL, Lee NY. One-Pot Colorimetric Nucleic Acid Test Mediated by Silver Nanoparticles for DNA Extraction and Detection. Biosensors. 2025; 15(5):271. https://doi.org/10.3390/bios15050271
Chicago/Turabian StylePark, Seung Kyun, Kieu The Loan Trinh, and Nae Yoon Lee. 2025. "One-Pot Colorimetric Nucleic Acid Test Mediated by Silver Nanoparticles for DNA Extraction and Detection" Biosensors 15, no. 5: 271. https://doi.org/10.3390/bios15050271
APA StylePark, S. K., Trinh, K. T. L., & Lee, N. Y. (2025). One-Pot Colorimetric Nucleic Acid Test Mediated by Silver Nanoparticles for DNA Extraction and Detection. Biosensors, 15(5), 271. https://doi.org/10.3390/bios15050271

