Silver and Hyaluronic Acid-Coated Gold Nanoparticles Modulate the Metabolism of a Model Human Gut Bacterium Lactobacillus casei
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation of Ag NP Dispersion and Synthesis of HA-Au NPs
2.2. Characterization of NPs
2.3. Bacterial Strains, Growth Media and Culturing
2.4. Bacterial Growth Assays with NPs
2.5. RNA Isolation and Quantitative PCR Analysis
2.6. Preparation of Spent Media and Their Antibacterial Activity Testing
2.7. Inductively Coupled Plasma-Mass Spectroscopy (ICP-MS)
2.8. Characterization of NPs Incubated in Spent Media
2.9. Caco-2 Cell Culture, Differentiation and Exposure to Lipopolysaccharide and Spent Media
2.10. Statistical Analysis
3. Results and Discussion
3.1. Formulation of Simulated Intestinal Fluid for Culturing of L. casei
3.2. Characteristics of Ag and HA-Au NPs and Their Transformation in Simulated Intestinal Fluid (IF)
3.3. Ag and HA-Au NP Effects on the Growth of L. casei
3.4. Ag and HA-Au NP Effects on the Bacteriocin Gene Expression of L. casei
3.5. HA-Au NP Effects on the Immunomodulatory Properties of L. casei
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Javed, I.; Cui, X.; Wang, X.; Mortimer, M.; Andrikopoulos, N.; Li, Y.; Davis, T.P.; Zhao, Y.; Ke, P.C.; Chen, C. Implications of the Human Gut-Brain and Gut-Cancer Axes for Future Nanomedicine. ACS Nano 2020, 14, 14391–14416. [Google Scholar] [CrossRef]
- Zhao, Y. Nanomedicine in China. Adv. Healthc. Mater. 2018, 7, 1801051. [Google Scholar] [CrossRef]
- Bobo, D.; Robinson, K.J.; Islam, J.; Thurecht, K.J.; Corrie, S.R. Nanoparticle-Based Medicines: A Review of FDA-Approved Materials and Clinical Trials to Date. Pharm. Res. 2016, 33, 2373–2387. [Google Scholar] [CrossRef]
- Yan, L.; Zhao, F.; Wang, J.; Zu, Y.; Gu, Z.; Zhao, Y. A Safe-by-Design Strategy towards Safer Nanomaterials in Nanomedicines. Adv. Mater. 2019, 31, 1805391. [Google Scholar] [CrossRef]
- Kim, K.; Choi, H.; Choi, E.S.; Park, M.-H.; Ryu, J.-H. Hyaluronic Acid-Coated Nanomedicine for Targeted Cancer Therapy. Pharmaceutics 2019, 11, 301. [Google Scholar] [CrossRef]
- Lee, Y.; Sugihara, K.; Gillilland, M.G., 3rd; Jon, S.; Kamada, N.; Moon, J.J. Hyaluronic acid-bilirubin nanomedicine for targeted modulation of dysregulated intestinal barrier, microbiome and immune responses in colitis. Nat. Mater. 2020, 19, 118–126. [Google Scholar] [CrossRef]
- Huang, W.; Tao, F.; Li, F.; Mortimer, M.; Guo, L.-H. Antibacterial nanomaterials for environmental and consumer product applications. NanoImpact 2020, 20, 100268. [Google Scholar] [CrossRef]
- Mukherjee, S.; Kotcherlakota, R.; Haque, S.; Das, S.; Nuthi, S.; Bhattacharya, D.; Madhusudana, K.; Chakravarty, S.; Sistla, R.; Patra, C.R. Silver Prussian Blue Analogue Nanoparticles: Rationally Designed Advanced Nanomedicine for Multifunctional Biomedical Applications. ACS Biomater. Sci. Eng. 2020, 6, 690–704. [Google Scholar] [CrossRef]
- Zhang, Y.; Mortimer, M.; Guo, L.-H. Interplay between engineered nanomaterials and microbiota. Environ. Sci.–Nano 2020, 7, 2454–2485. [Google Scholar] [CrossRef]
- Williams, K.; Milner, J.; Boudreau, M.D.; Gokulan, K.; Cerniglia, C.E.; Khare, S. Effects of subchronic exposure of silver nanoparticles on intestinal microbiota and gut-associated immune responses in the ileum of Sprague-Dawley rats. Nanotoxicology 2015, 9, 279–289. [Google Scholar] [CrossRef]
- Chen, H.; Zhao, R.; Wang, B.; Cai, C.; Zheng, L.; Wang, H.; Wang, M.; Ouyang, H.; Zhou, X.; Chai, Z.; et al. The effects of orally administered Ag, TiO2 and SiO2 nanoparticles on gut microbiota composition and colitis induction in mice. NanoImpact 2017, 8, 80–88. [Google Scholar] [CrossRef]
- Zhu, S.; Jiang, X.; Boudreau, M.D.; Feng, G.; Miao, Y.; Dong, S.; Wu, H.; Zeng, M.; Yin, J.-J. Orally administered gold nanoparticles protect against colitis by attenuating Toll-like receptor 4- and reactive oxygen/nitrogen species-mediated inflammatory responses but could induce gut dysbiosis in mice. J. Nanobiotechnol. 2018, 16, 86. [Google Scholar] [CrossRef] [PubMed]
- Abt, M.C.; Pamer, E.G. Commensal bacteria mediated defenses against pathogens. Curr. Opin. Immunol. 2014, 29, 16–22. [Google Scholar] [CrossRef] [PubMed]
- Tien, M.-T.; Girardin, S.E.; Regnault, B.; Le Bourhis, L.; Dillies, M.-A.; Coppee, J.-Y.; Bourdet-Sicard, R.; Sansonetti, P.J.; Pedron, T. Anti-inflammatory effect of Lactobacillus casei on Shigella-infected human intestinal epithelial cells. J. Immunol. 2006, 176, 1228–1237. [Google Scholar] [CrossRef] [PubMed]
- Fritz, J.H.; Le Bourhis, L.; Magalhaes, J.G.; Philpott, D.J. Innate immune recognition at the epithelial barrier drives adaptive immunity: APCs take the back seat. Trends Immunol. 2008, 29, 41–49. [Google Scholar] [CrossRef]
- Mortimer, M.; Devarajan, N.; Li, D.; Holden, P.A. Multiwall Carbon Nanotubes Induce More Pronounced Transcriptomic Responses in Pseudomonas aeruginosa PG201 than Graphene, Exfoliated Boron Nitride, or Carbon Black. ACS Nano 2018, 12, 2728–2740. [Google Scholar] [CrossRef]
- Mortimer, M.; Li, D.; Wang, Y.; Holden, P.A. Physical Properties of Carbon Nanomaterials and Nanoceria Affect Pathways Important to the Nodulation Competitiveness of the Symbiotic N2-Fixing Bacterium Bradyrhizobium diazoefficiens. Small 2020, 16, 1906055. [Google Scholar] [CrossRef]
- Bondarenko, O.; Mortimer, M.; Kahru, A.; Feliu, N.; Javed, I.; Kakinen, A.; Lin, S.; Xia, T.; Song, Y.; Davis, T.P.; et al. Nanotoxicology and nanomedicine: The Yin and Yang of nano-bio interactions for the new decade. Nano Today 2021, 39, 101184. [Google Scholar] [CrossRef]
- Ge, J.; Cai, R.; Yang, L.; Zhang, L.; Jiang, Y.; Yang, Y.; Cui, C.; Wan, S.; Chu, X.; Tan, W. Core-Shell HA-AuNPs@SiNPs Nanoprobe for Sensitive Fluorescence Hyaluronidase Detection and Cell Imaging. ACS Sustain. Chem. Eng. 2018, 6, 16555–16562. [Google Scholar] [CrossRef]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef]
- Ledesma, O.V.; De Ruiz Holgado, A.P.; Oliver, G.; De Giori, G.S.; Raibaud, P.; Galpin, J.V. A synthetic medium for comparative nutritional studies of lactobacilli. J. Appl. Bacteriol. 1977, 42, 123–133. [Google Scholar] [CrossRef] [PubMed]
- Minekus, M.; Alminger, M.; Alvito, P.; Ballance, S.; Bohn, T.; Bourlieu, C.; Carriere, F.; Boutrou, R.; Corredig, M.; Dupont, D.; et al. A standardised static in vitro digestion method suitable for food—An international consensus. Food Funct. 2014, 5, 1113–1124. [Google Scholar] [CrossRef] [PubMed]
- Xiu, Z.-M.; Zhang, Q.-B.; Puppala, H.L.; Colvin, V.L.; Alvarez, P.J.J. Negligible Particle-Specific Antibacterial Activity of Silver Nanoparticles. Nano Lett. 2012, 12, 4271–4275. [Google Scholar] [CrossRef] [PubMed]
- Mortimer, M.; Kefela, T.; Trinh, A.; Holden, P.A. Uptake and depuration of carbon- and boron nitride-based nanomaterials in the protozoa Tetrahymena thermophila. Environ. Sci.–Nano 2021, 8, 3613–3628. [Google Scholar] [CrossRef]
- Vindimian, E. MSExcel Macro REGTOX EV7.0.5.xls. 2005. Available online: http://www.normalesup.org/~vindimian/en_download.html (accessed on 1 May 2022).
- Kuo, Y.-C.; Liu, C.-F.; Lin, J.-F.; Li, A.-C.; Lo, T.-C.; Lin, T.-H. Characterization of putative class II bacteriocins identified from a non-bacteriocin-producing strain Lactobacillus casei ATCC 334. Appl. Microbiol. Biotechnol. 2013, 97, 237–246. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Hockett, K.L.; Baltrus, D.A. Use of the Soft-agar Overlay Technique to Screen for Bacterially Produced Inhibitory Compounds. JoVE–J. Vis. Exp. 2017, 119, e055064. [Google Scholar] [CrossRef]
- De Man, J.C.; Rogosa, M.; Sharpe, M.E. A medium for the cultivation of Lactobacilli. J. Appl. Bacteriol. 1960, 23, 130–135. [Google Scholar] [CrossRef]
- Hayek, S.A.; Gyawali, R.; Aljaloud, S.O.; Krastanov, A.; Ibrahim, S.A. Cultivation media for lactic acid bacteria used in dairy products. J. Dairy Res. 2019, 86, 490–502. [Google Scholar] [CrossRef]
- Kimoto, H.; Ohmomo, S.; Okamoto, T. Enhancement of bile tolerance in lactococci by Tween 80. J. Appl. Microbiol. 2002, 92, 41–46. [Google Scholar] [CrossRef] [Green Version]
- O’Flaherty, S.; Crawley, A.B.; Theriot, C.M.; Barrangou, R. The Lactobacillus Bile Salt Hydrolase Repertoire Reveals Niche-Specific Adaptation. mSphere 2018, 3, e00140-18. [Google Scholar] [CrossRef] [PubMed]
- Pessione, E. Lactic acid bacteria contribution to gut microbiota complexity: Lights and shadows. Front. Cell. Infect. Microbiol. 2012, 2, 86. [Google Scholar] [CrossRef] [PubMed]
- Allen, S.L.; Sharma, J.N.; Zamborini, F.P. Aggregation-Dependent Oxidation of Metal Nanoparticles. J. Am. Chem. Soc. 2017, 139, 12895–12898. [Google Scholar] [CrossRef]
- Ault, A.P.; Stark, D.I.; Axson, J.L.; Keeney, J.N.; Maynard, A.D.; Bergin, I.L.; Philbert, M.A. Protein corona-induced modification of silver nanoparticle aggregation in simulated gastric fluid. Environ. Sci.–Nano 2016, 3, 1510–1520. [Google Scholar] [CrossRef]
- Juganson, K.; Mortimer, M.; Ivask, A.; Kasemets, K.; Kahru, A. Extracellular conversion of silver ions into silver nanoparticles by protozoan Tetrahymena thermophila. Environ. Sci.–Process. Impacts 2013, 15, 244–250. [Google Scholar] [CrossRef] [PubMed]
- Kakinen, A.; Ding, F.; Chen, P.Y.; Mortimer, M.; Kahru, A.; Ke, P.C. Interaction of firefly luciferase and silver nanoparticles and its impact on enzyme activity. Nanotechnology 2013, 24, 345101. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Li, D.; Zhang, Y.; Zhang, W.; Ma, P.Y.; Wang, X.H.; Song, D.Q.; Sun, Y. One-pot synthesis of hyaluronic acid-coated gold nanoparticles as SERS substrate for the determination of hyaluronidase activity. Microchim. Acta 2020, 187, 604. [Google Scholar] [CrossRef]
- Jiang, X.M.; Zhang, X.W.; Gray, P.; Zheng, J.W.; Croley, T.R.; Fu, P.P.; Yin, J.J. Influences of simulated gastrointestinal environment on physicochemical properties of gold nanoparticles and their implications on intestinal epithelial permeability. J. Environ. Sci. Health Part C–Environ. Carcinog. Ecotoxicol. Rev. 2019, 37, 116–131. [Google Scholar] [CrossRef]
- Jain, P.K.; Lee, K.S.; El-Sayed, I.H.; El-Sayed, M.A. Calculated absorption and scattering properties of gold nanoparticles of different size, shape, and composition: Applications in biological imaging and biomedicine. J. Phys. Chem. B 2006, 110, 7238–7248. [Google Scholar] [CrossRef]
- Shannahan, J.H.; Lai, X.Y.; Ke, P.C.; Podila, R.; Brown, J.M.; Witzmann, F.A. Silver Nanoparticle Protein Corona Composition in Cell Culture Media. PLoS ONE 2013, 8, e74001. [Google Scholar] [CrossRef]
- Malva, A.D.; Albenzio, M.; Santillo, A.; Russo, D.; Figliola, L.; Caroprese, M.; Marino, R. Methods for Extraction of Muscle Proteins from Meat and Fish Using Denaturing and Nondenaturing Solutions. J. Food Qual. 2018, 2018, 8478471. [Google Scholar] [CrossRef]
- Albanese, A.; Walkey, C.D.; Olsen, J.B.; Guo, H.B.; Emili, A.; Chan, W.C.W. Secreted Biomolecules Alter the Biological Identity and Cellular Interactions of Nanoparticles. ACS Nano 2014, 8, 5515–5526. [Google Scholar] [CrossRef] [PubMed]
- Tian, X.; Jiang, X.M.; Welch, C.; Croley, T.R.; Wong, T.Y.; Chen, C.; Fan, S.H.; Chong, Y.; Li, R.B.; Ge, C.C.; et al. Bactericidal Effects of Silver Nanoparticles on Lactobacilli and the Underlying Mechanism. ACS Appl. Mater. Interfaces 2018, 10, 8443–8450. [Google Scholar] [CrossRef] [PubMed]
- Ivask, A.; Elbadawy, A.; Kaweeteerawat, C.; Boren, D.; Fischer, H.; Ji, Z.; Chang, C.H.; Liu, R.; Tolaymat, T.; Telesca, D.; et al. Toxicity mechanisms in Escherichia coli vary for silver nanoparticles and differ from ionic silver. ACS Nano 2014, 8, 374–386. [Google Scholar] [CrossRef] [PubMed]
- Ivask, A.; Kurvet, I.; Kasemets, K.; Blinova, I.; Aruoja, V.; Suppi, S.; Vija, H.; Käkinen, A.; Titma, T.; Heinlaan, M.; et al. Size-Dependent Toxicity of Silver Nanoparticles to Bacteria, Yeast, Algae, Crustaceans and Mammalian Cells In Vitro. PLoS ONE 2014, 9, e102108. [Google Scholar] [CrossRef]
- Bondarenko, O.; Ivask, A.; Kakinen, A.; Kurvet, I.; Kahru, A. Particle-cell contact enhances antibacterial activity of silver nanoparticles. PLoS ONE 2013, 8, e64060. [Google Scholar] [CrossRef]
- Feng, Z.V.; Gunsolus, I.L.; Qiu, T.A.; Hurley, K.R.; Nyberg, L.H.; Frew, H.; Johnson, K.P.; Vartanian, A.M.; Jacob, L.M.; Lohse, S.E.; et al. Impacts of gold nanoparticle charge and ligand type on surface binding and toxicity to Gram-negative and Gram-positive bacteria. Chem. Sci. 2015, 6, 5186–5196. [Google Scholar] [CrossRef]
- Nam, S.H.; Lee, W.M.; Shin, Y.J.; Yoon, S.J.; Kim, S.W.; Kwak, J.I.; An, Y.J. Derivation of guideline values for gold (III) ion toxicity limits to protect aquatic ecosystems. Water Res. 2014, 48, 126–136. [Google Scholar] [CrossRef]
- Sabella, S.; Carney, R.P.; Brunetti, V.; Malvindi, M.A.; Al-Juffali, N.; Vecchio, G.; Janes, S.M.; Bakr, O.M.; Cingolani, R.; Stellacci, F.; et al. A general mechanism for intracellular toxicity of metal-containing nanoparticles. Nanoscale 2014, 6, 7052–7061. [Google Scholar] [CrossRef]
- McCarrick, S.; Midander, K.; Krausová, M.; Carlander, U.; Karlsson, H.L. Gold Nanoparticles Dissolve Extracellularly in the Presence of Human Macrophages. Int. J. Nanomed. 2021, 16, 5895–5908. [Google Scholar] [CrossRef]
- Balfourier, A.; Luciani, N.; Wang, G.; Lelong, G.; Ersen, O.; Khelfa, A.; Alloyeau, D.; Gazeau, F.; Carn, F. Unexpected intracellular biodegradation and recrystallization of gold nanoparticles. Proc. Natl. Acad. Sci. USA 2020, 117, 103–113. [Google Scholar] [CrossRef] [PubMed]
- Yang, E.; Fan, L.H.; Yan, J.P.; Jiang, Y.M.; Doucette, C.; Fillmore, S.; Walker, B. Influence of culture media, pH and temperature on growth and bacteriocin production of bacteriocinogenic lactic acid bacteria. AMB Express 2018, 8, 10. [Google Scholar] [CrossRef] [PubMed]
- Yang, R.G.; Johnson, M.C.; Ray, B. Novel method to extract large amounts of bacteriocins from lactic-acid bacteria. Appl. Environ. Microbiol. 1992, 58, 3355–3359. [Google Scholar] [CrossRef] [PubMed]
- Kim, W.S.; Lee, J.Y.; Singh, B.; Maharjan, S.; Hong, L.; Lee, S.M.; Cui, L.H.; Lee, K.J.; Kim, G.; Yun, C.H.; et al. A new way of producing pediocin in Pediococcus acidilactici through intracellular stimulation by internalized inulin nanoparticles. Sci. Rep. 2018, 8, 5878. [Google Scholar] [CrossRef] [PubMed]
- Hong, L.; Kim, W.S.; Lee, S.M.; Kang, S.K.; Choi, Y.J.; Cho, C.S. Pullulan Nanoparticles as Prebiotics Enhance the Antibacterial Properties of Lactobacillus plantarum Through the Induction of Mild Stress in Probiotics. Front. Microbiol. 2019, 10, 142. [Google Scholar] [CrossRef]
- Gambino, M.; Marzano, V.; Villa, F.; Vitali, A.; Vannini, C.; Landini, P.; Cappitelli, F. Effects of sublethal doses of silver nanoparticles on Bacillus subtilis planktonic and sessile cells. J. Appl. Microbiol. 2015, 118, 1103–1115. [Google Scholar] [CrossRef]
- Domingo, G.; Villa, F.; Vannini, C.; Garuglieri, E.; Onelli, E.; Bracale, M.; Cappitelli, F. Label-Free Proteomic Approach to Study the Non-lethal Effects of Silver Nanoparticles on a Gut Bacterium. Front. Microbiol. 2019, 10, 2709. [Google Scholar] [CrossRef]
- Ouyang, K.; Mortimer, M.; Holden, P.A.; Cai, P.; Wu, Y.C.; Gao, C.H.; Huang, Q.Y. Towards a better understanding of Pseudomonas putida biofilm formation in the presence of ZnO nanoparticles (NPs): Role of NP concentration. Environ. Int. 2020, 137, 105485. [Google Scholar] [CrossRef]
- Huma, Z.E.; Javed, I.; Zhang, Z.Z.; Bilal, H.; Sun, Y.X.; Hussain, S.Z.; Davis, T.P.; Otzen, D.E.; Landersdorfer, C.B.; Ding, F.; et al. Nanosilver Mitigates Biofilm Formation via FapC Amyloidosis Inhibition. Small 2020, 16, 1906674. [Google Scholar] [CrossRef]
- Mohammed, M.; Devnarain, N.; Elhassan, E.; Govender, T. Exploring the applications of hyaluronic acid-based nanoparticles for diagnosis and treatment of bacterial infections. Wiley Interdiscip. Rev.–Nanomed. Nanobiotechnol. 2022, 14, e1799. [Google Scholar] [CrossRef]
- Di Cerbo, A.; Aponte, M.; Esposito, R.; Bondi, M.; Palmieri, B. Comparison of the effects of hyaluronidase and hyaluronic acid on probiotics growth. BMC Microbiol. 2013, 13, 243. [Google Scholar] [CrossRef] [PubMed]
- Hill, D.; Sugrue, I.; Tobin, C.; Hill, C.; Stanton, C.; Ross, R.P. The Lactobacillus casei Group: History and Health Related Applications. Front. Microbiol. 2018, 9, 2107. [Google Scholar] [CrossRef] [PubMed]
- Perdigon, G.; Galdeano, C.M.; Valdez, J.C.; Medici, M. Interaction of lactic acid bacteria with the gut immune system. Eur. J. Clin. Nutr. 2002, 56, S21–S26. [Google Scholar] [CrossRef] [PubMed]
- Casas-Solis, J.; Huizar-Lopez, M.D.; Irecta-Najera, C.A.; Pita-Lopez, M.L.; Santerre, A. Immunomodulatory Effect of Lactobacillus casei in a Murine Model of Colon Carcinogenesis. Probiotics Antimicrob. Proteins 2020, 12, 1012–1024. [Google Scholar] [CrossRef] [PubMed]
- Shin, W.; Kim, H.J. Intestinal barrier dysfunction orchestrates the onset of inflammatory host-microbiome cross-talk in a human gut inflammation-on-a-chip. Proc. Natl. Acad. Sci. USA 2018, 115, E10539–E10547. [Google Scholar] [CrossRef]
- Garces, V.; Gonzalez, A.; Galvez, N.; Delgado-Lopez, J.M.; Calvino, J.J.; Trasobares, S.; Fernandez-Afonso, Y.; Gutierrez, L.; Dominguez-Vera, J.M. Magneto-optical hyperthermia agents based on probiotic bacteria loaded with magnetic and gold nanoparticles. Nanoscale 2022, 14, 5716–5724. [Google Scholar] [CrossRef]
- Stabryla, L.M.; Johnston, K.A.; Millstone, J.E.; Gilbertson, L.M. Emerging investigator series: It’s not all about the ion: Support for particle-specific contributions to silver nanoparticle antimicrobial activity. Environ. Sci.–Nano 2018, 5, 2047–2068. [Google Scholar] [CrossRef]
- Zhang, Y.; Shareena Dasari, T.P.; Deng, H.; Yu, H.T. Antimicrobial Activity of Gold Nanoparticles and Ionic Gold. J. Environ. Sci. Health Part C–Environ. Carcinog. Ecotoxicol. Rev. 2015, 33, 286–327. [Google Scholar] [CrossRef]
- Mortimer, M.; Wang, Y.; Holden, P.A. Molecular Mechanisms of Nanomaterial-Bacterial Interactions Revealed by Omics-The Role of Nanomaterial Effect Level. Front. Bioeng. Biotechnol. 2021, 9, 493. [Google Scholar] [CrossRef]
- Siegrist, S.; Cörek, E.; Detampel, P.; Sandström, J.; Wick, P.; Huwyler, J. Preclinical hazard evaluation strategy for nanomedicines. Nanotoxicology 2019, 13, 73–99. [Google Scholar] [CrossRef] [Green Version]
Gene Name | Primer (5′–3′) |
---|---|
GAPD | CTTTCCCTGGTGAAGTTAG (F), GTTCAGGAAGTAAGCCATT® |
LSEI-2386 | ATTCATATGGACAGCATCCGTGATGTTTC (F), TTTGAATTCGCTGCCAGAACAAGTTGG®(R) |
LSEI-2163 | AAACATATGAAACGAAAGTGCCCCAAAAC (F), TTTGAATTCGCGACGATCTCTTGAA®TC (R) |
MRS | g/L | IF | g/L |
---|---|---|---|
Beef extract | 8 | Meat extract | 10.4 |
Glucose Tween 80 | 20 1 | Glucose Tween 80 | 10 1.1 |
K2HPO4·7H2O | 2 | K2HPO4 | 1 |
CH3COONa·H2O | 5 | CH3COONa | 6 |
MgSO4·7H2O | 0.2 | MgCl2·6H2O | 1 |
MnSO4·4H2O | 0.05 | MnSO4·H2O | 0.01 |
Triammonium citrate | 2 | KH2PO4 | 1 |
Oxoid peptone | 10 | NaCl | 0.01 |
Yeast extract | 4 | Bile salts | 0.1 |
Trypsin | 100 U/mL |
Nanoparticles | HDD (ζ-Potential) in Water, 0 h | HDD (ζ-Potential) in MRS, 0 h | HDD (ζ-Potential) in IF, 0 h | HDD in Water, 24 h | HDD in IF, 24 h | HDD (ζ-Potential) in Spent IF, 24 h |
---|---|---|---|---|---|---|
Ag NPs | 167 ± 20 nm (−53 ± 2 mV) | 573 ± 54 nm (−5 ± 0.5 mV) | 497 ± 38 nm (−9 ± 2 mV) | 95 ± 2 nm | 988 ± 179 nm | 557 ± 43 nm (−4 ± 0.6 mV) |
HA-Au NPs | 55 ± 1 nm (−19 ± 2 mV) | 364 ± 65 nm (−3 ± 1 mV) | 304 ± 27 nm (−6 ± 1 mV) | 20 ± 2 nm | 204 ± 10 nm | 222 ± 32 nm (−6 ± 1 mV) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, W.; Zhang, Y.; Li, Z.; Li, M.; Li, F.; Mortimer, M.; Guo, L.-H. Silver and Hyaluronic Acid-Coated Gold Nanoparticles Modulate the Metabolism of a Model Human Gut Bacterium Lactobacillus casei. Nanomaterials 2022, 12, 3377. https://doi.org/10.3390/nano12193377
Huang W, Zhang Y, Li Z, Li M, Li F, Mortimer M, Guo L-H. Silver and Hyaluronic Acid-Coated Gold Nanoparticles Modulate the Metabolism of a Model Human Gut Bacterium Lactobacillus casei. Nanomaterials. 2022; 12(19):3377. https://doi.org/10.3390/nano12193377
Chicago/Turabian StyleHuang, Wenqian, Yirong Zhang, Zhi Li, Minjie Li, Fangfang Li, Monika Mortimer, and Liang-Hong Guo. 2022. "Silver and Hyaluronic Acid-Coated Gold Nanoparticles Modulate the Metabolism of a Model Human Gut Bacterium Lactobacillus casei" Nanomaterials 12, no. 19: 3377. https://doi.org/10.3390/nano12193377
APA StyleHuang, W., Zhang, Y., Li, Z., Li, M., Li, F., Mortimer, M., & Guo, L.-H. (2022). Silver and Hyaluronic Acid-Coated Gold Nanoparticles Modulate the Metabolism of a Model Human Gut Bacterium Lactobacillus casei. Nanomaterials, 12(19), 3377. https://doi.org/10.3390/nano12193377