Impairment of PGC-1 Alpha Up-Regulation Enhances Nitrosative Stress in the Liver during Acute Pancreatitis in Obese Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Experimental Model of Acute Pancreatitis
2.3. RNA Extraction and RT-qPCR Analysis of Gene Expression
2.4. Western Blot Analysis
2.5. Co-Immunoprecipitation
2.6. Redox Pairs and Protein Nitration and Chlorination by UPLC-MS/MS Analysis
2.7. Energy Charge Determined by UPLC-MS/MS
2.8. Biochemical Assays
2.9. Histological Analysis
2.10. Statistical Analysis
3. Results
3.1. PGC-1α Levels are Up-Regulated in Mice Livers after Inducing Acute Pancreatitis
3.2. PGC-1α Restrains Nos2 Expression in the Liver after Acute Pancreatitis in Mice
3.3. PGC-1α Avoids the Assembly of the Complex between p65 and Phospho-STAT3 in the Liver during Experimental Acute Pancreatitis
3.4. PGC-1α Deficiency Downregulates Antioxidant Gene Expression and Increases Oxidative Stress in the Liver with Acute Pancreatitis
3.5. PGC-1α Prevents Protein Nitration in the Liver after Inducing Experimental Acute Pancreatitis
3.6. PGC-1α Levels Lower in the Livers of Obese Mice under Basal Conditions and during Pancreatitis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Crockett, S.D.; Wani, S.; Gardner, T.B.; Falck-Ytter, Y.; Barkun, A.N. American Gastroenterological Association Institute Clinical Guidelines Committee, American Gastroenterological Association Institute Guideline on Initial Management of Acute Pancreatitis. Gastroenterology. 2018, 154, 1096–1101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lankisch, P.G.; Apte, M.; Banks, P.A. Acute pancreatitis. Lancet 2015, 386, 85–96. [Google Scholar] [CrossRef]
- Schepers, N.J.; Bakker, O.J.; Besselink, M.G.; Ali, U.A.; Bollen, T.L.; Gooszen, H.G.; van Santvoort, H.C.; Bruno, M.J. Impact of characteristics of organ failure and infected necrosis on mortality in necrotising pancreatitis. Gut 2019, 68, 1044–1051. [Google Scholar] [CrossRef] [PubMed]
- Pérez, S.; Pereda, J.; Sabater, L.; Sastre, J. Redox signaling in acute pancreatitis. Redox Biol. 2015, 5, 1–14. [Google Scholar] [CrossRef] [Green Version]
- Tsai, K.; Wang, S.; Chen, T.; Kong, C.; Lee, S.; Lu, F. Oxidative stress: An important phenomenon with pathogenetic significance in the progression of acute pancreatitis. Gut 1998, 42, 850–855. [Google Scholar] [CrossRef] [Green Version]
- Sweiry, J.H.; Mann, G.E. Role of oxidative stress in the pathogenesis of acute pancreatitis. Scand. J. Gastroenterol. 1996, 31, 10–15. [Google Scholar] [CrossRef]
- Escobar, J.; Pereda, J.; Arduini, A.; Sandoval, J.; Moreno, M.L.; Pérez, S.; Sabater, L.; Aparici, L.; Cassinello, N.; Hidalgo, J.; et al. Oxidative and nitrosative stress in acute pancreatitis. Modul. Pentoxifylline Oxypurinol. Biochem. Pharmacol. 2011, 83, 122–130. [Google Scholar] [CrossRef]
- Rius-Pérez, S.; Pérez, S.; Torres-Cuevas, I.; Martí-Andrés, P.; Taléns-Visconti, R.; Paradela, A.; Guerrero, L.; Franco, L.; López-Rodas, G.; Torres, L.; et al. Blockade of the trans-sulfuration pathway in acute pancreatitis due to nitration of cystathionine β-synthase. Redox Biol. 2019, 28, 101324. [Google Scholar] [CrossRef]
- Ang, A.D.; Adhikari, S.; Ng, S.W.; Bhatia, M. Expression of Nitric Oxide Synthase Isoforms and Nitric Oxide Production in Acute Pancreatitis and Associated Lung Injury. Pancreatology 2009, 9, 150–159. [Google Scholar] [CrossRef]
- Cuzzocrea, S.; Mazzon, E.; Dugo, L.; Serrino, I.; Centorrino, E.; Ciccolo, A.; Van de Loo, F.; Britti, D.; Caputi, A.; Thiemermann, C. Inducible nitric oxide synthase-deficient mice exhibit resistance to the acute pancreatitis induced by cerulein. Shock 2002, 17, 416–422. [Google Scholar] [CrossRef]
- Yadav, D.; Lowenfels, A.B. The epidemiology of pancreatitis and pancreatic cancer. Gastroenterology 2013, 144, 1252–1261. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Emerenziani, S.; Pier Luca-Guarino, M.; Trilo-Asensio, L.M.; Altamore, A.; Ribolsi, M.; Balestrieri, P.; Cicala, M. Role of Overweight and Obesity in Gastrointestinal Disease. Nutrients 2020, 12, 111. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khatua, B.; El-Kurdi, B.; Singh, V.P. Obesity and pancreatitis. Curr. Opin. Gastroenterol. 2017, 33, 374–382. [Google Scholar] [CrossRef] [PubMed]
- Garg, P.K.; Singh, V.P. Organ Failure due to Systemic Injury in Acute Pancreatitis. Gastroenterology 2019, 156, 2008–2023. [Google Scholar] [CrossRef]
- Folch-Puy, E. Importance of the liver in systemic complications associated with acute pancreatitis: The role of Kupffer cells. J. Pathol. 2007, 211, 383–388. [Google Scholar] [CrossRef]
- Segersvärd, R.; Tsai, J.A.; Herrington, M.K.; Wang, F. Obesity alters cytokine gene expression and promotes liver injury in rats with acute pancreatitis. Obesity (Silver Spring) 2008, 16, 23–28. [Google Scholar] [CrossRef]
- Yoon, S.B.; Lee, I.S.; Choi, M.H.; Lee, K.; Ham, H.; Oh, H.J.; Park, S.H.; Lim, C.-H.; Choi, M.-G. Impact of Fatty Liver on Acute Pancreatitis Severity. Gastroenterol. Res. Pract. 2017, 2017, 4532320. [Google Scholar] [CrossRef]
- Rius-Pérez, S.; Torres-Cuevas, I.; Millán, I.; Ortega, Á.L.; Pérez, S. PGC-1α, Inflammation, and Oxidative Stress: An Integrative View in Metabolism. Oxid. Med. Cell Longev. 2020, 2020, 1452696. [Google Scholar] [CrossRef] [Green Version]
- Valle, I.; Alvarez-Barrientos, A.; Arza, E.; Lamas, S.; Monsalve, M. PGC-1alpha regulates the mitochondrial antioxidant defense system in vascular endothelial cells. Cardiovasc. Res. 2005, 66, 562–573. [Google Scholar] [CrossRef] [Green Version]
- Olmos, Y.; Sánchez-Gómez, F.J.; Wild, B.; García-Quintans, N.; Cabezudo, S.; Lamas, S.; Monsalve, M. SirT1 regulation of antioxidant genes is dependent on the formation of a FoxO3a/PGC-1α complex. Antioxid. Redox Signal. 2013, 19, 1507–1521. [Google Scholar] [CrossRef]
- Eisele, P.S.; Salatino, S.; Sobek, J.; Hottiger, M.O.; Handschin, C. The peroxisome proliferator-activated receptor γ coactivator 1α/β (PGC-1) coactivators repress the transcriptional activity of NF-κB in skeletal muscle cells. J. Biol. Chem. 2013, 288, 2246–2260. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yuan, S.; Liu, X.; Zhu, X.; Qu, Z.; Gong, Z.; Li, J.; Xiao, L.; Yang, Y.; Liu, H.; Sun, L.; et al. The Role of TLR4 on PGC-1α-Mediated Oxidative Stress in Tubular Cell in Diabetic Kidney Disease. Oxid. Med. Cell Longev. 2018, 2018, 6296802. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lin, J.; Wu, P.-H.; Tarr, P.T.; Lindenberg, K.S.; St-Pierre, J.; Zhang, C.-Y.; Mootha, V.K.; Jäger, S.; Vianna, C.R.; Reznick, R.M.; et al. Defects in adaptive energy metabolism with CNS-linked hyperactivity in PGC-1alpha null mice. Cell 2004, 119, 121–135. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Silva-Vaz, P.; Margarida-Abrantes, A.; Castelo-Branco, M.; Gouveia, A.; Botelho, M.F.; Ghiherme-Tralhao, J. Murine Models of Acute Pancreatitis: A Critical Appraisal of Clinical Relevance. Int. J. Mol. Sci. 2019, 20, 2794. [Google Scholar] [CrossRef] [Green Version]
- Monsalve, M.; Wu, Z.; Adelmant, G.; Puigserver, P.; Fan, M.; Spiegelman, B.M. Direct coupling of transcription and mRNA processing through the thermogenic coactivator PGC-1. Mol. Cell 2000, 6, 307–316. [Google Scholar] [CrossRef]
- Escobar, J.; Sánchez-Illana, A.; Kuligowski, J.; Torres-Cuevas, I.; Solberg, R.; Garberg, H.T.; Huun, M.U.; Saugstad, O.D.; Vento, M.; Cháfer-Pericás, C. Development of a reliable method based on ultra-performance liquid chromatography coupled to tandem mass spectrometry to measure thiol-associated oxidative stress in whole blood samples. J. Pharm. Biomed. Anal. 2016, 123, 104–112. [Google Scholar] [CrossRef]
- Henseley, K.; Maidt, M.L.; Pye, Q.N.; Stewart, C.A.; Wack, M.; Tabatabaie, T.; Floyd, R.A. Quantitation of protein-bound 3-nitrotyrosine and 3,4-dihydroxyphenylalanine by high-performance liquid chromatography with electrochemical array detection. Anal. Biochem. 1997, 251, 187–195. [Google Scholar] [CrossRef]
- Torres-Cuevas, I.; Kuligowsky, J.; Cárcel, M.; Cháfer-Pericas, C.; Asensi, M.; Solberg, R.; Cubells, E.; Nuñez, A.; Saugtad, O.D.; Vento, M.; et al. Protein-bound tyrosine oxidation, nitration and chlorination by-products assessed by ultraperformance liquid chromatography coupled to tandem mass spectrometry. Anal. Chem. Acta 2016, 913, 104–110. [Google Scholar] [CrossRef]
- Li, L.; Lu-Nan, Y.; Xiao-Li, C.; Wu-Sheng, L.; Xiao-Dong, X.; Yan-Tao, W. Hepatic adenylate energy charge levels in patients with hepatoma after hepatic artery embolization. World J. Gastroenteroly 1998, 15, 109–111. [Google Scholar] [CrossRef]
- Jiang, Y.; Chengjun, S.; Ding, X.; Yuan, D.; Chen, K.; Gao, B.; Chen, Y.; Sun, A. Simultaneous determination of adenine nucleotides, creatine phosphate and creatine in rat liver by high performance liquid chromatography electrospray ionization-tandem mass spectrometry. J. Pharm. Biomed. Anal. 2012, 66, 258–263. [Google Scholar] [CrossRef]
- Van Laethem, J.L.; Eskinazi, R.; Louis, H.; Rickaert, F.; Robberecht, P.; Deviere, J. Multisystemic production of interleukin 10 limits the severity of acute pancreatitis in mice. Gut 1998, 43, 408–413. [Google Scholar] [CrossRef] [PubMed]
- Pérez, S.; Rius-Pérez, S.; Finamor, I.; Martí-Andrés, P.; Prieto, I.; García, R.; Monsalve, M.; Sastre, J. Obesity causes Pgc-1α deficiency in the pancreas leading to marked Il-6 up-regulation via NF-κB in acute pancreatitis. J. Pathol. 2018, 247, 48–59. [Google Scholar] [CrossRef] [PubMed]
- Ma, J.F.; Sanchez, B.J.; Hall, D.T.; Tremblay, A.K.; Di Marco, S.; Gallouzi, I. STAT3 promotes IFNγ/TNFα-induced muscle wasting in an NF-κB-dependent and IL-6-independent manner. EMBO Mol. Med. 2017, 9, 622–637. [Google Scholar] [CrossRef] [PubMed]
- Nybo, T.; Dieterich, S.; Gamon, L.F.; Chuang, C.Y.; Hammer, A.; Hoefler, G.; Malle, E.; Rogowska-Wrzesinska, A.; Davies, M.J. Chlorination and oxidation of the extracellular matrix protein laminin and basement membrane extracts by hypochlorous acid and myeloperoxidase. Redox Biol. 2019, 20, 496–513. [Google Scholar] [CrossRef]
- Radi, R.; Cassina, A.; Hodara, R. Nitric oxide and peroxynitrite interactions with mitochondria. Biol. Chem. 2002, 383, 401–409. [Google Scholar] [CrossRef] [PubMed]
- Pérez, S.; Finamor, I.; Martí-Andrés, P.; Pereda, J.; Campos, A.; Domingues, R.; Haj, F.; Sabater, L.; de-Madaria, E.; Sastre, J. Role of obesity in the release of extracellular nucleosomes in acute pancreatitis: A clinical and experimental study. Int. J. Obes. (Lond) 2018, 43, 158–168. [Google Scholar] [CrossRef] [PubMed]
- Kleinert, H.; Pautz, A.; Linker, K.; Schwarz, P.M. Regulation of the expression of inducible nitric oxide synthase. Eur. J. Pharmacol. 2004, 500, 255–266. [Google Scholar] [CrossRef]
- Alvarez-Guardia, D.; Palomer, X.; Coll, T.; Davidson, M.M.; Chan, T.O.; Feldman, A.M.; Laguna, J.C.; Vázquez-Carrera, M. The p65 subunit of NF-kappaB binds to PGC-1alpha, linking inflammation and metabolic disturbances in cardiac cells. Cardiovasc. Res. 2010, 87, 449–458. [Google Scholar] [CrossRef] [Green Version]
- Barroso, W.A.; Victorino, V.J.; Jeremias, I.C.; Petroni, R.C.; Ariga, S.K.K.; Salles, T.A.; Barbeiro, D.F.; de Lima, T.M.; de Souza, H.P. High-fat diet inhibits PGC-1α suppressive effect on NFκB signaling in hepatocytes. Eur. J. Nutr. 2018, 57, 1891–1900. [Google Scholar] [CrossRef]
- Reiniers, M.J.; van Golen, R.F.; van Gulik, T.M.; Heger, M. Reactive Oxygen and Nitrogen Species in Steatotic Hepatocytes: A Molecular Perspective on the Pathophysiology of Ischemia-Reperfusion Injury in the Fatty Liver. Antioxid Redox Signal 2014, 21, 1119–1142. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Islam, M.S.; Yu, H.; Miao, L.; Liu, Z.; He, Y.; Sun, H. Hepatoprotective Effect of the Ethanol Extract of Illicium henryi against Acute Liver Injury in Mice Induced by Lipopolysaccharide. Antioxidants 2019, 8, 446. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Proniewski, B.; Kij, A.; Sitek, B.; Kelley, E.E.; Chlopicki, S. Multiorgan Development of Oxidative and Nitrosative Stress in LPS-Induced Endotoxemia in C57Bl/6 Mice: DHE-Based In Vivo Approach. Oxid. Med. Cell Longev. 2019, 2019, 7838406. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saad, B.; Frei, K.; Scholl, F.A.; Fontana, A.; Maier, P. Hepatocyte-Derived Interleukin-6 and Tumor-Necrosis Factor α Mediate the Lipopolysaccharide-Induced Acute-Phase Response and Nitric Oxide Release by Cultured Rat Hepatocytes. Eur. J. Biochem. 1995, 229, 349–355. [Google Scholar] [CrossRef] [PubMed]
- Dare, A.J.; Phillips, A.R.; Hickey, A.J.; Mittal, A.; Loveday, B.; Thompson, N.; Windsor, J.A. A systematic review of experimental treatments for mitochondrial dysfunction in sepsis and multiple organ dysfunction syndrome. Free Radic. Biol. Med. 2009, 47, 1517–1525. [Google Scholar] [CrossRef]
- Trumbeckaite, S.; Kuliaviene, I.; Deduchovas, O.; Kincius, M.; Baniene, R.; Virketyte, S.; Bukauskas, D.; Jansen, E.; Kupčinskas, L.; Borutaite, V.; et al. Experimental acute pancreatitis induces mitochondrial dysfunction in rat pancreas, kidney and lungs but not in liver. Pancreatology 2013, 13, 216–224. [Google Scholar] [CrossRef]
- Crunkhorn, S.; Dearie, F.; Mantzoros, C.; Gami, H.; da Silva, W.S.; Espinoza, D.; Faucette, R.; Barry, K.; Bianco, A.C.; Patti, M.E. Peroxisome proliferator activator receptor gamma coactivator-1 expression is reduced in obesity: Potential pathogenic role of saturated fatty acids and p38 mitogen-activated protein kinase activation. J. Biol. Chem. 2007, 282, 15439–15450. [Google Scholar] [CrossRef] [Green Version]
- Kaneki, M.; Shimizu, N.; Yamada, D.; Chang, K. Nitrosative Stress and Pathogenesis of Insulin Resistance. Antioxid. Redox Signal. 2007, 9, 319–329. [Google Scholar] [CrossRef]
- García-Ruiz, C.; Rodriguez-Juan, C.; Díaz-Juan, T.; Del Hoyo, P.; Colina, F.; Muñoz-Yagüe, T.; Solís-Herruzo, J.A. Uric acid and anti-TNF antibody improve mitochondrial dysfunction in ob/ob mice. Hepatology 2006, 44, 581–591. [Google Scholar] [CrossRef]
- Fangchao, M.; Jia, Y.; Man, L.; Mingwei, X.; Yupu, H.; Yu, Z.; Yudong, Y.; He, X.; Hongzhong, J.; Weixing, W. Magnesium isoglycyrrhizinate alleviates liver injury in obese rats with acute necrotizing pancreatitis. Pathol. Res. Pract. 2019, 215, 106–114. [Google Scholar] [CrossRef]
Target Gene (mm) | Direct/Reverse Oligonucleotide |
---|---|
Ppargc1a (Gene ID: 19017) | F --> TTAAAGTTCATGGGGCAAGC R --> TAGGAATGGCTGAAGGGATG |
Sod2 (Gene ID: 20656) | F --> GGCCAAGGGAGATGTTACAA R --> GAACCTTGGACTCCCACAGA |
Prx3 (Gene ID: 11757) | F --> CAAGAAAGAATGGTGGTTTGG R --> TGCTTGACGACACCATTAGG |
Nos2 (Gene ID: 18126) | F -->GCATCCCAAGTACGAGTGGGT R -->GAAGTCTCGAACTCCAATC |
Tbp (Gene ID: 21374) | F -->CAGCCTTCCACCTTATGCTC R --> CCGTAAGGCATCATTGGACT |
Target Gene (mm) | Sonda TaqMan |
---|---|
Tnfα (Gene ID: 21926) | Mm00443258_g1 |
Il6 (Gene ID: 16193) | Mm00446190_m1 |
Tbp (Gene ID: 21374) | Mm01277042_m1 |
Lean Group | Obese Group | |
---|---|---|
Body weight (g) | 22.9 ± 1.1 | 29.7 ± 1.8 ** |
Blood glucose (mg/dl) | 137.8 ± 25.8 | 201.6 ± 50.3 * |
Liver Triglycerides (mg/g protein) | 86.4 ± 22.4 | 138.8 ± 28.4 ** |
Liver Total Lipids (mg/g protein) | 665.8 ± 208.4 | 1581.7 ± 437.7 ** |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rius-Pérez, S.; Torres-Cuevas, I.; Monsalve, M.; Miranda, F.J.; Pérez, S. Impairment of PGC-1 Alpha Up-Regulation Enhances Nitrosative Stress in the Liver during Acute Pancreatitis in Obese Mice. Antioxidants 2020, 9, 887. https://doi.org/10.3390/antiox9090887
Rius-Pérez S, Torres-Cuevas I, Monsalve M, Miranda FJ, Pérez S. Impairment of PGC-1 Alpha Up-Regulation Enhances Nitrosative Stress in the Liver during Acute Pancreatitis in Obese Mice. Antioxidants. 2020; 9(9):887. https://doi.org/10.3390/antiox9090887
Chicago/Turabian StyleRius-Pérez, Sergio, Isabel Torres-Cuevas, María Monsalve, Francisco J. Miranda, and Salvador Pérez. 2020. "Impairment of PGC-1 Alpha Up-Regulation Enhances Nitrosative Stress in the Liver during Acute Pancreatitis in Obese Mice" Antioxidants 9, no. 9: 887. https://doi.org/10.3390/antiox9090887
APA StyleRius-Pérez, S., Torres-Cuevas, I., Monsalve, M., Miranda, F. J., & Pérez, S. (2020). Impairment of PGC-1 Alpha Up-Regulation Enhances Nitrosative Stress in the Liver during Acute Pancreatitis in Obese Mice. Antioxidants, 9(9), 887. https://doi.org/10.3390/antiox9090887