Neuroprotective Effects of Euonymus alatus Extract on Scopolamine-Induced Memory Deficits in Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of the Euonymus alatus Leaf Extract (EAE)
2.2. Chemicals and Reagents
2.3. Euonymus alatus Leaf DPPH and ABTS Radical Scavenging Assays
2.4. Determination of Rutin and Quercetin
2.5. Measurement of Inhibitory Activity against Acetylcholine Esterase
2.6. Cell Culture
2.7. Cell Viability Test and Transcriptional Activity Assay
2.8. Animal Experiment
2.9. Animal Behavioral Testing
2.10. Measurement of the Serum 8-Hydroxy-2′-Deoxyguanosine (8-OHdG) Level
2.11. Determination of Lipid Peroxidation in Liver Tissues
2.12. Western Blotting
2.13. Quantitative PCR Analysis
2.14. Histology
2.15. Statistical Analysis
3. Results
3.1. Radical Scavenging Activity of EAE
3.2. The Cytoprotective Effects of EAE
3.3. Effect of EAE on Scopolamine-induced Cognitive Impairment in Mice
3.4. Effect of EAE on Lipid Peroxidation and DNA Damage in Mice Challenged with Scopolamine
3.5. Effect of EAE on the Expression of BDNF, GDNF, and NMDA Receptor in the Mouse Hippocampus
3.6. Effect of EAE on the Nrf2/HO-1 Signaling Pathway and the PSD-95 Levels in the Hippocampus
3.7. Effects of the Oral Administration of EAE on the Scopolamine-Induced Neuronal Damage in the Hippocampus
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Suzuki, T.; Motohashi, H.; Yamamoto, M. Toward clinical application of the Keap1-Nrf2 pathway. Trends Pharmacol. Sci. 2013, 34, 340–346. [Google Scholar] [CrossRef] [PubMed]
- Bahn, G.; Park, J.S.; Yun, U.J.; Lee, Y.J.; Choi, Y.; Park, J.S.; Baek, S.H.; Choi, B.Y.; Cho, Y.S.; Kim, H.K.; et al. NRF2/ARE pathway negatively regulates BACE1 expression and ameliorates cognitive deficits in mouse Alzheimer’s models. Proc. Natl. Acad. Sci. USA 2019, 116, 12516–12523. [Google Scholar] [CrossRef] [PubMed]
- Uruno, A.; Matsumaru, D.; Ryoke, R.; Saito, R.; Kadoguchi, S.; Saigusa, D.; Saito, T.; Saido, T.C.; Kawashima, R.; Yamamoto, M. Nrf2 Suppresses Oxidative Stress and Inflammation in App Knock-In Alzheimer’s Disease Model Mice. Mol. Cell Biol. 2020, 40. [Google Scholar] [CrossRef] [PubMed]
- Lipton, S.A.; Rezaie, T.; Nutter, A.; Lopez, K.M.; Parker, J.; Kosaka, K.; Satoh, T.; McKercher, S.R.; Masliah, E.; Nakanishi, N. Therapeutic advantage of pro-electrophilic drugs to activate the Nrf2/ARE pathway in Alzheimer’s disease models. Cell Death Dis. 2016, 7, e2499. [Google Scholar] [CrossRef]
- Goverdhan, P.; Sravanthi, A.; Mamatha, T. Neuroprotective effects of meloxicAm. and selegiline in scopolamine-induced cognitive impairment and oxidative stress. Int. J. Alzheimers Dis. 2012, 2012, 974013. [Google Scholar] [CrossRef]
- Zhai, X.; Lenon, G.B.; Xue, C.C.; Li, C.G. Euonymus alatus: A Review on Its Phytochemistry and Antidiabetic Activity. Evid. Based Complement Alternat. Med. 2016, 2016, 9425714. [Google Scholar] [CrossRef]
- Fang, X.K.; Gao, J.; Zhu, D.N. Kaempferol and quercetin isolated from Euonymus alatus improve glucose uptake of 3T3-L1 cells without adipogenesis activity. Life Sci. 2008, 82, 615–622. [Google Scholar] [CrossRef]
- Zhang, F.; Yang, Y.; Su, P.; Guo, Z. Microwave-assisted extraction of rutin and quercetin from the stalks of Euonymus alatus (Thunb.) Sieb. Phytochem. Anal. 2009, 20, 33–37. [Google Scholar] [CrossRef]
- Katsube, T.; Tabata, H.; Ohta, Y.; Yamasaki, Y.; Anuurad, E.; Shiwaku, K.; Yamane, Y. Screening for antioxidant activity in edible plant products: A comparison of low-density lipoprotein oxidation assay, DPPH radical scavenging assay, and Folin-Ciocalteu assay. Abstr. Pap. Am. Chem. S 2004, 228, U53. [Google Scholar] [CrossRef]
- Re, R.; Pellegrini, N.; Proteggente, A.; Pannala, A.; Yang, M.; Rice-Evans, C. Antioxidant activity applying an improved ABTS radical cation decolorization assay. Free Radic. Biol. Med. 1999, 26, 1231–1237. [Google Scholar] [CrossRef]
- Thaipong, K.; Boonprakob, U.; Crosby, K.; Cisneros-Zevallos, L.; Byrne, D.H. Comparison of ABTS, DPPH, FRAP, and ORAC assays for estimating antioxidant activity from guava fruit extracts. J. Food Compos. Anal. 2006, 19, 669–675. [Google Scholar] [CrossRef]
- Ellman, G.L.; Courtney, K.D.; Andres, V., Jr.; Feather-Stone, R.M. A new and rapid colorimetric determination of acetylcholinesterase activity. BioChem. Pharmacol. 1961, 7, 88–95. [Google Scholar] [CrossRef]
- Orhan, I.; Sener, B.; Choudhary, M.I.; Khalid, A. Acetylcholinesterase and butyrylcholinesterase inhibitory activity of some Turkish medicinal plants. J. EthnoPharmacol. 2004, 91, 57–60. [Google Scholar] [CrossRef] [PubMed]
- Seo, J.Y.; Ju, S.H.; Oh, J.; Lee, S.K.; Kim, J.S. Neuroprotective and Cognition-Enhancing Effects of Compound K Isolated from Red Ginseng. J. Agric. Food Chem. 2016, 64, 2855–2864. [Google Scholar] [CrossRef]
- Kim, M.H.; Seo, J.Y.; Kim, J.S. Artemisia annua L. extract ameliorates galactose-induced cognitive impairment in mice. Food Sci. Biotechnol. 2015, 24, 1901–1905. [Google Scholar] [CrossRef]
- Watanabe, J.; Shetty, A.K.; Hattiangady, B.; Kim, D.K.; Foraker, J.E.; Nishida, H.; Prockop, D.J. Administration of TSG-6 improves memory after traumatic brain injury in mice. NeuroBiol. Dis. 2013, 59, 86–99. [Google Scholar] [CrossRef]
- Buege, J.A.; Aust, S.D. Microsomal lipid peroxidation. Methods EnzyMol. 1978, 52, 302–310. [Google Scholar] [CrossRef]
- Seo, H.; Oh, J.; Hahn, D.; Kwon, C.S.; Lee, J.S.; Kim, J.S. Protective Effect of Glyceollins in a Mouse Model of Dextran Sulfate Sodium-Induced Colitis. J. Med. Food 2017, 20, 1055–1062. [Google Scholar] [CrossRef]
- Oh, J.; Kim, J.; Jang, J.H.; Lee, S.; Park, C.M.; Kim, W.K.; Kim, J.S. Novel (1E, 3E, 5E)-1,6-bis(Substituted phenyl) hexa-1,3,5-triene Analogs Inhibit Melanogenesis in B16F10 Cells and Zebrafish. Int. J. Mol. Sci. 2018, 19, 1067. [Google Scholar] [CrossRef]
- Yan, Z.H.; Han, Z.Z.; Hu, X.Q.; Liu, Q.X.; Zhang, W.D.; Liu, R.H.; Li, H.L. Chemical constituents of Euonymus alatus. Chem. Nat. Compd. 2013, 49, 340–342. [Google Scholar] [CrossRef]
- Jeong, S.Y.; Nguyen, P.H.; Zhao, B.T.; Ali, M.Y.; Choi, J.S.; Min, B.S.; Woo, M.H. Chemical Constituents of Euonymus alatus (Thunb.) Sieb. and Their PTP1B and alpha-Glucosidase Inhibitory Activities. Phytother. Res. 2015, 29, 1540–1548. [Google Scholar] [CrossRef] [PubMed]
- Venkatesan, R.; Subedi, L.; Yeo, E.J.; Kim, S.Y. Lactucopicrin ameliorates oxidative stress mediated by scopolamine-induced neurotoxicity through activation of the NRF2 pathway. NeuroChem. Int. 2016, 99, 133–146. [Google Scholar] [CrossRef] [PubMed]
- Jeong, E.J.; Lee, K.Y.; Kim, S.H.; Sung, S.H.; Kim, Y.C. Cognitive-enhancing and antioxidant activities of iridoid glycosides from Scrophularia buergeriana in scopolamine-treated mice. Eur. J. Pharmacol. 2008, 588, 78–84. [Google Scholar] [CrossRef] [PubMed]
- Fan, Y.; Hu, J.; Li, J.; Yang, Z.; Xin, X.; Wang, J.; Ding, J.; Geng, M. Effect of acidic oligosaccharide sugar chain on scopolamine-induced memory impairment in rats and its related mechanisms. NeuroSci. Lett. 2005, 374, 222–226. [Google Scholar] [CrossRef]
- El-Sherbiny, D.A.; Khalifa, A.E.; Attia, A.S.; Eldenshary Eel, D. Hypericum perforatum extract demonstrates antioxidant properties against elevated rat brain oxidative status induced by amnestic dose of scopolamine. Pharmacol. BioChem. Behav. 2003, 76, 525–533. [Google Scholar] [CrossRef]
- Ishii, T.; Warabi, E.; Mann, G.E. Circadian control of BDNF-mediated Nrf2 activation in astrocytes protects dopaminergic neurons from ferroptosis. Free Radic. Biol. Med. 2019, 133, 169–178. [Google Scholar] [CrossRef]
- Lu, B.; Nagappan, G.; Lu, Y. BDNF and synaptic plasticity, cognitive function, and dysfunction. Handb. Exp. Pharmacol. 2014, 220, 223–250. [Google Scholar] [CrossRef]
- Connor, B.; Dragunow, M. The role of neuronal growth factors in neurodegenerative disorders of the human brain. Brain Res. Brain Res. Rev. 1998, 27, 1–39. [Google Scholar] [CrossRef]
- Murer, M.G.; Yan, Q.; Raisman-Vozari, R. Brain-derived neurotrophic factor in the control human brain, and in Alzheimer’s disease and Parkinson’s disease. Prog. NeuroBiol. 2001, 63, 71–124. [Google Scholar] [CrossRef]
- Zhang, L.; Fang, Y.; Xu, Y.M.; Lian, Y.J.; Xie, N.C.; Wu, T.W.; Zhang, H.F.; Sun, L.M.; Zhang, R.F.; Wang, Z.H. Curcumin Improves Amyloid beta-Peptide (1-42) Induced Spatial Memory Deficits through BDNF-ERK Signaling Pathway. PLoS ONE 2015, 10, e0131525. [Google Scholar] [CrossRef]
- Davies, P.; Maloney, A.J. Selective loss of central cholinergic neurons in Alzheimer’s disease. Lancet 1976, 2, 1403. [Google Scholar] [CrossRef]
- Whitehouse, P.J.; Price, D.L.; Struble, R.G.; Clark, A.W.; Coyle, J.T.; Delon, M.R. Alzheimer’s disease and senile dementia: Loss of neurons in the basal forebrain. Science 1982, 215, 1237–1239. [Google Scholar] [CrossRef] [PubMed]
- Laske, C.; Stellos, K.; Hoffmann, N.; Stransky, E.; Straten, G.; Eschweiler, G.W.; Leyhe, T. Higher BDNF serum levels predict slower cognitive decline in Alzheimer’s disease patients. Int. J. NeuropsychoPharmacol. 2011, 14, 399–404. [Google Scholar] [CrossRef] [PubMed]
- Manach, C.; Morand, C.; Demigne, C.; Texier, O.; Regerat, F.; Remesy, C. Bioavailability of rutin and quercetin in rats. FEBS Lett. 1997, 409, 12–16. [Google Scholar] [CrossRef]
- Yan, Z.H.; Han, Z.Z.; Hu, X.Q.; Liu, Q.X.; Zhang, W.D.; Liu, R.H.; Li, H.L. Two New Sesquiterpenes from Euonymus alatus. Helv. Chim. Acta 2013, 96, 85–92. [Google Scholar] [CrossRef]











| Experimental Group * | Scopolamine (1 mg/kg BW) | Treatment |
|---|---|---|
| Control | − | Vehicle |
| Scopolamine | + | Vehicle |
| Donepezil | + | 5 mg/kg BW |
| EAE_Low | + | 50 mg/kg BW |
| EAE_Middle | + | 100 mg/kg BW |
| EAE_High | + | 150 mg/kg BW |
| Gene | Primer (5′→3′) | Annealing Temperature (°C) | |
|---|---|---|---|
| Forward | Reverse | ||
| BDNF (NM_001316310) | CACTGGCTGACACTTTTGAGCAC | GCTGTGACCCACTCGCTAATACTG | 62 °C |
| GDNF (NM_001301357) | CCCGCTGAAGACCACTCCCTC | GCGCTGCCGCTTGTTTATCTGG | 64 °C |
| NMDA Receptor1 (NM_001372559) | GCAGFAAACCAGGCCAATA | TGACAGGGCCATCTGTAT | 54 °C |
| β-actin (XM_030254057) | ACTATTGGCAACGAGCGGTT | ATGGATGCCACAGGATTCCA | 52 °C |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Woo, Y.; Lim, J.S.; Oh, J.; Lee, J.S.; Kim, J.-S. Neuroprotective Effects of Euonymus alatus Extract on Scopolamine-Induced Memory Deficits in Mice. Antioxidants 2020, 9, 449. https://doi.org/10.3390/antiox9050449
Woo Y, Lim JS, Oh J, Lee JS, Kim J-S. Neuroprotective Effects of Euonymus alatus Extract on Scopolamine-Induced Memory Deficits in Mice. Antioxidants. 2020; 9(5):449. https://doi.org/10.3390/antiox9050449
Chicago/Turabian StyleWoo, Yunju, Ji Sun Lim, Jisun Oh, Jeong Soon Lee, and Jong-Sang Kim. 2020. "Neuroprotective Effects of Euonymus alatus Extract on Scopolamine-Induced Memory Deficits in Mice" Antioxidants 9, no. 5: 449. https://doi.org/10.3390/antiox9050449
APA StyleWoo, Y., Lim, J. S., Oh, J., Lee, J. S., & Kim, J.-S. (2020). Neuroprotective Effects of Euonymus alatus Extract on Scopolamine-Induced Memory Deficits in Mice. Antioxidants, 9(5), 449. https://doi.org/10.3390/antiox9050449

