Environmental Enrichment Attenuates Oxidative Stress and Alters Detoxifying Enzymes in an A53T α-Synuclein Transgenic Mouse Model of Parkinson’s Disease
Abstract
:1. Introduction
2. Materials and Methods
2.1. Transgenic Mouse Model of Parkinson’s Disease
2.2. Mice Rearing and Sacrifice
2.3. RNA Extraction
2.4. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.5. Immunohistochemistry (IHC)
2.6. Glutathione Activity Assay
2.7. Neurobehavioral Tests
2.7.1. Buried Food Test
2.7.2. Rotarod Test
2.7.3. Hanging Wire Test
2.8. Statistical Evaluation
3. Results
3.1. EE-Treated PD Mice Had Improved Neurobehavioral Outcomes
3.2. EE Attenuated Oxidative Stress in Olfactory Bulb, Brain Stem, and Frontal Cortex but not in the Striatum of PD Mice
3.3. Apototic Cell Death Was Decreased, and Cell Proliferation Was Preserved by EE in the SVZ
3.4. Expression of Detoxifying Enzymes Was Normalized in The Brain of EE-treated PD Mice
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Jagmag, S.A.; Tripathi, N.; Shukla, S.D.; Maiti, S.; Khurana, S. Evaluation of Models of Parkinson’s Disease. Front. Neurosci. 2015, 9, 503. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Seo, W.K.; Koh, S.B.; Kim, B.J.; Yu, S.W.; Park, M.H.; Park, K.W.; Lee, D.H. Prevalence of Parkinson’s disease in Korea. J. Clin. Neurosci. 2007, 14, 1155–1157. [Google Scholar] [CrossRef] [PubMed]
- Balestrino, R.; Schapira, A.H.V. Parkinson disease. Eur. J. Neurol. 2020, 27, 27–42. [Google Scholar] [CrossRef] [PubMed]
- Reichmann, H.; Jost, W. Parkinson’s disease—Many diseases with many faces. J. Neurol. 2008, 255 (Suppl. 5), 1. [Google Scholar] [CrossRef]
- Procaccini, C.; Santopaolo, M.; Faicchia, D.; Colamatteo, A.; Formisano, L.; de Candia, P.; Galgani, M.; De Rosa, V.; Matarese, G. Role of metabolism in neurodegenerative disorders. Metabolism 2016, 65, 1376–1390. [Google Scholar] [CrossRef]
- Nebert, D.W.; Dalton, T.P. The role of cytochrome P450 enzymes in endogenous signalling pathways and environmental carcinogenesis. Nat. Rev. Cancer 2006, 6, 947–960. [Google Scholar] [CrossRef]
- Ravindranath, V.; Strobel, H.W. Cytochrome P450-mediated metabolism in brain: Functional roles and their implications. Expert Opin. Drug Metab. Toxicol. 2013, 9, 551–558. [Google Scholar] [CrossRef]
- Heydel, J.M.; Coelho, A.; Thiebaud, N.; Legendre, A.; Le Bon, A.M.; Faure, P.; Neiers, F.; Artur, Y.; Golebiowski, J.; Briand, L. Odorant-binding proteins and xenobiotic metabolizing enzymes: Implications in olfactory perireceptor events. Anat. Rec. 2013, 296, 1333–1345. [Google Scholar] [CrossRef]
- Braak, H.; Rub, U.; Gai, W.P.; Del Tredici, K. Idiopathic Parkinson’s disease: Possible routes by which vulnerable neuronal types may be subject to neuroinvasion by an unknown pathogen. J. Neural Transm. 2003, 110, 517–536. [Google Scholar] [CrossRef]
- Del Tredici, K.; Rub, U.; De Vos, R.A.; Bohl, J.R.; Braak, H. Where does parkinson disease pathology begin in the brain? J. Neuropathol. Exp. Neurol. 2002, 61, 413–426. [Google Scholar] [CrossRef]
- Lionnet, A.; Leclair-Visonneau, L.; Neunlist, M.; Murayama, S.; Takao, M.; Adler, C.H.; Derkinderen, P.; Beach, T.G. Does Parkinson’s disease start in the gut? Acta Neuropathol. 2018, 135, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Minn, A.; Leclerc, S.; Heydel, J.M.; Minn, A.L.; Denizcot, C.; Cattarelli, M.; Netter, P.; Gradinaru, D. Drug transport into the mammalian brain: The nasal pathway and its specific metabolic barrier. J. Drug Target. 2002, 10, 285–296. [Google Scholar] [CrossRef] [PubMed]
- Seo, J.H.; Pyo, S.; Shin, Y.K.; Nam, B.G.; Kang, J.W.; Kim, K.P.; Lee, H.Y.; Cho, S.R. The Effect of Environmental Enrichment on Glutathione-Mediated Xenobiotic Metabolism and Antioxidation in Normal Adult Mice. Front. Neurol. 2018, 9, 425. [Google Scholar] [CrossRef] [PubMed]
- Rey, N.L.; Wesson, D.W.; Brundin, P. The olfactory bulb as the entry site for prion-like propagation in neurodegenerative diseases. Neurobiol. Dis. 2018, 109, 226–248. [Google Scholar] [CrossRef] [PubMed]
- Kalia, L.V.; Lang, A.E. Parkinson’s disease. Lancet 2015, 386, 896–912. [Google Scholar] [CrossRef]
- Lee, M.Y.; Yu, J.H.; Kim, J.Y.; Seo, J.H.; Park, E.S.; Kim, C.H.; Kim, H.; Cho, S.R. Alteration of synaptic activity-regulating genes underlying functional improvement by long-term exposure to an enriched environment in the adult brain. Neurorehabilit. Neural Repair 2013, 27, 561–574. [Google Scholar] [CrossRef]
- Will, B.; Galani, R.; Kelche, C.; Rosenzweig, M.R. Recovery from brain injury in animals: Relative efficacy of environmental enrichment, physical exercise or formal training (1990–2002). Prog. Neurobiol. 2004, 72, 167–182. [Google Scholar] [CrossRef] [PubMed]
- Seo, J.H.; Yu, J.H.; Suh, H.; Kim, M.S.; Cho, S.R. Fibroblast growth factor-2 induced by enriched environment enhances angiogenesis and motor function in chronic hypoxic-ischemic brain injury. PLoS ONE 2013, 8, e74405. [Google Scholar] [CrossRef] [Green Version]
- Mohammed, A.H.; Zhu, S.W.; Darmopil, S.; Hjerling-Leffler, J.; Ernfors, P.; Winblad, B.; Diamond, M.C.; Eriksson, P.S.; Bogdanovic, N. Environmental enrichment and the brain. Prog. Brain Res. 2002, 138, 109–133. [Google Scholar] [CrossRef]
- Kempermann, G.; Gast, D.; Gage, F.H. Neuroplasticity in old age: Sustained fivefold induction of hippocampal neurogenesis by long-term environmental enrichment. Ann. Neurol. 2002, 52, 135–143. [Google Scholar] [CrossRef]
- Ravikiran, T.; Sowbhagya, R.; Anupama, S.K.; Anand, S.; Bhagyalakshmi, D. Age-related changes in the brain antioxidant status: Modulation by dietary supplementation of Decalepis hamiltonii and physical exercise. Mol. Cell. Biochem. 2016, 419, 103–113. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wi, S.; Lee, J.W.; Kim, M.; Park, C.H.; Cho, S.R. An Enriched Environment Ameliorates Oxidative Stress and Olfactory Dysfunction in Parkinson’s Disease with alpha-Synucleinopathy. Cell Transplant. 2018, 27, 831–839. [Google Scholar] [CrossRef] [PubMed]
- Smith, T.W.; Lippa, C.F. Ki-67 immunoreactivity in Alzheimer’s disease and other neurodegenerative disorders. J. Neuropathol. Exp. Neurol. 1995, 54, 297–303. [Google Scholar] [CrossRef] [PubMed]
- Alvarez-Buylla, A.; Garcia-Verdugo, J.M. Neurogenesis in adult subventricular zone. J. Neurosci. 2002, 22, 629–634. [Google Scholar] [CrossRef] [Green Version]
- Farrell, K.F.; Krishnamachari, S.; Villanueva, E.; Lou, H.; Alerte, T.N.; Peet, E.; Drolet, R.E.; Perez, R.G. Non-motor parkinsonian pathology in aging A53T α-synuclein mice is associated with progressive synucleinopathy and altered enzymatic function. J. Neurochem. 2014, 128, 536–546. [Google Scholar] [CrossRef]
- Fan, L.W.; Lin, S.; Pang, Y.; Lei, M.; Zhang, F.; Rhodes, P.G.; Cai, Z. Hypoxia-ischemia induced neurological dysfunction and brain injury in the neonatal rat. Behav. Brain Res. 2005, 165, 80–90. [Google Scholar] [CrossRef]
- Tomlinson, C.L.; Herd, C.P.; Clarke, C.E.; Meek, C.; Patel, S.; Stowe, R.; Deane, K.H.; Shah, L.; Sackley, C.M.; Wheatley, K.; et al. Physiotherapy for Parkinson’s disease: A comparison of techniques. Cochrane Database Syst. Rev. 2014. [Google Scholar] [CrossRef] [Green Version]
- Palasz, E.; Niewiadomski, W.; Gasiorowska, A.; Wysocka, A.; Stepniewska, A.; Niewiadomska, G. Exercise-Induced Neuroprotection and Recovery of Motor Function in Animal Models of Parkinson’s Disease. Front. Neurol. 2019, 10, 1143. [Google Scholar] [CrossRef] [Green Version]
- Van der Kolk, N.M.; King, L.A. Effects of exercise on mobility in people with Parkinson’s disease. Mov. Disord. 2013, 28, 1587–1596. [Google Scholar] [CrossRef]
- Stuckenschneider, T.; Askew, C.D.; Meneses, A.L.; Baake, R.; Weber, J.; Schneider, S. The Effect of Different Exercise Modes on Domain-Specific Cognitive Function in Patients Suffering from Parkinson’s Disease: A Systematic Review of Randomized Controlled Trials. J. Parkinsons Dis. 2019, 9, 73–95. [Google Scholar] [CrossRef]
- Alves Da Rocha, P.; McClelland, J.; Morris, M.E. Complementary physical therapies for movement disorders in Parkinson’s disease: A systematic review. Eur. J. Phys. Rehabil. Med. 2015, 51, 693–704. [Google Scholar] [PubMed]
- Monteiro-Junior, R.S.; Cevada, T.; Oliveira, B.R.; Lattari, E.; Portugal, E.M.; Carvalho, A.; Deslandes, A.C. We need to move more: Neurobiological hypotheses of physical exercise as a treatment for Parkinson’s disease. Med. Hypotheses 2015, 85, 537–541. [Google Scholar] [CrossRef] [PubMed]
- Sehm, B.; Taubert, M.; Conde, V.; Weise, D.; Classen, J.; Dukart, J.; Draganski, B.; Villringer, A.; Ragert, P. Structural brain plasticity in Parkinson’s disease induced by balance training. Neurobiol. Aging 2014, 35, 232–239. [Google Scholar] [CrossRef] [PubMed]
- Fisher, B.E.; Li, Q.; Nacca, A.; Salem, G.J.; Song, J.; Yip, J.; Hui, J.S.; Jakowec, M.W.; Petzinger, G.M. Treadmill exercise elevates striatal dopamine D2 receptor binding potential in patients with early Parkinson’s disease. Neuroreport 2013, 24, 509–514. [Google Scholar] [CrossRef] [PubMed]
- Beall, E.B.; Lowe, M.J.; Alberts, J.L.; Frankemolle, A.M.; Thota, A.K.; Shah, C.; Phillips, M.D. The effect of forced-exercise therapy for Parkinson’s disease on motor cortex functional connectivity. Brain Connect. 2013, 3, 190–198. [Google Scholar] [CrossRef] [Green Version]
- Komitova, M.; Mattsson, B.; Johansson, B.B.; Eriksson, P.S. Enriched environment increases neural stem/progenitor cell proliferation and neurogenesis in the subventricular zone of stroke-lesioned adult rats. Stroke 2005, 36, 1278–1282. [Google Scholar] [CrossRef] [Green Version]
- Veena, J.; Srikumar, B.N.; Mahati, K.; Bhagya, V.; Raju, T.R.; Shankaranarayana Rao, B.S. Enriched environment restores hippocampal cell proliferation and ameliorates cognitive deficits in chronically stressed rats. J. Neurosci. Res. 2009, 87, 831–843. [Google Scholar] [CrossRef]
- Okuda, H.; Tatsumi, K.; Makinodan, M.; Yamauchi, T.; Kishimoto, T.; Wanaka, A. Environmental enrichment stimulates progenitor cell proliferation in the amygdala. J. Neurosci. Res. 2009, 87, 3546–3553. [Google Scholar] [CrossRef]
- Young, D.; Lawlor, P.A.; Leone, P.; Dragunow, M.; During, M.J. Environmental enrichment inhibits spontaneous apoptosis, prevents seizures and is neuroprotective. Nat. Med. 1999, 5, 448–453. [Google Scholar] [CrossRef]
- Chen, X.; Zhang, X.; Xue, L.; Hao, C.; Liao, W.; Wan, Q. Treatment with Enriched Environment Reduces Neuronal Apoptosis in the Periinfarct Cortex after Cerebral Ischemia/Reperfusion Injury. Cell. Physiol. Biochem. 2017, 41, 1445–1456. [Google Scholar] [CrossRef]
- Hoglinger, G.U.; Rizk, P.; Muriel, M.P.; Duyckaerts, C.; Oertel, W.H.; Caille, I.; Hirsch, E.C. Dopamine depletion impairs precursor cell proliferation in Parkinson disease. Nat. Neurosci. 2004, 7, 726–735. [Google Scholar] [CrossRef] [PubMed]
- Singh, S.; Dikshit, M. Apoptotic neuronal death in Parkinson’s disease: Involvement of nitric oxide. Brain Res. Rev. 2007, 54, 233–250. [Google Scholar] [CrossRef] [PubMed]
- Andersen, J.K. Does neuronal loss in Parkinson’s disease involve programmed cell death? Bioessays 2001, 23, 640–646. [Google Scholar] [CrossRef] [PubMed]
- Tatton, W.G.; Chalmers-Redman, R.; Brown, D.; Tatton, N. Apoptosis in Parkinson’s disease: Signals for neuronal degradation. Ann. Neurol. 2003, 53 (Suppl. 3), S61–S70. [Google Scholar] [CrossRef]
- Ekshyyan, O.; Aw, T.Y. Apoptosis: A key in neurodegenerative disorders. Curr. Neurovasc. Res. 2004, 1, 355–371. [Google Scholar] [CrossRef]
- Jungling, A.; Reglodi, D.; Karadi, Z.N.; Horvath, G.; Farkas, J.; Gaszner, B.; Tamas, A. Effects of Postnatal Enriched Environment in a Model of Parkinson’s Disease in Adult Rats. Int. J. Mol. Sci. 2017, 18, 406. [Google Scholar] [CrossRef] [Green Version]
- Steiner, B.; Winter, C.; Hosman, K.; Siebert, E.; Kempermann, G.; Petrus, D.S.; Kupsch, A. Enriched environment induces cellular plasticity in the adult substantia nigra and improves motor behavior function in the 6-OHDA rat model of Parkinson’s disease. Exp. Neurol. 2006, 199, 291–300. [Google Scholar] [CrossRef]
- Nithianantharajah, J.; Hannan, A.J. Enriched environments, experience-dependent plasticity and disorders of the nervous system. Nat. Rev. Neurosci. 2006, 7, 697–709. [Google Scholar] [CrossRef]
- Sha, J.C.; Ismail, R.; Marlena, D.; Lee, J.L. Environmental complexity and feeding enrichment can mitigate effects of space constraints in captive callitrichids. Lab. Anim. 2016, 50, 137–144. [Google Scholar] [CrossRef]
- Tsai, P.P.; Stelzer, H.D.; Hedrich, H.J.; Hackbarth, H. Are the effects of different enrichment designs on the physiology and behaviour of DBA/2 mice consistent? Lab. Anim. 2003, 37, 314–327. [Google Scholar] [CrossRef] [Green Version]
- Yan, D.; Zhang, Y.; Liu, L.; Shi, N.; Yan, H. Pesticide exposure and risk of Parkinson’s disease: Dose-response meta-analysis of observational studies. Regul. Toxicol. Pharmacol. 2018, 96, 57–63. [Google Scholar] [CrossRef] [PubMed]
- Langston, J.W. The MPTP Story. J. Parkinsons Dis. 2017, 7, S11–S19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Naoi, M.; Maruyama, W.; Akao, Y.; Yi, H. Dopamine-derived endogenous N-methyl-(R)-salsolinol: Its role in Parkinson’s disease. Neurotoxicol. Teratol. 2002, 24, 579–591. [Google Scholar] [CrossRef]
- Williams, A.C.; Cartwright, L.S.; Ramsden, D.B. Parkinson’s disease: The first common neurological disease due to auto-intoxication? QJM 2005, 98, 215–226. [Google Scholar] [CrossRef] [Green Version]
- Hamadjida, A.; Frouni, I.; Kwan, C.; Huot, P. Classic animal models of Parkinson’s disease: A historical perspective. Behav. Pharmacol. 2019, 30, 291–310. [Google Scholar] [CrossRef]
- Tanner, C.M.; Kamel, F.; Ross, G.W.; Hoppin, J.A.; Goldman, S.M.; Korell, M.; Marras, C.; Bhudhikanok, G.S.; Kasten, M.; Chade, A.R.; et al. Rotenone, paraquat, and Parkinson’s disease. Environ. Health Perspect. 2011, 119, 866–872. [Google Scholar] [CrossRef] [Green Version]
- Goldman, S.M. Environmental toxins and Parkinson’s disease. Annu. Rev. Pharmacol. Toxicol. 2014, 54, 141–164. [Google Scholar] [CrossRef]
- Dos Santos, L.R.B.; Fleming, I. Role of cytochrome P450-derived, polyunsaturated fatty acid mediators in diabetes and the metabolic syndrome. Prostaglandins Other Lipid Mediat. 2019, 148, 106407. [Google Scholar] [CrossRef]
- Manikandan, P.; Nagini, S. Cytochrome P450 Structure, Function and Clinical Significance: A Review. Curr. Drug Targets 2018, 19, 38–54. [Google Scholar] [CrossRef]
- Elfaki, I.; Mir, R.; Almutairi, F.M.; Duhier, F.M.A. Cytochrome P450: Polymorphisms and Roles in Cancer, Diabetes and Atherosclerosis. Asian Pac. J. Cancer Prev. 2018, 19, 2057–2070. [Google Scholar] [CrossRef]
- Fatunde, O.A.; Brown, S.A. The Role of CYP450 Drug Metabolism in Precision Cardio-Oncology. Int. J. Mol. Sci. 2020, 21, 604. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ghosh, C.; Hossain, M.; Solanki, J.; Dadas, A.; Marchi, N.; Janigro, D. Pathophysiological implications of neurovascular P450 in brain disorders. Drug Discov. Today 2016, 21, 1609–1619. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sonsalla, P.K.; Heikkila, R.E. The influence of dose and dosing interval on MPTP-induced dopaminergic neurotoxicity in mice. Eur. J. Pharmacol. 1986, 129, 339–345. [Google Scholar] [CrossRef]
- Apte, S.N.; Langston, J.W. Permanent neurological deficits due to lithium toxicity. Ann. Neurol. 1983, 13, 453–455. [Google Scholar] [CrossRef]
- Kopin, I.J.; Markey, S.P. MPTP toxicity: Implications for research in Parkinson’s disease. Annu. Rev. Neurosci. 1988, 11, 81–96. [Google Scholar] [CrossRef]
- Lim, J.L.; Wilhelmus, M.M.; de Vries, H.E.; Drukarch, B.; Hoozemans, J.J.; van Horssen, J. Antioxidative defense mechanisms controlled by Nrf2: State-of-the-art and clinical perspectives in neurodegenerative diseases. Arch. Toxicol. 2014, 88, 1773–1786. [Google Scholar] [CrossRef]
- Kolahdouzan, M.; Hamadeh, M.J. The neuroprotective effects of caffeine in neurodegenerative diseases. CNS Neurosci. Ther. 2017, 23, 272–290. [Google Scholar] [CrossRef]
- Ritz, B.; Ascherio, A.; Checkoway, H.; Marder, K.S.; Nelson, L.M.; Rocca, W.A.; Ross, G.W.; Strickland, D.; Van Den Eeden, S.K.; Gorell, J. Pooled analysis of tobacco use and risk of Parkinson disease. Arch. Neurol. 2007, 64, 990–997. [Google Scholar] [CrossRef] [Green Version]
- Breckenridge, C.B.; Berry, C.; Chang, E.T.; Sielken, R.L., Jr.; Mandel, J.S. Association between Parkinson’s Disease and Cigarette Smoking, Rural Living, Well-Water Consumption, Farming and Pesticide Use: Systematic Review and Meta-Analysis. PLoS ONE 2016, 11, e0151841. [Google Scholar] [CrossRef] [Green Version]
- Das, N.P.; Shahi, G.S.; Moochhala, S.M.; Sato, T.; Sunamoto, J. Effect of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) and its toxic metabolites on the physicochemical property of the liposomal membrane in relation to their cytochrome P-450 inhibition. Chem. Phys. Lipids 1992, 62, 303–310. [Google Scholar] [CrossRef]
- Singh, S.; Singh, K.; Gupta, S.P.; Patel, D.K.; Singh, V.K.; Singh, R.K.; Singh, M.P. Effect of caffeine on the expression of cytochrome P450 1A2, adenosine A2A receptor and dopamine transporter in control and 1-methyl 4-phenyl 1, 2, 3, 6-tetrahydropyridine treated mouse striatum. Brain Res. 2009, 1283, 115–126. [Google Scholar] [CrossRef]
- Oppermann, U. Carbonyl reductases: The complex relationships of mammalian carbonyl- and quinone-reducing enzymes and their role in physiology. Annu. Rev. Pharmacol. Toxicol. 2007, 47, 293–322. [Google Scholar] [CrossRef]
- Maser, E. Neuroprotective role for carbonyl reductase? Biochem. Biophys. Res. Commun. 2006, 340, 1019–1022. [Google Scholar] [CrossRef]
- Dalle-Donne, I.; Giustarini, D.; Colombo, R.; Rossi, R.; Milzani, A. Protein carbonylation in human diseases. Trends Mol. Med. 2003, 9, 169–176. [Google Scholar] [CrossRef]
- Curtis, J.M.; Hahn, W.S.; Long, E.K.; Burrill, J.S.; Arriaga, E.A.; Bernlohr, D.A. Protein carbonylation and metabolic control systems. Trends Endocrinol. Metab. 2012, 23, 399–406. [Google Scholar] [CrossRef] [Green Version]
- Ajith, T.A.; Vinodkumar, P. Advanced Glycation End Products: Association with the Pathogenesis of Diseases and the Current Therapeutic Advances. Curr. Clin. Pharmacol. 2016, 11, 118–127. [Google Scholar] [CrossRef]
- Ishikura, S.; Usami, N.; Araki, M.; Hara, A. Structural and functional characterization of rabbit and human L-gulonate 3-dehydrogenase. J. Biochem. 2005, 137, 303–314. [Google Scholar] [CrossRef]
- Androutsopoulos, V.P.; Kanavouras, K.; Tsatsakis, A.M. Role of paraoxonase 1 (PON1) in organophosphate metabolism: Implications in neurodegenerative diseases. Toxicol. Appl. Pharmacol. 2011, 256, 418–424. [Google Scholar] [CrossRef]
- Furlong, C.E.; Suzuki, S.M.; Stevens, R.C.; Marsillach, J.; Richter, R.J.; Jarvik, G.P.; Checkoway, H.; Samii, A.; Costa, L.G.; Griffith, A.; et al. Human PON1, a biomarker of risk of disease and exposure. Chem. Biol. Interact. 2010, 187, 355–361. [Google Scholar] [CrossRef] [Green Version]
- Menini, T.; Gugliucci, A. Paraoxonase 1 in neurological disorders. Redox Rep. 2014, 19, 49–58. [Google Scholar] [CrossRef]
- Clarimon, J.; Eerola, J.; Hellström, O.; Tienari, P.J.; Singleton, A. Paraoxonase 1 (PON1) gene polymorphisms and Parkinson’s disease in a Finnish population. Neurosci. Lett. 2004, 367, 168–170. [Google Scholar] [CrossRef] [PubMed]
- Akhmedova, S.N.; Yakimovsky, A.K.; Schwartz, E.I. Paraoxonase 1 Met--Leu 54 polymorphism is associated with Parkinson’s disease. J. Neurol. Sci. 2001, 184, 179–182. [Google Scholar] [CrossRef]
- Ahmed Laskar, A.; Younus, H. Aldehyde toxicity and metabolism: The role of aldehyde dehydrogenases in detoxification, drug resistance and carcinogenesis. Drug Metab. Rev. 2019, 51, 42–64. [Google Scholar] [CrossRef]
- Tafti, M.; Ghyselinck, N.B. Functional implication of the vitamin A signaling pathway in the brain. Arch. Neurol. 2007, 64, 1706–1711. [Google Scholar] [CrossRef]
- MacDonald, P.N.; Bok, D.; Ong, D.E. Localization of cellular retinol-binding protein and retinol-binding protein in cells comprising the blood-brain barrier of rat and human. Proc. Natl. Acad. Sci. USA 1990, 87, 4265–4269. [Google Scholar] [CrossRef] [Green Version]
- Takeda, A.; Nyssen, O.P.; Syed, A.; Jansen, E.; Bueno-de-Mesquita, B.; Gallo, V. Vitamin A and carotenoids and the risk of Parkinson’s disease: A systematic review and meta-analysis. Neuroepidemiology 2014, 42, 25–38. [Google Scholar] [CrossRef]
- Cai, H.; Liu, G.; Sun, L.; Ding, J. Aldehyde Dehydrogenase 1 making molecular inroads into the differential vulnerability of nigrostriatal dopaminergic neuron subtypes in Parkinson’s disease. Transl. Neurodegener. 2014, 3, 1–7. [Google Scholar] [CrossRef] [Green Version]
- Marchitti, S.A.; Deitrich, R.A.; Vasiliou, V. Neurotoxicity and metabolism of the catecholamine-derived 3,4-dihydroxyphenylacetaldehyde and 3,4-dihydroxyphenylglycolaldehyde: The role of aldehyde dehydrogenase. Pharmacol. Rev. 2007, 59, 125–150. [Google Scholar] [CrossRef]
- Zhang, Q.; Yan, W.; Bai, Y.; Zhu, Y.; Ma, J. Repeated formaldehyde inhalation impaired olfactory function and changed SNAP25 proteins in olfactory bulb. Int. J. Occup. Environ. Health 2014, 20, 308–312. [Google Scholar] [CrossRef] [Green Version]
- Jensen, N.; Oliveira, J.R. Basal ganglia vulnerability to oxidative stress. Front. Neurosci. 2014, 8, 80. [Google Scholar] [CrossRef] [Green Version]
- Kidd, P.M. Parkinson’s disease as multifactorial oxidative neurodegeneration: Implications for integrative management. Altern. Med. Rev. 2000, 5, 502–529. [Google Scholar] [PubMed]
- Cardoso, H.D.; Passos, P.P.; Lagranha, C.J.; Ferraz, A.C.; Santos Junior, E.F.; Oliveira, R.S.; Oliveira, P.E.; Santos Rde, C.; Santana, D.F.; Borba, J.M.; et al. Differential vulnerability of substantia nigra and corpus striatum to oxidative insult induced by reduced dietary levels of essential fatty acids. Front. Hum. Neurosci. 2012, 6, 249. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cardoso, H.D.; dos Santos Junior, E.F.; de Santana, D.F.; Goncalves-Pimentel, C.; Angelim, M.K.; Isaac, A.R.; Lagranha, C.J.; Guedes, R.C.; Beltrao, E.I.; Morya, E.; et al. Omega-3 deficiency and neurodegeneration in the substantia nigra: Involvement of increased nitric oxide production and reduced BDNF expression. Biochim. Biophys. Acta 2014, 1840, 1902–1912. [Google Scholar] [CrossRef] [PubMed]
Gene ID | Genes | Primer Sequences | |
---|---|---|---|
13077 | Cyp1a2 | Forward | GCTTCTCCATAGCCTCGGAC |
Reverse | TTAGCCACCGATTCCACCAC | ||
12409 | Cbr2 | Forward | CCCCCTTCCACATTCAAGCA |
Reverse | CTCCTCTGTGATGGTCTCGC | ||
68631 | Cryl1 | Forward | GATTGACGGCTTCGTCCTGA |
Reverse | GCATAGTCTCCAAGGGTCCG | ||
18979 | Pon1 | Forward | ATGACGCAGAGAATCCTCCC |
Reverse | TTTGTACACAGAGGCGACCG | ||
11522 | Adh1 | Forward | GACATAGAAGTCGCACCCCC |
Reverse | CCAACGCTCTCAACAATGCC | ||
26358 | Aldh1a7 | Forward | GGTTTAGCAGCAGGAGTCTTCA |
Reverse | CAGCCAAATAGCAGTTCACCC | ||
14433 | Gapdh | Forward | CAAGGTCATCCATGACAACTTTG |
Reverse | GTCCACCACCCTGTTGCTGTAG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Seo, J.H.; Kang, S.-W.; Kim, K.; Wi, S.; Lee, J.W.; Cho, S.-R. Environmental Enrichment Attenuates Oxidative Stress and Alters Detoxifying Enzymes in an A53T α-Synuclein Transgenic Mouse Model of Parkinson’s Disease. Antioxidants 2020, 9, 928. https://doi.org/10.3390/antiox9100928
Seo JH, Kang S-W, Kim K, Wi S, Lee JW, Cho S-R. Environmental Enrichment Attenuates Oxidative Stress and Alters Detoxifying Enzymes in an A53T α-Synuclein Transgenic Mouse Model of Parkinson’s Disease. Antioxidants. 2020; 9(10):928. https://doi.org/10.3390/antiox9100928
Chicago/Turabian StyleSeo, Jung Hwa, Seong-Woong Kang, Kyungri Kim, Soohyun Wi, Jang Woo Lee, and Sung-Rae Cho. 2020. "Environmental Enrichment Attenuates Oxidative Stress and Alters Detoxifying Enzymes in an A53T α-Synuclein Transgenic Mouse Model of Parkinson’s Disease" Antioxidants 9, no. 10: 928. https://doi.org/10.3390/antiox9100928
APA StyleSeo, J. H., Kang, S.-W., Kim, K., Wi, S., Lee, J. W., & Cho, S.-R. (2020). Environmental Enrichment Attenuates Oxidative Stress and Alters Detoxifying Enzymes in an A53T α-Synuclein Transgenic Mouse Model of Parkinson’s Disease. Antioxidants, 9(10), 928. https://doi.org/10.3390/antiox9100928