Combined Treatment with Three Natural Antioxidants Enhances Neuroprotection in a SH-SY5Y 3D Culture Model
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture and Treatment
2.2. 3D Model Preparation
2.3. MTT Assay
2.4. Prestoblue Assay
2.5. Reduced Glutathione (GSH) Level Measurement
2.6. Crystal Violet Assay
2.7. RNA Extraction and Real-Time PCR
3. Results
3.1. Development and Characterization of the 3D SH-SY5Y Culture System
3.2. SF, EGCG and PB Protect 3D SH-SY5Y Cells from Oxidative-Induced Injury
3.3. SEP Co-Treatment Enhances Antioxidant Defenses
3.4. SEP Co-Treatment Modulates Genes Involved in Oxidative Stress Control
3.5. SEP Co-Treatment is able to Modulate Insulin-Degrading Enzyme (IDE) Gene Expression
4. Discussion
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
Abbreviations
2D | Two-dimensional |
3D | Three-dimensional |
BDNF | Brain-derived neurotrophic factor |
DCFH-DA | 2,7-dichlorodihydrofluorescein diacetate |
DMEM | Dulbecco’s Modified Eagle’s medium |
DMSO | Dimethyl sulfoxide |
ECM | Extra cellular matrix |
EGCG | Epigallocatechin gallate |
GR | Glutathione reductase |
GSH | Reduced glutathione |
H2O2 | Hydrogen peroxide |
HO1 | Heme oxygenase 1 |
IDE | Insulin-degrading enzyme |
MAP2 | Microtubule-associated protein 2 |
MCB | Monochlorobimane |
MTT | 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide) |
NOX1 | NADPH oxidase 1 |
NOX2 | NADPH oxidase 2 |
NQO1 | NAD(P)H: quinone oxidoreductase 1 |
PB | Plumbagin |
PBS | Phosphate buffered saline |
PCR | Polymerase chain reaction |
RA | All-trans retinoic acid |
ROS | Reactive oxygen species |
RPS18 | Ribosomal protein S18 |
SEP | Sulforaphane, Epigallocatechin gallate, Plumbagin |
SF | Sulforaphane |
TR | Thioredoxin reductase 1 |
References
- Barnham, K.J.; Masters, C.L.; Bush, A.I. Neurodegenerative diseases and oxidative stress. Nat. Rev. Drug Discov. 2004, 3, 205–214. [Google Scholar] [CrossRef]
- Gammon, K. Neurodegenerative disease: Brain windfall. Nature 2014, 515, 299–300. [Google Scholar] [CrossRef] [PubMed]
- Tarozzi, A.; Angeloni, C.; Malaguti, M.; Morroni, F.; Hrelia, S.; Hrelia, P. Sulforaphane as a Potential Protective Phytochemical against Neurodegenerative Diseases. Oxid. Med. Cell. Longev. 2013, 2013, 415078. [Google Scholar] [CrossRef] [PubMed]
- Angeloni, C.; Malaguti, M.; Hrelia, S. Antiglycative activity of sulforaphane: A new avenue to counteract neurodegeneration? Neural Regen. Res. 2015, 10, 1750. [Google Scholar] [CrossRef] [PubMed]
- Lenzi, M.; Fimognari, C.; Hrelia, P. Sulforaphane as a Promising Molecule for Fighting Cancer. In Advances in Nutrition and Cancer; Cancer Treatment and Research; Springer: Berlin/Heidelberg, Germany, 2014; Volume 159, pp. 207–223. [Google Scholar]
- Bordoni, A.; Hrelia, S.; Angeloni, C.; Giordano, E.; Guarnieri, C.; Caldarera, C.M.; Biagi, P.L. Green tea protection of hypoxia/reoxygenation injury in cultured cardiac cells. J. Nutr. Biochem. 2002, 13, 103–111. [Google Scholar] [CrossRef]
- Singh, B.N.; Shankar, S.; Srivastava, R.K. Green tea catechin, epigallocatechin-3-gallate (EGCG): Mechanisms, perspectives and clinical applications. Biochem. Pharmacol. 2011, 82, 1807–1821. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Singh, N.A.; Mandal, A.K.A.; Khan, Z.A. Potential neuroprotective properties of epigallocatechin-3-gallate (EGCG). Nutr. J. 2016, 15, 60. [Google Scholar] [CrossRef]
- Chen, X.-J.; Zhang, J.-G.; Wu, L. Plumbagin inhibits neuronal apoptosis, intimal hyperplasia and also suppresses TNF-α/NF-κB pathway induced inflammation and matrix metalloproteinase-2/9 expression in rat cerebral ischemia. Saudi J. Biol. Sci. 2017, 25, 1033–1039. [Google Scholar] [CrossRef]
- Yuan, J.-H.; Pan, F.; Chen, J.; Chen, C.-E.; Xie, D.-P.; Jiang, X.-Z.; Guo, S.-J.; Zhou, J. Neuroprotection by plumbagin involves BDNF-TrkB-PI3K/Akt and ERK1/2/JNK pathways in isoflurane-induced neonatal rats. J. Pharm. Pharmacol. 2017, 69, 896–906. [Google Scholar] [CrossRef]
- Luo, P.; Wong, Y.F.; Ge, L.; Zhang, Z.F.; Liu, Y.; Liu, L.; Zhou, H. Anti-inflammatory and analgesic effect of plumbagin through inhibition of nuclear factor-κB activation. J. Pharmacol. Exp. Ther. 2010, 335, 735–742. [Google Scholar] [CrossRef]
- Padhye, S.; Dandawate, P.; Yusufi, M.; Ahmad, A.; Sarkar, F.H. Perspectives on medicinal properties of plumbagin and its analogs. Med. Res. Rev. 2012, 32, 1131–1158. [Google Scholar] [CrossRef] [PubMed]
- Arruri, V.; Komirishetty, P.; Areti, A.; Dungavath, S.K.N.; Kumar, A. Nrf2 and NF-κB modulation by Plumbagin attenuates functional, behavioural and biochemical deficits in rat model of neuropathic pain. Pharmacol. Rep. 2017, 69, 625–632. [Google Scholar] [CrossRef] [PubMed]
- Maraldi, T. Natural compounds as modulators of NADPH oxidases. Oxid. Med. Cell. Longev. 2013, 2013, 271602. [Google Scholar] [CrossRef] [PubMed]
- Tarozzi, A.; Morroni, F.; Merlicco, A.; Hrelia, S.; Angeloni, C.; Cantelli-Forti, G.; Hrelia, P. Sulforaphane as an inducer of glutathione prevents oxidative stress-induced cell death in a dopaminergic-like neuroblastoma cell line. J. Neurochem. 2009, 111, 1161–1171. [Google Scholar] [CrossRef] [PubMed]
- Jeong, J.H.; Kim, H.J.; Lee, T.J.; Kim, M.K.; Park, E.S.; Choi, B.S. Epigallocatechin 3-gallate attenuates neuronal damage induced by 3-hydroxykynurenine. Toxicology 2004, 195, 53–60. [Google Scholar] [CrossRef] [PubMed]
- Son, T.G.; Camandola, S.; Arumugam, T.V.; Cutler, R.G.; Telljohann, R.S.; Mughal, M.R.; Moore, T.A.; Luo, W.; Yu, Q.-S.; Johnson, D.A.; et al. Plumbagin, a novel Nrf2/ARE activator, protects against cerebral ischemia. J. Neurochem. 2010, 112, 1316–1326. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Holmes, A.M.; Charlton, A.; Derby, B.; Ewart, L.; Scott, A.; Shu, W. Rising to the challenge: Applying biofabrication approaches for better drug and chemical product development. Biofabrication 2017, 9, 033001. [Google Scholar] [CrossRef] [PubMed]
- Papadimitriou, C.; Celikkaya, H.; Cosacak, M.I.; Mashkaryan, V.; Bray, L.; Bhattarai, P.; Brandt, K.; Hollak, H.; Chen, X.; He, S.; et al. 3D Culture Method for Alzheimer’s Disease Modeling Reveals Interleukin-4 Rescues Aβ42-Induced Loss of Human Neural Stem Cell Plasticity. Dev. Cell 2018, 46, 85–101. [Google Scholar] [CrossRef]
- Zhang, D.; Pekkanen-Mattila, M.; Shahsavani, M.; Falk, A.; Teixeira, A.I.; Herland, A. A 3D Alzheimer’s disease culture model and the induction of P21-activated kinase mediated sensing in iPSC derived neurons. Biomaterials 2014, 35, 1420–1428. [Google Scholar] [CrossRef]
- Xicoy, H.; Wieringa, B.; Martens, G.J.M. The SH-SY5Y cell line in Parkinson’s disease research: A systematic review. Mol. Neurodegener. 2017, 12, 10. [Google Scholar] [CrossRef]
- Lázaro, D.F.; Angeliki, M.; Pavlou, S.; Outeiro, T.F. Cellular models as tools for the study of the role of alpha-synuclein in Parkinson’s disease. Exp. Neurol. 2017, 298, 162–171. [Google Scholar] [CrossRef] [PubMed]
- Morabito, C.; Steimberg, N.; Mazzoleni, G.; Guarnieri, S.; Fanò-Illic, G.; Mariggiò, M.A.; Mariggi, M.A. RCCS Bioreactor-Based Modelled Microgravity Induces Significant Changes on In Vitro 3D Neuroglial Cell Cultures. BioMed Res. Int. 2015, 2015, 754283. [Google Scholar] [CrossRef] [PubMed]
- Seidel, D.; Krinke, D.; Jahnke, H.G.; Hirche, A.; Kloß, D.; Mack, T.G.A.; Striggow, F.; Robitzki, A. Induced Tauopathy in a Novel 3D-Culture Model Mediates Neurodegenerative Processes: A Real-Time Study on Biochips. PLoS ONE 2012, 7, e49150. [Google Scholar] [CrossRef] [PubMed]
- De Simone, U.; Roccio, M.; Gribaldo, L.; Spinillo, A.; Caloni, F.; Coccini, T. Human 3D Cultures as Models for Evaluating Magnetic Nanoparticle CNS Cytotoxicity after Short-and Repeated Long-Term Exposure. Int. J. Mol. Sci. 2018, 19, 1993. [Google Scholar] [CrossRef] [PubMed]
- Li, G.N.; Livi, L.L.; Gourd, C.M.; Deweerd, E.S.; Hoffman-Kim, D. Genomic and Morphological Changes of Neuroblastoma Cells in Response to Three-Dimensional Matrices. Tissue Eng. 2007, 13, 1035–1047. [Google Scholar] [CrossRef] [PubMed]
- Innala, M.; Riebe, I.; Kuzmenko, V.; Sundberg, J.; Gatenholm, P.; Hanse, E.; Johannesson, S. 3D Culturing and differentiation of SH-SY5Y neuroblastoma cells on bacterial nanocellulose scaffolds. Artif. Cells Nanomed. Biotechnol. 2014, 42, 302–308. [Google Scholar] [CrossRef] [PubMed]
- Tunesi, M.; Fusco, F.; Fiordaliso, F.; Corbelli, A.; Biella, G.; Raimondi, M.T. Optimization of a 3D Dynamic Culturing System for In Vitro Modeling of Frontotemporal Neurodegeneration-Relevant Pathologic Features. Front. Aging Neurosci. 2016, 8, 146. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Desai, A.; Kisaalita, W.S.; Keith, C.; Wu, Z.-Z. Human neuroblastoma (SH-SY5Y) cell culture and differentiation in 3-D collagen hydrogels for cell-based biosensing. Biosens. Bioelectron. 2006, 21, 1483–1492. [Google Scholar] [CrossRef] [PubMed]
- Lv, D.; Yu, S.-C.; Ping, Y.-F.; Wu, H.; Zhao, X.; Zhang, H.; Cui, Y.; Chen, B.; Zhang, X.; Dai, J.; et al. A three-dimensional collagen scaffold cell culture system for screening anti-glioma therapeutics. Oncotarget 2016, 7, 56904–56914. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Angeloni, C.; Teti, G.; Barbalace, M.C.; Malaguti, M.; Falconi, M.; Hrelia, S. 17β-Estradiol enhances sulforaphane cardioprotection against oxidative stress. J. Nutr. Biochem. 2017, 42, 26–36. [Google Scholar] [CrossRef] [PubMed]
- Lopes, F.M.; Schroder, R.; da Frota Junior, M.L.C.; Zanotto-Filho, A.; Muller, C.B.; Pires, A.S.; Meurer, R.T.; Colpo, G.D.; Gelain, D.P.; Kapczinski, F.; et al. Comparison between proliferative and neuron-like SH-SY5Y cells as an in vitro model for Parkinson disease studies. Brain Res. 2010, 1337, 85–94. [Google Scholar] [CrossRef] [PubMed]
- Giusti, L.; Angeloni, C.; Barbalace, M.; Lacerenza, S.; Ciregia, F.; Ronci, M.; Urbani, A.; Manera, C.; Digiacomo, M.; Macchia, M.; et al. A Proteomic Approach to Uncover Neuroprotective Mechanisms of Oleocanthal against Oxidative Stress. Int. J. Mol. Sci. 2018, 19, 2329. [Google Scholar] [CrossRef] [PubMed]
- Angeloni, C.; Malaguti, M.; Rizzo, B.; Barbalace, M.C.; Fabbri, D.; Hrelia, S. Neuroprotective Effect of Sulforaphane against Methylglyoxal Cytotoxicity. Chem. Res. Toxicol. 2015, 28, 1234–1245. [Google Scholar] [CrossRef] [PubMed]
- Angeloni, C.; Prata, C.; Vieceli Dalla Sega, F.; Piperno, R.; Hrelia, S. Traumatic Brain Injury and NADPH Oxidase: A Deep Relationship. Oxid. Med. Cell. Longev. 2015, 2015, 370312. [Google Scholar] [CrossRef] [PubMed]
- Kurochkin, I.V.; Guarnera, E.; Berezovsky, I.N. Insulin-Degrading Enzyme in the Fight against Alzheimer’s Disease. Trends Pharmacol. Sci. 2018, 39, 49–58. [Google Scholar] [CrossRef] [PubMed]
- Sikanyika, N.L.; Parkington, H.C.; Smith, A.I.; Kuruppu, S. Powering Amyloid Beta Degrading Enzymes: A Possible Therapy for Alzheimer’s Disease. Neurochem. Res. 2019, 44, 1289–1296. [Google Scholar] [CrossRef] [PubMed]
- Heemels, M.-T. Neurodegenerative diseases. Nature 2016, 539, 179. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Guo, C.; Kong, J. Oxidative stress in neurodegenerative diseases. Neural Regen. Res. 2012, 7, 376–385. [Google Scholar] [CrossRef] [PubMed]
- Uttara, B.; Singh, A.V.; Zamboni, P.; Mahajan, R.T. Oxidative stress and neurodegenerative diseases: A review of upstream and downstream antioxidant therapeutic options. Curr. Neuropharmacol. 2009, 7, 65–74. [Google Scholar] [CrossRef]
- Mazzoleni, G.; Di Lorenzo, D.; Steimberg, N. Modelling tissues in 3D: The next future of pharmaco-toxicology and food research? Genes Nutr. 2009, 4, 13–22. [Google Scholar] [CrossRef]
- Marrazzo, P.; Maccari, S.; Taddei, A.; Bevan, L.; Telford, J.; Soriani, M.; Pezzicoli, A. 3D Reconstruction of the Human Airway Mucosa In Vitro as an Experimental Model to Study NTHi Infections. PLoS ONE 2016, 11, e0153985. [Google Scholar] [CrossRef] [PubMed]
- Brännvall, K.; Bergman, K.; Wallenquist, U.; Svahn, S.; Bowden, T.; Hilborn, J.; Forsberg-Nilsson, K. Enhanced neuronal differentiation in a three-dimensional collagen-hyaluronan matrix. J. Neurosci. Res. 2007, 85, 2138–2146. [Google Scholar] [CrossRef] [PubMed]
- Dong, C.; Lv, Y. Application of Collagen Scaffold in Tissue Engineering: Recent Advances and New Perspectives. Polymers 2016, 8, 42. [Google Scholar] [CrossRef] [PubMed]
- Glowacki, J.; Mizuno, S. Collagen scaffolds for tissue engineering. Biopolymers 2008, 89, 338–344. [Google Scholar] [CrossRef] [PubMed]
- Willerth, S.M.; Sakiyama-Elbert, S.E. Approaches to neural tissue engineering using scaffolds for drug delivery. Adv. Drug Deliv. Rev. 2007, 59, 325–338. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gao, X.; Wang, Y.; Chen, J.; Peng, J. The role of peripheral nerve ECM components in the tissue engineering nerve construction. Rev. Neurosci. 2013, 24, 443–453. [Google Scholar] [CrossRef]
- Gonzalez-Perez, F.; Udina, E.; Navarro, X. Extracellular Matrix Components in Peripheral Nerve Regeneration. Int. Rev. Neurobiol. 2013, 108, 257–275. [Google Scholar] [CrossRef]
- Kelsey, N.A.; Wilkins, H.M.; Linseman, D.A. Nutraceutical antioxidants as novel neuroprotective agents. Molecules 2010, 15, 7792–7814. [Google Scholar] [CrossRef] [PubMed]
- Tilak, J.C.; Adhikari, S.; Devasagayam, T.P.A. Antioxidant properties of Plumbago zeylanica, an Indian medicinal plant and its active ingredient, plumbagin. Redox Rep. 2004, 9, 219–227. [Google Scholar] [CrossRef]
- Vashist, A.; Kaushik, A.; Vashist, A.; Bala, J.; Nikkhah-Moshaie, R.; Sagar, V.; Nair, M. Nanogels as potential drug nanocarriers for CNS drug delivery. Drug Discov. Today 2018, 23, 1436–1443. [Google Scholar] [CrossRef]
- Wang, K.-H.; Li, B.-Z. Plumbagin protects against hydrogen peroxide-induced neurotoxicity by modulating NF-κB and Nrf-2. Arch. Med. Sci. 2018, 14, 1112–1118. [Google Scholar] [CrossRef]
- Wang, S.; Zhang, Z.; Zhao, S. Plumbagin inhibits amyloid-β-induced neurotoxicity. Neuroreport 2018, 29, 1269–1274. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Yang, T.; Leak, R.K.; Chen, J.; Zhang, F. Preventive and Protective Roles of Dietary Nrf2 Activators Against Central Nervous System Diseases. CNS Neurol. Disord. Drug Targets 2017, 16, 326–338. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khan, M.B.; Hoda, M.N.; Ishrat, T.; Ahmad, S.; Moshahid Khan, M.; Ahmad, A.; Yusuf, S.; Islam, F. Neuroprotective efficacy of Nardostachys jatamansi and crocetin in conjunction with selenium in cognitive impairment. Neurol. Sci. 2012, 33, 1011–1020. [Google Scholar] [CrossRef] [PubMed]
- Zaky, A.; Bassiouny, A.; Farghaly, M.; El-Sabaa, B.M. A Combination of Resveratrol and Curcumin is Effective Against Aluminum Chloride-Induced Neuroinflammation in Rats. J. Alzheimer’s Dis. 2017, 60, S221–S235. [Google Scholar] [CrossRef] [PubMed]
- Dhitavat, S.; Ortiz, D.; Rogers, E.; Rivera, E.; Shea, T.B. Folate, vitamin E, and acetyl-l-carnitine provide synergistic protection against oxidative stress resulting from exposure of human neuroblastoma cells to amyloid-beta. Brain Res. 2005, 1061, 114–117. [Google Scholar] [CrossRef]
- Cheng, Y.; Rong, J. Therapeutic Potential of Heme Oxygenase-1/carbon Monoxide System Against Ischemia-Reperfusion Injury. Curr. Pharm. Des. 2017, 23. [Google Scholar] [CrossRef]
- Ross, D.; Siegel, D. Functions of NQO1 in Cellular Protection and CoQ10 Metabolism and its Potential Role as a Redox Sensitive Molecular Switch. Front. Physiol. 2017, 8, 595. [Google Scholar] [CrossRef]
- Couto, N.; Wood, J.; Barber, J. The role of glutathione reductase and related enzymes on cellular redox homoeostasis network. Free Radic. Biol. Med. 2016, 95, 27–42. [Google Scholar] [CrossRef]
- Lu, J.; Holmgren, A. The thioredoxin antioxidant system. Free Radic. Biol. Med. 2014, 66, 75–87. [Google Scholar] [CrossRef]
- Li, J.; Li, W.; Jiang, Z.G.; Ghanbari, H. Oxidative stress and neurodegenerative disorders. Int. J. Mol. Sci. 2013, 14, 24438–24475. [Google Scholar] [CrossRef] [PubMed]
- De Oliveira, M.R.; Brasil, F.B.; Fürstenau, C.R. Sulforaphane Attenuated the Pro-Inflammatory State Induced by Hydrogen Peroxide in SH-SY5Y Cells Through the Nrf2/HO-1 Signaling Pathway. Neurotox. Res. 2018, 34, 241–249. [Google Scholar] [CrossRef]
- Vauzour, D.; Buonfiglio, M.; Corona, G.; Chirafisi, J.; Vafeiadou, K.; Angeloni, C.; Hrelia, S.; Hrelia, P.; Spencer, J.P.E. Sulforaphane protects cortical neurons against 5- S -cysteinyl-dopamine-induced toxicity through the activation of ERK1/2, Nrf-2 and the upregulation of detoxification enzymes. Mol. Nutr. Food Res. 2010, 54, 532–542. [Google Scholar] [CrossRef] [PubMed]
- Romeo, L.; Intrieri, M.; D’Agata, V.; Mangano, N.G.; Oriani, G.; Ontario, M.L.; Scapagnini, G. The major green tea polyphenol, (-)-epigallocatechin-3-gallate, induces heme oxygenase in rat neurons and acts as an effective neuroprotective agent against oxidative stress. J. Am. Coll. Nutr. 2009, 28, S492–S499. [Google Scholar] [CrossRef] [PubMed]
- Han, J.; Wang, M.; Jing, X.; Shi, H.; Ren, M.; Lou, H. (−)-Epigallocatechin Gallate Protects Against Cerebral Ischemia-Induced Oxidative Stress via Nrf2/ARE Signaling. Neurochem. Res. 2014, 39, 1292–1299. [Google Scholar] [CrossRef] [PubMed]
- Marrazzo, P.; Angeloni, C.; Freschi, M.; Lorenzini, A.; Prata, C.; Maraldi, T.; Hrelia, S. Combination of epigallocatechin gallate and sulforaphane counteracts in vitro oxidative stress and delays stemness loss of amniotic fluid stem cells. Oxid. Med. Cell. Longev. 2018, 2018, 5263985. [Google Scholar] [CrossRef] [PubMed]
- Zhu, X.; Yang, J.; Zhu, W.; Yin, X.; Yang, B.; Wei, Y.; Guo, X. Combination of Berberine with Resveratrol Improves the Lipid-Lowering Efficacy. Int. J. Mol. Sci. 2018, 19, 3903. [Google Scholar] [CrossRef] [PubMed]
- Ma, M.W.; Wang, J.; Zhang, Q.; Wang, R.; Dhandapani, K.M.; Vadlamudi, R.K.; Brann, D.W. NADPH oxidase in brain injury and neurodegenerative disorders. Mol. Neurodegener. 2017, 12, 7. [Google Scholar] [CrossRef] [PubMed]
- Shyu, K.-G.; Chang, C.-C.; Yeh, Y.-C.; Sheu, J.-R.; Chou, D.-S. Mechanisms of Ascorbyl Radical Formation in Human Platelet-Rich Plasma. Biomed Res. Int. 2014, 2014, 614506. [Google Scholar] [CrossRef]
- Coso, S.; Harrison, I.; Harrison, C.B.; Vinh, A.; Sobey, C.G.; Drummond, G.R.; Williams, E.D.; Selemidis, S. NADPH Oxidases as Regulators of Tumor Angiogenesis: Current and Emerging Concepts. Antioxid. Redox Signal. 2012, 16, 1229–1247. [Google Scholar] [CrossRef] [Green Version]
- Selemidis, S.; Sobey, C.G.; Wingler, K.; Schmidt, H.H.H.W.; Drummond, G.R. NADPH oxidases in the vasculature: Molecular features, roles in disease and pharmacological inhibition. Pharmacol. Ther. 2008, 120, 254–291. [Google Scholar] [CrossRef] [PubMed]
- Armitage, M.E.; Wingler, K.; Schmidt, H.H.H.W.; La, M. Translating the oxidative stress hypothesis into the clinic: NOX versus NOS. J. Mol. Med. 2009, 87, 1071–1076. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stargardt, A.; Gillis, J.; Kamphuis, W.; Wiemhoefer, A.; Kooijman, L.; Raspe, M.; Benckhuijsen, W.; Drijfhout, J.W.; Reits, E. Reduced amyloid-β degradation in early Alzheimer’s disease but not in the APPswePS1dE9 and 3xTg-AD mouse models. Aging Cell 2013, 12, 499–507. [Google Scholar] [CrossRef] [PubMed]
- Portelius, E.; Mattsson, N.; Pannee, J.; Zetterberg, H.; Gisslén, M.; Vanderstichele, H.; Gkanatsiou, E.; Crespi, G.A.N.; Parker, M.W.; Miles, L.A.; et al. Ex vivo 18O-labeling mass spectrometry identifies a peripheral amyloid β clearance pathway. Mol. Neurodegener. 2017, 12, 18. [Google Scholar] [CrossRef] [PubMed]
- Farris, W.; Mansourian, S.; Chang, Y.; Lindsley, L.; Eckman, E.A.; Frosch, M.P.; Eckman, C.B.; Tanzi, R.E.; Selkoe, D.J.; Guenette, S. Insulin-degrading enzyme regulates the levels of insulin, amyloid beta-protein, and the beta-amyloid precursor protein intracellular domain in vivo. Proc. Natl. Acad. Sci. USA 2003, 100, 4162–4167. [Google Scholar] [CrossRef] [PubMed]
- Langhans, S.A. Three-Dimensional in Vitro Cell Culture Models in Drug Discovery and Drug Repositioning. Front. Pharmacol. 2018, 9, 6. [Google Scholar] [CrossRef]
- Fang, Y.; Eglen, R.M. Three-Dimensional Cell Cultures in Drug Discovery and Development. SLAS Discov. Adv. Life Sci. R D 2017, 22, 456–472. [Google Scholar] [CrossRef] [Green Version]
- Ko, K.R.; Frampton, J.P. Developments in 3D neural cell culture models: The future of neurotherapeutics testing? Expert Rev. Neurother. 2016, 16, 739–741. [Google Scholar] [CrossRef]
- Maraldi, T.; Prata, C.; Marrazzo, P.; Hrelia, S.; Angeloni, C. Natural compounds as a strategy to optimize “in vitro” expansion of stem cells. Rejuvenation Res. 2019. [Google Scholar] [CrossRef]
Gene | Sequence | RefSeq Accession n. |
---|---|---|
RPS18 * | Fw CAGAAGGATGTAAAGGATGG | NM_022551 |
Rv TATTTCTTCTTGGACACACC | ||
MAP2 | Fw GAAGATTTACTTACAGCCTCG | NM_002374 |
Rv GGTAAGTTTTAGTTGTCTCTGG | ||
BDNF | Fw CAAAAGTGGAGAACATTTGC | NM_001143811 |
Rv AACTCCAGTCAATAGGTCAG | ||
HMOX1(HO1) | Fw CAACAAAGTGCAAGATTCTG | NM_002133.2 |
Rv TGCATTCACATGGCATAAAG | ||
IDE | Fw CAACCTGAAGTGATTCAGAAC | NM_001165946 |
Rv AATATGTGGTTTCACAAGGG | ||
NOX1 | Fw CCGGTCATTCTTTATATCTGTG | NM_007052 |
Rv CAACCTTGGTAATCACAACC | ||
NOX2 | Fw AAGATCTACTTCTACTGGCTG | NM_000397 |
Rv AGATGTTGTAGCTGAGGAAG | ||
NQO1 | Fw AGTATCCACAATAGCTGACG | NM_000903 |
Rv TTTGTGGGTCTGTAGAAATG | ||
GSR (GR) | Fw GACCTATTCAACGAGCTTTAC | NM_000637 |
Rv CAACCACCTTTTCTTCCTTG | ||
TXNRD1 (TR) | Fw AGACAGTTAAGCATGATTGG | NM_001093771 |
Rv AATTGCCCATAAGCATTCTC |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Marrazzo, P.; Angeloni, C.; Hrelia, S. Combined Treatment with Three Natural Antioxidants Enhances Neuroprotection in a SH-SY5Y 3D Culture Model. Antioxidants 2019, 8, 420. https://doi.org/10.3390/antiox8100420
Marrazzo P, Angeloni C, Hrelia S. Combined Treatment with Three Natural Antioxidants Enhances Neuroprotection in a SH-SY5Y 3D Culture Model. Antioxidants. 2019; 8(10):420. https://doi.org/10.3390/antiox8100420
Chicago/Turabian StyleMarrazzo, Pasquale, Cristina Angeloni, and Silvana Hrelia. 2019. "Combined Treatment with Three Natural Antioxidants Enhances Neuroprotection in a SH-SY5Y 3D Culture Model" Antioxidants 8, no. 10: 420. https://doi.org/10.3390/antiox8100420