Enhanced Alarmin Secretion Exacerbates Neutrophil Extracellular Trap (NET) Formation in Active Psoriasis: Implication of IL-33 and TSLP in Driving NET Formation, Inflammation and Oxidative Stress in Psoriasis
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Subjects and Sampling
2.2. PBMC Isolation
2.3. Neutrophil Isolation, NET Formation, and Stimulation Assay: Identification and Quantification
2.4. RNA Extraction and qPCR Assay
| Genes | Gene Accession Number | Forward Primers (5′-3′) Reverse Primers (3′-5′) |
|---|---|---|
| β-actin | NM_001101 | GCGTGACATTAAGGAGAAG GAAGGAAGGCTGGAAGAG |
| IL-33 | NM_033439 | GCCAACAACAAGGAACACTCTG CACTCCAGGATCAGTCTTGCAT |
| TSLP | NM_033035 | CCAGAGCCTAACCTTCAATCC ATAGCCTGGGCACCAGATAG |
| S100A7 | NM_002963 | GACTACCACAAGCAGAGCCAT GACATTTTATTGTTCCTGGGGTCT |
| S100B | NM_006272 | CATGCAGATAACAGCTGGTTG CGGATTGCGAGTTCTGATGG |
| HSP60 | NM_199440 | CGCTGACGCGAAGACTCG AGCATTAAGGCTCGGGCATC |
| HSP70 | NM_005345 | CCACTGGAAGGACTTAGGCG CTGGAAGCCCAGGTCTATGC |
| IL-6 | NM_001371096 | AGACAGCCACTCACCTCTTC CAGGCTGGCATTTGTGGTTG |
| IL-15 | NM_000585 | TGGGCCTAGAGTAGCTTACC TTAGGTGCTTTGGGCCAACT |
| IL-17 | NM_002190 | TGTCCATCTCATAGCAGGCAC CAGGACTCACCACCAATGAG |
| IFN-γ | NM_000619 | GCAGAGCCAAATTGTCTCCT ATGCTCTTCGACCTCGAAAC |
| TNF-α | NM_000594 | CCATCAGAGGGCCTGTACCT GTGGGTGAGGAGTACATGGG |
| IL-13 | NM_002188 | ATGCATCCGCTCCTCAATCC TCTGGGTGATGTTGACCAGC |
| IL-23 | NM_016584 | CCCAAGGACTCAGGGACAAC TGGAGGCTGCGAAGGATTTT |
2.5. ELISA-Based Assays
2.6. Flow Cytometry-Based Assays
2.7. Immunofluorescence-Based Study
2.8. Statistical Analysis
3. Result
4. Discussion
Limitations
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Parisi, R.; Symmons, D.P.M.; Griffiths, C.E.; Ashcroft, D.M.; on behalf of the Identification and Management of Psoriasis and Associated ComorbidiTy (IMPACT) Project Team. Global epidemiology of psoriasis: A systematic review of incidence and prevalence. J. Investig. Dermatol. 2013, 133, 377–385. [Google Scholar] [CrossRef] [Scilit]
- Nestle, F.O.; Kaplan, D.H.; Barker, J. Psoriasis. N. Engl. J. Med. 2009, 361, 496–509. [Google Scholar] [CrossRef] [Scilit]
- Di Cesare, A.; Di Meglio, P.; Nestle, F.O. The IL-23/Th17 Axis in the Immunopathogenesis of Psoriasis. J. Investig. Dermatol. 2009, 129, 1339–1350. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Potestio, L.; Martora, F.; Lauletta, G.; Vallone, Y.; Battista, T.; Megna, M. The Role of Interleukin 23/17 Axis in Psoriasis Management: A Comprehensive Review of Clinical Trials. Clin. Cosmet. Investig. Dermatol. 2024, 17, 829–842. [Google Scholar] [CrossRef] [Scilit]
- Schön, M.P. Adaptive and Innate Immunity in Psoriasis and Other Inflammatory Disorders. Front. Immunol. 2019, 10, 1764. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liang, Y.; Sarkar, M.K.; Tsoi, L.C.; Gudjonsson, J.E. Psoriasis: A Mixed Autoimmune and Autoinflammatory Disease. Curr. Opin. Immunol. 2017, 49, 1–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, D.; Han, Z.; Oppenheim, J.J. Alarmins and immunity. Immunol. Rev. 2017, 280, 41–56. [Google Scholar] [CrossRef] [Scilit]
- Kiełbowski, K.; Stańska, W.; Bakinowska, E.; Rusiński, M.; Pawlik, A. The Role of Alarmins in the Pathogenesis of Rheumatoid Arthritis, Osteoarthritis, and Psoriasis. Curr. Issues Mol. Biol. 2024, 46, 3640–3675. [Google Scholar] [CrossRef] [Scilit]
- Hasegawa, T.; Oka, T.; Demehri, S. Alarmin Cytokines as Central Regulators of Cutaneous Immunity. Front. Immunol. 2022, 13, 876515. [Google Scholar] [CrossRef] [Scilit]
- Yamanishi, K.; Imai, Y. Alarmins/stressorins and immune dysregulation in intractable skin disorders. Allergol. Int. 2021, 70, 421–429. [Google Scholar] [CrossRef] [Scilit]
- Liang, H.; Li, J.; Zhang, K. Pathogenic Role of S100 Proteins in Psoriasis. Front. Immunol. 2023, 14, 1191645. [Google Scholar] [CrossRef] [Scilit]
- Saito-Sasaki, N.; Sawada, Y. S100 Proteins in the Pathogenesis of Psoriasis and Atopic Dermatitis. Diagnostics 2023, 13, 3167. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maurelli, M.; Gisondi, P.; Danese, E.; Gelati, M.; Papagrigoraki, A.; Giglio, M.; Lippi, G.; Girolomoni, G. Psoriasin (S100a7) Is Increased in the Serum of Patients with Moderate-to-Severe Psoriasis. Br. J. Dermatol. 2020, 182, 1502–1503. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salem, S.A.M.; El-Khateeb, E.A.; Harvy, M.; Emam, H.M.E.-S.; Abdelaal, W.; El Nemr, R.; El-Hagry, O.O. Study of Serum Levels and Skin Expression of S100b Protein in Psoriasis. An. Bras. Dermatol. 2017, 92, 323–328. [Google Scholar] [CrossRef] [Scilit]
- Mitsui, A.; Tada, Y.; Takahashi, T.; Shibata, S.; Kamata, M.; Miyagaki, T.; Fujita, H.; Sugaya, M.; Kadono, T.; Sato, S.; et al. Serum IL-33 levels are increased in patients with psoriasis. Clin. Exp. Dermatol. 2016, 41, 183–189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, S.-H.; Zuo, Y.-G. Thymic Stromal Lymphopoietin in Cutaneous Immune-Mediated Diseases. Front. Immunol. 2021, 12, 698522. [Google Scholar] [CrossRef] [Scilit]
- El-Ghareeb, M.I.; Helmy, A.; Al Kazzaz, S.; Samir, H. Serum Tslp Is a Potential Biomarker of Psoriasis Vulgaris Activity. Psoriasis Targets Ther. 2019, 9, 59–63. [Google Scholar] [CrossRef] [Scilit]
- Hu, C.; Yang, J.; Qi, Z.; Wu, H.; Wang, B.; Zou, F.; Mei, H.; Liu, J.; Wang, W.; Liu, Q. Heat shock proteins: Biological functions, pathological roles, and therapeutic opportunities. MedComm 2022, 3, e161. [Google Scholar] [CrossRef] [Scilit]
- Adday, W.T.; Al-Shakour, A.A.; Taher, S.A.; Taresh, W. Evaluation of Serum Levels of Heat Shock Protein 70 in Patients with Psoriasis in Basra, Iraq. Menopausal Rev. 2024, 23, 64–68. [Google Scholar] [CrossRef] [Scilit]
- Borsky, P.; Fiala, Z.; Andrys, C.; Beranek, M.; Hamakova, K.; Malkova, A.; Svadlakova, T.; Krejsek, J.; Palicka, V.; Borska, L.; et al. Alarmins HMGB1, IL-33, S100A7, and S100A12 in Psoriasis Vulgaris. Mediat. Inflamm. 2020, 2020, 8465083. [Google Scholar] [CrossRef] [Scilit]
- Alves-Filho, J.C.; Melo, B.M.S.; Ryffel, B. MMP-9 Mediates Cross-Talk between Neutrophils and Endothelial Cells in Psoriasis. J. Investig. Dermatol. 2021, 141, 716–718. [Google Scholar] [CrossRef] [Scilit]
- Rodriguez-Rosales, Y.A.; Langereis, J.D.; Gorris, M.A.; Reek, J.M.v.D.; Fasse, E.; Netea, M.G.; de Vries, I.J.M.; Gomez-Muñoz, L.; van Cranenbroek, B.; Körber, A.; et al. Immunomodulatory aged neutrophils are augmented in blood and skin of psoriasis patients. J. Allergy Clin. Immunol. 2021, 148, 1030–1040. [Google Scholar] [CrossRef] [Scilit]
- Xu, X.; Zhang, Y.; Pan, Z.; Zhang, X.; Liu, X.; Tang, L.; Zhang, X.; Zhou, F.; Cheng, H. Genome-wide DNA methylation of Munro’s microabscess reveals the epigenetic regulation in the pathogenesis of psoriasis. Front. Immunol. 2022, 13, 1057839. [Google Scholar] [CrossRef] [Scilit]
- Gao, F.; Peng, H.; Gou, R.; Zhou, Y.; Ren, S.; Li, F. Exploring Neutrophil Extracellular Traps: Mechanisms of Immune Regulation and Future Therapeutic Potential. Exp. Hematol. Oncol. 2025, 14, 80. [Google Scholar] [CrossRef] [Scilit]
- Czerwińska, J.; Owczarczyk-Saczonek, A. The Impact of Disease Severity on the Serum Levels of Significant Neutrophil Extracellular Trap (NET) Proteins in Patients with Psoriasis. Int. J. Mol. Sci. 2024, 25, 10671. [Google Scholar] [CrossRef] [Scilit]
- Liu, Q.; Chen, R.; Zhang, Z.; Sha, Z.; Wu, H. Mechanisms and Immune Crosstalk of Neutrophil Extracellular Traps in Response to Infection. mBio 2025, 16, e0018925. [Google Scholar] [CrossRef] [Scilit]
- Tang, R.; Yin, J.; Qin, Z.; Zhang, M.; Jia, X. Nets: A New Target for Autoimmune Disease. Front. Immunol. 2025, 16, 1646527. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, J.; Feng, Y.; Shi, D. Netosis of Psoriasis: A Critical Step in Amplifying the Inflammatory Response. Front. Immunol. 2024, 15, 1374934. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Turnier, J.L.; Kahlenberg, J.M. The Role of Cutaneous Type I IFNs in Autoimmune and Autoinflammatory Diseases. J. Immunol. 2020, 205, 2941–2950. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arroyo-Andrés, J.; Rivera, A.G.; Díaz-Benito, B.; Moraga, A.; Hernández, I.L.; Rivera-Díaz, R. Neutrophil Extracellular Trap (NET) Markers in Psoriasis: Linking With Disease Severity and Comorbidities. Actas Dermo-Sifiliogr. 2025, 116, 1131–1135. [Google Scholar] [CrossRef] [Scilit]
- Czerwińska, J.; Kasprowicz-Furmańczyk, M.; Placek, W.; Owczarczyk-Saczonek, A. Changes in Tumor Necrosis Factor α (TNFα) and Peptidyl Arginine Deiminase 4 (PAD-4) Levels in Serum of General Treated Psoriatic Patients. Int. J. Environ. Res. Public Health 2022, 19, 8723. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Liu, B.; Fukudome, E.Y.; Lu, J.; Chong, W.; Jin, G.; Liu, Z.; Velmahos, G.C.; Demoya, M.; King, D.R.; et al. Identification of citrullinated histone H3 as a potential serum protein biomarker in a lethal model of lipopolysaccharide-induced shock. Surgery 2011, 150, 442–451. [Google Scholar] [CrossRef] [Scilit]
- Dobrică, E.-C.; Cozma, M.-A.; Găman, M.-A.; Voiculescu, V.-M.; Găman, A.M. The Involvement of Oxidative Stress in Psoriasis: A Systematic Review. Antioxidants 2022, 11, 282. [Google Scholar] [CrossRef] [Scilit]
- Bilski, R.; Kupczyk, D.; Woźniak, A. Oxidative Imbalance in Psoriasis with an Emphasis on Psoriatic Arthritis: Therapeutic Antioxidant Targets. Molecules 2024, 29, 5460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kadam, D.P.; Suryakar, A.N.; Ankush, R.D.; Kadam, C.Y.; Deshpande, K.H. Role of Oxidative Stress in Various Stages of Psoriasis. Indian J. Clin. Biochem. 2010, 25, 388–392. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bakić, M.; Klisić, A.; Kocić, G.; Kocić, H.; Karanikolić, V. Oxidative stress and metabolic biomarkers in patients with Psoriasis. J. Med. Biochem. 2024, 43, 97–105. [Google Scholar] [CrossRef] [Scilit]
- Wroński, A.; Gęgotek, A.; Skrzydlewska, E. Protein adducts with lipid peroxidation products in patients with psoriasis. Redox Biol. 2023, 63, 102729. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Blagov, A.; Sukhorukov, V.; Guo, S.; Zhang, D.; Eremin, I.; Orekhov, A. The Role of Oxidative Stress in the Induction and Development of Psoriasis. Front. Biosci. 2023, 28, 118. [Google Scholar] [CrossRef] [Scilit]
- Henneck, T.; Krüger, C.; Nerlich, A.; Langer, M.; Fingerhut, L.; Bonilla, M.C.; Meurer, M.; Berg, S.v.D.; de Buhr, N.; Branitzki-Heinemann, K.; et al. Comparison of NET quantification methods based on immunofluorescence microscopy: Hand-counting, semi-automated and automated evaluations. Heliyon 2023, 9, e16982. [Google Scholar] [CrossRef] [Scilit]
- Tembhre, M.K.; Parihar, A.S.; Sharma, A.; Gupta, S.; Chattopadhyay, P.; Sharma, V.K. Participation of T cell immunoglobulin and mucin domain-3 (TIM-3) and its ligand (galectin-9) in the pathogenesis of active generalized vitiligo. Immunol. Res. 2015, 62, 23–34. [Google Scholar] [CrossRef] [Scilit]
- Parihar, A.; Tembhre, M.; Sharma, V.; Gupta, S.; Chattopadhyay, P.; Deepak, K. Effect of narrowband ultraviolet B treatment on micro RNA expression in active nonsegmental generalized vitiligo. Br. J. Dermatol. 2020, 183, 167–169. [Google Scholar] [CrossRef] [Scilit]
- Tembhre, M.K. Shipra Low-Dose Melittin Enhanced Pigment Production Through the Upregulation of Tyrosinase Activity and Dendricity in Melanocytes by Limiting Oxidative Stress: A Therapeutic Implication for Vitiligo. Antioxidants 2024, 13, 1424. [Google Scholar] [CrossRef] [Scilit]
- Sieminska, I.; Pieniawska, M.; Grzywa, T.M. The Immunology of Psoriasis—Current Concepts in Pathogenesis. Clin. Rev. Allergy Immunol. 2024, 66, 164–191. [Google Scholar] [CrossRef] [Scilit]
- Gurski, C.J.; Dittel, B.N. Myeloperoxidase as a Marker to Differentiate Mouse Monocyte/Macrophage Subsets. Int. J. Mol. Sci. 2022, 23, 8246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burn, G.L.; Raisch, T.; Tacke, S.; Winkler, M.; Prumbaum, D.; Thee, S.; Gimber, N.; Raunser, S.; Zychlinsky, A. Myeloperoxidase transforms chromatin into neutrophil extracellular traps. Nature 2025, 647, 747–756. [Google Scholar] [CrossRef] [Scilit]
- Tembhre, M.K.; Parihar, A.S.; Sharma, V.K.; Imran, S.; Bhari, N.; Lakshmy, R.; Bhalla, A. Enhanced expression of angiotensin-converting enzyme 2 in psoriatic skin and its upregulation in keratinocytes by interferon-γ: Implication of inflammatory milieu in skin tropism of SARS-CoV-2. Br. J. Dermatol. 2021, 184, 577–579. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Manchanda, K.; Kolarova, H.; Kerkenpaß, C.; Mollenhauer, M.; Vitecek, J.; Rudolph, V.; Kubala, L.; Baldus, S.; Adam, M.; Klinke, A. MPO (Myeloperoxidase) Reduces Endothelial Glycocalyx Thickness Dependent on Its Cationic Charge. Arter. Thromb. Vasc. Biol. 2018, 38, 1859–1867. [Google Scholar] [CrossRef] [Scilit]
- Naish, E.; Wood, A.J.; Stewart, A.P.; Routledge, M.; Morris, A.C.; Chilvers, E.R.; Lodge, K.M. The formation and function of the neutrophil phagosome. Immunol. Rev. 2023, 314, 158–180. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hawkins, C.L.; Davies, M.J. Role of myeloperoxidase and oxidant formation in the extracellular environment in inflammation-induced tissue damage. Free Radic. Biol. Med. 2021, 172, 633–651. [Google Scholar] [CrossRef] [Scilit]
- Chiang, C.-C.; Cheng, W.-J.; Korinek, M.; Lin, C.-Y.; Hwang, T.-L. Neutrophils in Psoriasis. Front. Immunol. 2019, 10, 2376. [Google Scholar] [CrossRef] [Scilit]
- Wang, W.-M.; Jin, H.-Z. Role of Neutrophils in Psoriasis. J. Immunol. Res. 2020, 2020, 3709749. [Google Scholar] [CrossRef] [Scilit]
- Vicanolo, T.; Özcan, A.; Li, J.L.; Huerta-López, C.; Ballesteros, I.; Rubio-Ponce, A.; Dumitru, A.C.; Nicolás-Ávila, J.Á.; Molina-Moreno, M.; Reyes-Gutierrez, P.; et al. Matrix-producing neutrophils populate and shield the skin. Nature 2025, 641, 740–748, Correction in Nature 2025, 641, E10. [Google Scholar] [CrossRef] [Scilit]
- El Kebir, D.; JózSef, L.; Pan, W.; Filep, J.G. Myeloperoxidase delays neutrophil apoptosis through CD11b/CD18 integrins and prolongs inflammation. Circ. Res. 2008, 103, 352–359. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cai, H.; Chuang, C.Y.; Hawkins, C.L.; Davies, M.J. Binding of myeloperoxidase to the extracellular matrix of smooth muscle cells and subsequent matrix modification. Sci. Rep. 2020, 10, 666. [Google Scholar] [CrossRef] [Scilit]
- Donkel, S.J.; Wolters, F.J.; Ikram, M.A.; de Maat, M.P.M. Circulating Myeloperoxidase (MPO)-DNA complexes as marker for Neutrophil Extracellular Traps (NETs) levels and the association with cardiovascular risk factors in the general population. PLoS ONE 2021, 16, e0253698. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Strzepa, A.; Pritchard, K.A.; Dittel, B.N. Myeloperoxidase: A new player in autoimmunity. Cell. Immunol. 2017, 317, 1–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, B.; Li, G.; Yang, X.; Song, Z.; Wang, Y.; Zhang, Z. NETosis in Psoriatic Arthritis: Serum MPO–DNA Complex Level Correlates With Its Disease Activity. Front. Immunol. 2022, 13, 911347. [Google Scholar] [CrossRef] [Scilit]
- Tembhre, M.K.; Sriwastva, M.K.; Hote, M.P.; Srivastava, S.; Solanki, P.; Imran, S.; Lakshmy, R.; Sharma, A.; Jaiswal, K.; Upadhyay, A.D. Interleukin-33 Induces Neutrophil Extracellular Trap (NET) Formation and Macrophage Necroptosis via Enhancing Oxidative Stress and Secretion of Proatherogenic Factors in Advanced Atherosclerosis. Antioxidants 2022, 11, 2343. [Google Scholar] [CrossRef] [Scilit]
- Haegens, A.; Vernooy, J.H.J.; Heeringa, P.; Mossman, B.T.; Wouters, E.F.M. Myeloperoxidase modulates lung epithelial responses to pro-inflammatory agents. Eur. Respir. J. 2008, 31, 252–260. [Google Scholar] [CrossRef] [Scilit]
- Duan, X.; Liu, X.; Liu, N.; Huang, Y.; Jin, Z.; Zhang, S.; Ming, Z.; Chen, H. Inhibition of keratinocyte necroptosis mediated by RIPK1/RIPK3/MLKL provides a protective effect against psoriatic inflammation. Cell Death Dis. 2020, 11, 134. [Google Scholar] [CrossRef] [Scilit]
- Chen, Z.; Hu, Y.; Gong, Y.; Zhang, X.; Cui, L.; Chen, R.; Yu, Y.; Yu, Q.; Chen, Y.; Diao, H.; et al. Interleukin-33 alleviates psoriatic inflammation by suppressing the T helper type 17 immune response. Immunology 2020, 160, 382–392. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duan, Y.; Dong, Y.; Hu, H.; Wang, Q.; Guo, S.; Fu, D.; Song, X.; Kalvakolanu, D.V.; Tian, Z. IL-33 contributes to disease severity in Psoriasis-like models of mouse. Cytokine 2019, 119, 159–167. [Google Scholar] [CrossRef] [Scilit]
- AbdelWahed, M.A.; Elmogy, M.H.; Abdelsalam, M.; Zohdy, M. Serum interleukin-33 level may serve as a new marker for psoriasis diagnosis. Egypt. J. Dermatol. Venerol. 2021, 41, 109–114. [Google Scholar] [CrossRef] [Scilit]
- Zhou, X.; Hu, Y.; Liu, L.; Liu, L.; Chen, H.; Huang, D.; Ju, M.; Luan, C.; Chen, K.; Zhang, J. IL-33-mediated activation of mast cells is involved in the progression of imiquimod-induced psoriasis-like dermatitis. Cell Commun. Signal. 2023, 21, 52. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kollabathula, S.S.; Venkatachalam, K.; Divya, K.S.; Guruprasad, P.; Nayar, P.A.S. A Comparative Study on Serum Levels of “Thymic Stromal Lymphopoietin” Between Patients with Psoriasis Vulgaris and Healthy Individuals: A Case-Control Study. Indian Dermatol. Online J. 2024, 15, 449–453. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suwarsa, O.; Dharmadji, H.P.; Sutedja, E.; Herlina, L.; Sori, P.R.; Hindritiani, R.; Dwiyana, R.F.; Gunawan, H. Skin tissue expression and serum level of thymic stromal lymphopoietin in patients with psoriasis vulgaris. Dermatol. Rep. 2019, 11, 8006. [Google Scholar] [CrossRef] [Scilit]
- Khaled, H.N.; Elghobashy, Y.; El Sayed, E.M.A. Thymic stromal lymphopoietin: Evaluating its role as a new marker related to presence of psoriasis vulgaris and its severity. Egypt. J. Dermatol. Venerol. 2023, 43, 212–219. [Google Scholar] [CrossRef] [Scilit]
- Song, C.; Sun, J.; Zhao, Z.; Zhang, X.; Ding, X.; Liang, X.; Bai, J.; Xing, L.; Gong, L.; Li, C.; et al. Thymic Stromal Lymphopoietin Activates Mouse Dendritic Cells Through the JAK/SYK Pathway in Promoting Th17 Response in Psoriasis. Balk. Med. J. 2024, 41, 174–185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gago-Lopez, N.; Mellor, L.F.; Megías, D.; Martín-Serrano, G.; Izeta, A.; Jimenez, F.; Wagner, E.F. Role of bulge epidermal stem cells and TSLP signaling in psoriasis. EMBO Mol. Med. 2019, 11, e10697. [Google Scholar] [CrossRef] [Scilit]
- Sarandi, E.; Krueger-Krasagakis, S.; Tsoukalas, D.; Sidiropoulou, P.; Evangelou, G.; Sifaki, M.; Rudofsky, G.; Drakoulis, N.; Tsatsakis, A. Psoriasis immunometabolism: Progress on metabolic biomarkers and targeted therapy. Front. Mol. Biosci. 2023, 10, 1201912. [Google Scholar] [CrossRef] [Scilit]
- Kirmit, A.; Kader, S.; Aksoy, M.; Bal, C.; Nural, C.; Aslan, O. Trace elements and oxidative stress status in patients with psoriasis. Adv. Dermatol. Allergol. 2020, 37, 333–339. [Google Scholar] [CrossRef] [Scilit]
- Man, A.-M.; Orăsan, M.S.; Hoteiuc, O.-A.; Olănescu-Vaida-Voevod, M.-C.; Mocan, T. Inflammation and Psoriasis: A Comprehensive Review. Int. J. Mol. Sci. 2023, 24, 16095. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goodman, W.A.; Levine, A.D.; Massari, J.V.; Sugiyama, H.; McCormick, T.S.; Cooper, K.D. IL-6 Signaling in Psoriasis Prevents Immune Suppression by Regulatory T Cells. J. Immunol. 2009, 183, 3170–3176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eid, N.S.M.; AbdElatief, A.A.; Donia, H.A.; Salem, A.O.F. Evaluation of Serum Interleukin 15 in Psoriatic Patients. ALEXMED ePosters 2023, 5, 55–56. [Google Scholar] [CrossRef] [Scilit]
- Elder, J.T. IL-15 and Psoriasis: Another Genetic Link to Th17? J. Investig. Dermatol. 2007, 127, 2495–2497. [Google Scholar] [CrossRef] [Scilit]
- Mills, K.H.G. Il-17 and Il-17-Producing Cells in Protection Versus Pathology. Nat. Rev. Immunol. 2023, 23, 38–54. [Google Scholar] [CrossRef] [Scilit]
- Ness-Schwickerath, K.J.; Morita, C.T. Regulation and Function of Il-17a- and Il-22-Producing Γδ T Cells. Cell. Mol. Life Sci. 2011, 68, 2371–2390. [Google Scholar] [CrossRef] [Scilit]
- Lamiable, O.; Brewerton, M.; Ronchese, F. Il-13 in Dermal Type-2 Dendritic Cell Specialization: From Function to Therapeutic Targeting. Eur. J. Immunol. 2022, 52, 1047–1057. [Google Scholar] [CrossRef] [Scilit]
- Mayer, J.U.; Hilligan, K.L.; Chandler, J.S.; Eccles, D.A.; Old, S.I.; Domingues, R.G.; Yang, J.; Webb, G.R.; Munoz-Erazo, L.; Hyde, E.J.; et al. Homeostatic IL-13 in healthy skin directs dendritic cell differentiation to promote TH2 and inhibit TH17 cell polarization. Nat. Immunol. 2021, 22, 1538–1550, Correction in Nat. Immunol. 2022, 23, 985. [Google Scholar] [CrossRef] [Scilit]
- Alam, M.S.; Otsuka, S.; Wong, N.; Abbasi, A.; Gaida, M.M.; Fan, Y.; Meerzaman, D.; Ashwell, J.D. Tnf Plays a Crucial Role in Inflammation by Signaling Via T Cell Tnfr2. Proc. Natl. Acad. Sci. USA 2021, 118, e2109972118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johansen, C.; Funding, A.T.; Otkjaer, K.; Kragballe, K.; Jensen, U.B.; Madsen, M.; Binderup, L.; Skak-Nielsen, T.; Fjording, M.S.; Iversen, L. Protein expression of TNF-alpha in psoriatic skin is regulated at a posttranscriptional level by MAPK-activated protein kinase 2. J. Immunol. 2006, 176, 1431–1438. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Shao, X.; Li, X.; Chen, Q.; Zang, Y.; Wang, J.; Yang, Y.; Qiang, L.; Lin, A.; He, Y. Novel TNF-α-targeting mRNA therapy for sustained psoriasis treatment and relapse prevention by suppressing IL-15-TRM signaling. J. Control. Release 2025, 387, 114218. [Google Scholar] [CrossRef] [Scilit]
- Mah, A.Y.; Cooper, M.A. Metabolic Regulation of Natural Killer Cell IFN-γ Production. Crit. Rev. Immunol. 2016, 36, 131–147. [Google Scholar] [CrossRef] [Scilit]
- Kurtovic, N.; Halilovic, E. Serum Concentrations of Interferon Gamma (IFN-γ) in Patients with Psoriasis: Correlation with Clinical Type and Severity of the Disease. Med. Arch. 2018, 72, 410–413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jung, K.; Ku, J.-Y.; Kwon, J.-S.; Won, G.; Yoon, H.; Oh, S.-I.; Kim, M.H.; Kim, C.; Yoon, J.-S. Ifn-Γ/Tnf-A Synergism Induces Pro-Inflammatory Cytokine and Chemokine Production by In Vitro Canine Keratinocytes. Vet. Sci. 2025, 12, 55. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Clinical Variables | Active Psoriasis Patients (Psoriasis Vulgaris) | Control | p Value |
|---|---|---|---|
| Total Participants | N = 56 | N = 56 | |
| Male | N = 47 | N = 39 | |
| Female | N = 9 | N = 17 | |
| Age (Mean ± SD) (in years) | |||
| Total number of subjects | 36.89 ± 12.73 | 33.51 ± 8.14 | |
| Male | 36.71 ± 13.58 | 33.62 ± 8.03 | |
| Female | 37.27 ± 11.21 | 33.36 ± 8.29 | |
| PASI score (Mean ± SD) | 37.27 ± 14.11 | - | |
| Psoriasis (Mild) (PASI < 10) | N = 5 | - | |
| Psoriasis (Moderate to severe) (PASI ≥ 10) | N = 51 | - | |
| Total disease duration (in years) (Mean ± SD) | 9.80 ± 6.51 | - | |
| BMI (Mean ± SD) | 23.4 ± 1.2 | 22.9 ± 1.1 | p > 0.05 |
| Blood Pressure | p > 0.05 | ||
| Systolic blood pressure (SBP) | |||
| (normal range: <120 mmHg) | |||
| Range | 110–118 mmHg | 108–114 mmHg | |
| Mean ± SD | 116.6 ± 3.0 mmHg | 113.5 ± 2.8 mmHg | |
| Diastolic blood pressure (DBP) | |||
| (normal range: <80 mmHg) | |||
| Range | 70–78 mmHg | 68–76 mmHg | |
| Mean ± SD | 74.6 ± 2.3 mmHg | 72.4 ± 2.2 mmHg | |
| Fasting sugar glucose | p > 0.05 | ||
| (normal range: 70–99 mg/dL) | |||
| Range | 88–98 mg/dL | 82–90 mg/dL | |
| Mean ± SD | 93.3 ± 2.7 mg/dL | 86.4 ± 2.4 mg/dL | |
| HbA1c | p > 0.05 | ||
| (normal range: | |||
| Normal: < 5.7% | |||
| Prediabetes: 5.7–6.4% | |||
| Diabetes: ≥ 6.5%) | |||
| Range | 4.8–5.4% | 4.7–5.1% | |
| Mean ± SD | 5.42 ± 0.32 | 5.28 ± 0.30 | |
| Thyroid profile test | p > 0.05 | ||
| T3 | |||
| (normal range: 80–200 ng/dL) | |||
| Range | 112–125 ng/dL | 105–115 ng/dL | |
| Mean ± SD | 119.1 ± 3.3 ng/dL | 110.4 ± 2.9 ng/dL | |
| T4 | |||
| (normal range: 5.1–14.1 µg/dL) | |||
| Range | 7.6–8.7 µg/dL | 7.1–8.0 µg/dL | |
| Mean ± SD | 8.18 ± 0.28 µg/dL | 7.55 ± 0.26 µg/dL | |
| TSH | |||
| (normal range: 0.27–4.20 µIU/mL) | |||
| Range | 1.8–2.6 µIU/mL | 1.4–2.2 µIU/mL | |
| Mean ± SD | 2.18 ± 0.19 µIU/mL | 1.78 ± 0.20 µIU/mL | |
| Vitamin D | p > 0.05 | ||
| (normal range: 30–50 ng/mL) | |||
| Range | 26–48 | 28–49 | |
| Mean ± SD | 34.8 ± 6.2 | 36.5 ± 5.8 | |
| B12 | p > 0.05 | ||
| (normal range: 197–771 pg/mL) | |||
| Range | 260–620 | 280–650 | |
| Mean ± SD | 412 ± 96 | 438 ± 102 | |
| Homocysteine | p > 0.05 | ||
| (normal range: 5–15 µmol/L) | |||
| Range | 6.5–14.8 | 6.2–14.2 | |
| Mean ± SD | 10.8 ± 2.4 | 10.1 ± 2.2 | |
| Hs CRP | p > 0.05 | ||
| (normal range: 1.0–5.0 mg/L) | |||
| Range | 1.1–3.9 | 0.34–0.46 | |
| Mean ± SD | 2.48 ± 0.86 | 0.40 ± 0.03 | |
| CK-MB | p > 0.05 | ||
| (normal range: 0–25 U/L) | |||
| Range | 9–24 | 8–22 | |
| Mean ± SD | 16.8 ± 4.2 | 15.6 ± 3.8 | |
| Trop T | p > 0.05 | ||
| (normal range: <14 ng/L) | |||
| Range | 3.2–12.4 | 3.0–11.6 | |
| Mean ± SD | 7.6 ± 2.1 | 6.9 ± 1.9 | |
| Metabolic/autoimmune/cardiovascular comorbidities (diabetes, hypertension, atherosclerosis, RA, IBD, SLE, etc.) | None | None | |
| Associated skin disease (vitiligo, AA, Acne, dermatitis, PsA, etc.) | None | None | |
| Smoking | None | None | |
| Alcohol or any drug addiction | None | None | |
| Treatment (Systemic/topical (e.g., corticosteroids, retinoids, phototherapy, methotrexate, cyclosporine, etc.)) | None | None |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Ojha, V.; Tembhre, M.K.; Gupta, V. Enhanced Alarmin Secretion Exacerbates Neutrophil Extracellular Trap (NET) Formation in Active Psoriasis: Implication of IL-33 and TSLP in Driving NET Formation, Inflammation and Oxidative Stress in Psoriasis. Antioxidants 2026, 15, 71. https://doi.org/10.3390/antiox15010071
Ojha V, Tembhre MK, Gupta V. Enhanced Alarmin Secretion Exacerbates Neutrophil Extracellular Trap (NET) Formation in Active Psoriasis: Implication of IL-33 and TSLP in Driving NET Formation, Inflammation and Oxidative Stress in Psoriasis. Antioxidants. 2026; 15(1):71. https://doi.org/10.3390/antiox15010071
Chicago/Turabian StyleOjha, Vanshika, Manoj Kumar Tembhre, and Vishal Gupta. 2026. "Enhanced Alarmin Secretion Exacerbates Neutrophil Extracellular Trap (NET) Formation in Active Psoriasis: Implication of IL-33 and TSLP in Driving NET Formation, Inflammation and Oxidative Stress in Psoriasis" Antioxidants 15, no. 1: 71. https://doi.org/10.3390/antiox15010071
APA StyleOjha, V., Tembhre, M. K., & Gupta, V. (2026). Enhanced Alarmin Secretion Exacerbates Neutrophil Extracellular Trap (NET) Formation in Active Psoriasis: Implication of IL-33 and TSLP in Driving NET Formation, Inflammation and Oxidative Stress in Psoriasis. Antioxidants, 15(1), 71. https://doi.org/10.3390/antiox15010071

