Next Article in Journal
Dietary Supplements Derived from Food By-Products for the Management of Diabetes Mellitus
Previous Article in Journal
A Novel Function of Glycerol Kinase Alleviates LPS-Induced Inflammatory Responses by the p38/STAT3 Pathway and Mitigates ROS Generation in Kupffer Cells
Previous Article in Special Issue
Dietary Probiotic Bacillus subtilis AAHM-BS2360 and Its Postbiotic Metabolites Enhance Growth, Immunity, and Resistance to Edwardsiellosis in Pangasianodon hypophthalmus
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antioxidants
Volume 14
Issue 10
10.3390/antiox14101175
antioxidants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Optimizing Low Fishmeal Diets with Vitamin C Supplementation: A Comprehensive Study on Growth, Immunity, and Heat Stress Resistance in Largemouth Bass (Micropterus salmoides) Juveniles

by
Shengqi Zhao
1,
Hualiang Liang
2,
Xiaoru Chen
3,
Lu Zhang
3,
Dongyu Huang
2,
Yongli Wang
3,
Zhenyan Cheng
1,* and
Mingchun Ren
1,2,*
1
College of Fisheries, Tianjin Agricultural University, Tianjin 300392, China
2
Key Laboratory of Integrated Rice-Fish Farming Ecology, Ministry of Agriculture and Rural Affairs, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, China
3
Healthy Aquaculture Key Laboratory of Sichuan Province, Tongwei Co., Ltd., 588 Tianfu Avenue, Chengdu 610093, China
*
Authors to whom correspondence should be addressed.
Antioxidants 2025, 14(10), 1175; https://doi.org/10.3390/antiox14101175
Submission received: 7 August 2025 / Revised: 12 September 2025 / Accepted: 23 September 2025 / Published: 26 September 2025
(This article belongs to the Special Issue Antioxidants and Aquaculture: A Synergistic Approach for Sustainable Aquatic Production)
Browse Figures
Versions Notes

Abstract

Six dietary groups were supplemented with graded vitamin C (VC) levels: VC1 (control, 0.39 g/kg), VC2 (0.51 g/kg), VC3 (0.66 g/kg), VC4 (0.81 g/kg), VC5 (0.97 g/kg), and VC6 (1.11 g/kg). Largemouth bass (Micropterus salmoides) with an initial weight of 2.21 ± 0.00 g were fed these diets for 8 weeks to evaluate the effects of different VC levels on growth performance, immune response, and heat stress resistance. Heat stress was induced at a constant temperature of 33.00 ± 0.16 °C for one week. The VC3 and VC4 groups showed significantly improved growth performance (FBW, WGR, SGR) compared to VC1 (p < 0.05). VC4 exhibited lower ALT and AST levels before and after heat stress. Antioxidant capacity (T-AOC, GSH-Px, CAT) was significantly enhanced in VC3–VC5, with VC5 showing the highest after stress activity (except CAT). Expression of pro-inflammatory genes (nf-κb, il-8) was downregulated in VC4 and VC5, while anti-inflammatory il-10 was upregulated in VC4 after stress. Apoptosis-related genes (bcl-2, caspase, bax) and TUNEL assays indicated the strongest anti-apoptotic effects in VC3 and VC4 under heat stress (p < 0.05). These findings suggest that VC supplementation in low-fishmeal diets enhances growth, immune response, apoptosis resistance, and acute heat stress tolerance in fish.

1. Introduction

Fishmeal, as the primary protein source in aquaculture diets, is rich in protein, essential amino acids, vitamins, minerals, and other necessary nutrients [1]. Nevertheless, alongside the swift advancement of socioeconomic development, the aquaculture industry has grown significantly, leading to a mismatch between the demand for fishmeal and its availability, resulting in rising fishmeal prices and limiting the growth of the industry. To ensure the sustainable development of aquaculture, alleviate resource pressures, reduce feed costs, and promote environmentally friendly practices, low-fishmeal diets have been increasingly adopted. Despite this, research has shown that low-fishmeal diets can negatively affect the physiological metabolism of farmed species [2,3,4,5]. The supplementation of additives such as enzymes [6], probiotics and prebiotics [7], natural plant extracts [8], and Vitamin C (VC) [9] can enhance the performance of aquatic animals fed low-fishmeal diets. Therefore, investigating the effects of specific additives in low-fishmeal diets is essential for optimizing aquaculture practices.
VC, or L-ascorbic acid, is essential for the normal growth and physiological functions of aquatic animals [10]. VC plays a critical role in promoting fish growth [11], supporting reproductive health [12], enhancing iron absorption [13], strengthening immunity [13], improving tissue hematology [14], and facilitating collagen synthesis [15]. Moreover, VC acts as a potent antioxidant by donating electrons to biomolecules, protecting cells from oxidative damage during metabolism [16], which is largely attributed to its influence on the Nrf2 signaling pathway [17]. Supplementing 148 mg/kg VC in a low-fishmeal diet for hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂) enhances the Nrf2 pathway, thereby boosting antioxidant capacity [9]. Additionally, VC supplementation has been effective in reducing lipid peroxide accumulation and improving the growth performance of tuna (Terapon jarbua) [18,19]. However, limited research has explored the effects of VC supplementation in low-fishmeal diets within aquaculture, highlighting a significant gap that warrants further investigation.
Recent reports indicate that the total production of Micropterus salmoides (M. salmoides) in China has reached 880,000 tonnes, accounting for over 99% of global production [20,21]. This species is highly valued for its meat quality, rapid growth, and adaptability [22,23]. However, high water temperatures during summer result in elevated mortality rates in M. salmoides [24]. VC supplementation in the diet can effectively enhance growth rate [25], immunity [26], and antioxidant capacity in M. salmoides [27]. As previously noted, low-fishmeal diets may lead to nutritional deficiencies, compromised immune function, and reduced stress tolerance in fish. Given VC’s ability to improve growth and immune responses, this study aims to evaluate the impact of VC supplementation in low-fishmeal diets on the growth, immunity, and stress resilience of M. salmoides. The study will also determine the optimal VC level in these diets. Additionally, heat stress conditions were incorporated to assess how VC supplementation affects the alleviation of acute heat stress in M. salmoides under low-fishmeal diet conditions.

2. Materials and Methods

2.1. Diet Preparation

Table 1 presents the primary components and dry matter content of the experimental diets. These diets primarily consist of fishmeal and chicken meal as the primary protein constituents, supplemented by fish oil and soybean oil as the principal fat inputs, among others. By reviewing relevant studies on vitamin C in aquaculture fish, based on a review of studies on VC in aquaculture fish species, optimal supplementation levels vary significantly among different animals, as reported in previous research [28,29,30,31,32,33]. Six diets with varying VC concentrations were formulated, named VC1, VC2, VC3, VC4, VC5, and VC6, corresponding to VC levels of 0.39 g/kg, 0.51 g/kg, 0.66 g/kg, 0.81 g/kg, 0.97 g/kg, and 1.11 g/kg, respectively. All ingredients were milled, passed through an 80-mesh sieve, accurately weighed, and mixed with water according to the designed formulations [34]. The mixture was then processed into puffed pellets (3 mm in diameter) using a bulking granulator (TSE65-type, Beijing, China) as described in previous studies. After pellet formation, the diets were naturally air-dried at ambient temperature. They were then placed in resealable bags, marked, and preserved at −20 °C for later use.

2.2. Experimental Fish

Juvenile M. salmoides were cultured in the recirculating aquaculture system (RAS) at the Freshwater Fisheries Research Centre of the Chinese Academy of Fisheries Sciences (CAFS), located in Yixing, China. Prior to the experiment, all juvenile fish were acclimated for two weeks in RAS breeding buckets (270 L) and fed a commercial compound diet (48% protein, 12% lipid) to adapt to the culture environment. A total of 360 healthy, uniformly sized juvenile fish (initial weight 2.21 ± 0.00 g) were randomly selected and distributed into RAS breeding buckets (20 fish per bucket), with 18 buckets set up to represent the six dietary treatments, each with triplicates. The fish received three daily feedings at 07:30, 12:30, and 17:30, with each meal provided until satiation. The culture period lasted for 8 weeks. Water quality parameters (YSI ProDSS Multiparameter Water Quality Meter, OH, USA) were recorded daily, with water temperature maintained between 26 and 30 °C, dissolved oxygen concentration above 6 mg/L, and pH between 7.0 and 7.5.

2.3. Sample Collection

When the farming trial concluded, the fish were maintained without feeding for 24 h, after which the fish in each bucket were weighed and counted for growth performance analysis. Blood was collected from the tail vein of three randomly selected fish from each bucket, placed in centrifuge tubes, and immediately centrifuged (10 min, 3000 rpm, 4 °C). The supernatant was transferred into corresponding tubes and stored at −80 °C for subsequent plasma biochemical and antioxidant capacity analyses. Intestinal samples were taken for gene expression analysis related to antioxidants, immunity, and apoptosis. Additionally, two more fish from each bucket were randomly selected for whole-body composition analysis.

2.4. Heat Stress Experiment

At the end of the previous culture period, the remaining fish were placed back into the same RAS breeding buckets, maintaining the same groupings as before. The water temperature was incrementally raised from 28 °C to 33 °C at a rate of 0.5 °C per hour using a heating rod. The temperature was monitored every three hours with a thermometer until it stabilized at 33 ± 0.16 °C. During this period, the culture environment was maintained under the same conditions as the previous phase, with the dissolved oxygen concentration kept above 6 mg/L and the pH maintained between 7.0 and 7.5. The fish were cultured for an additional week under these conditions. Sample collection after the heat stress period was conducted following the methods outlined in Section 2.3. In addition to the previously collected samples, gills from each fish were harvested for TUNEL immunofluorescence analysis.

2.5. Measurement of Growth Indicators

The main growth indicators were calculated according to the specific formulae in Table 2.

2.6. Body Composition and Biochemical Analysis

The whole fish body composition and the crude composition of the feed were determined using methods referenced from previous studies within our group. Firstly whole fish moisture (%) was determined by drying in an oven at 105 °C. Whole fish and feed crude protein (%) were determined using a Kjeldahl nitrogen meter (Haineng K1100, Jinan Haineng Instrument Co., Ltd., Jinan, China). Whole fish and feed crude lipid (%) were determined on an automatic analyser (Haineng SOX606, Jinan Haineng Instrument Co., Ltd., China) using the Soxhlet extraction method. The ash (%) content of whole fish and feed was determined by burning in a muffle furnace (XL-2A, Hangzhou Zhuochi Instrument Co., Ltd., Hangzhou, China) at 560 °C. Plasma biochemical parameters ALT (alanine aminotransferase) and AST (aspartate aminotransferase) were measured using the methods recommended by the International Federation of Clinical Chemistry, employing kits purchased from Mindray Medical International Ltd. (Shenzhen, China) (ALT: 105-000442-00; AST: 15-00443-000) on the Mindray BS 400 automated biochemical analyser (Mindray Medical International Ltd., Shenzhen, China), as described in the experimental protocols of previous research [35]. Plasma antioxidant enzyme activity factors MDA (malondialdehyde), CAT (catalase), SOD (superoxide dismutase), GSH-Px (glutathione peroxidase), GSH (glutathione) and T-AOC (total antioxidant capacity) were measured using assay kits purchased from Jiancheng Bioengineering Institute (Nanjing, China). MDA was determined using the TBA method for amino acids (A003-1-2), CAT was measured by the molybdate method (A007-1-1), SOD was assessed via the WST-1 assay (A001-3-2), GSH was quantified using the microplate method (A006-1-1), GSH-Px was determined by the colorimetric method (A005-1-2), and T-AOC was measured by the ABTS method (A015-2-1). The primary experimental methods, kits, and equipment followed those detailed in the earlier research [35], as outlined in Table 3.

2.7. Methods of Analysing Apoptosis in Gills After Heat Stress

The analysis was conducted using the Aipathwell image analysis software (Alpathwell v2) from Servicebio. The procedure involved the following steps: (1) Positioning: The area to be measured was selected either automatically or manually. (2) Color Selection: The target fluorescence signal in HSI was manually selected to ensure accurate identification of the positive signal, which was then saved as a standard. (3) Calculation: The software automatically identifies DAPI-stained cell nuclei, extends the cytoplasmic boundaries, and computes the number of positive cells, area, cumulative optical density (IOD), and tissue area after reverse decolorization. (4) Analysis: The software processes high-power data of the measured area and generates a report.

2.8. Real-Time PCR Analysis

Following the method outlined by D. Huang et al. [35], RNA was extracted from perch intestines using the TRIzol method (Vazyme Biotech Co., Ltd., Nanjing, China). RNA concentration and purity were determined using a NanoDrop 2000 spectrophotometer. Real-time quantitative PCR analysis of genes related to immunity, antioxidant capacity, and apoptosis was performed on a CFX96 real-time PCR detection system (Bio-Rad) following the kit protocol (Q221-01, Vazyme, Nanjing, China). Beta-actin (β-actin) was selected as the internal reference gene due to its stability in prior studies within the group. Primer sequences are provided in Table 4.

2.9. Statistical Analyses

Growth performance data and whole fish body composition are presented as Mean ± Standard Error (Mean ± S.E.) and analyzed using one-way analysis of variance (ANOVA) with Tukey’s method in SPSS ver. 26 to determine statistical significance (p < 0.05). Independent t-tests were used for comparisons before and after heat stress, with p < 0.05 indicating statistical significance and p < 0.01 denoting high significance. Graphs and tables were created using GraphPad Prism software (GraphPad Prism version 9.1.0 for Windows (GraphPad Software, San Diego, CA, USA).

3. Results

3.1. Growth Data

As shown in Table 5, the FBW, WGR, and SGR were significantly higher in the VC3 and VC4 groups compared to the VC1 group (p < 0.05). The FCR decreased markedly in the VC2, VC5, and VC6 groups compared to the VC1 group (p < 0.05). Quadratic regression analysis of SGR (Figure 1) and WGR (Figure 2) with varying VC levels indicated that the optimal VC requirement for the diet was 0.77 g/kg. According to Table 6, different VC concentrations in the diet did not significantly affect the whole-body composition of M. salmoides (p > 0.05).

3.2. Plasma Biochemical Analysis Before and After Heat Stress

Figure 3 illustrates the effect of dietary VC levels on plasma biochemical indices of M. salmoides before and after heat stress. No significant impact on ALT and AST concentrations was observed in all groups before heat stress (p > 0.05). After heat stress, both ALT and AST levels in the VC4 group were markedly lower than those in the VC1 group (p < 0.05). t-test analysis revealed significant increases in ALT and AST levels after heat stress across all groups (p < 0.01).

3.3. Analysis of Plasma Antioxidant Capacity

Figure 4 presents the effects of different VC levels in the diet on the plasma antioxidant capacity of M. salmoides before and after heat stress. Before stress, the activity of T-AOC (Figure 4A) was significantly higher in the VC3 and VC4 groups compared to the VC1 group (p < 0.05). SOD activity (Figure 4B) was significantly increased in the VC6 group (p < 0.05). MDA content (Figure 4C) was lowest in the VC3 group (p < 0.05). CAT activity (Figure 4E) was markedly higher in the VC3 and VC6 groups than in the VC1 group (p < 0.05). GSH-Px activity (Figure 4E) was significantly higher in the VC4 group than in the VC1 group (p < 0.05). After heat stress, the activities of T-AOC (Figure 4A), SOD (Figure 4B), and GSH-Px (Figure 4E) were considerably higher in the VC5 group compared to the VC1 group (p < 0.05). MDA content (Figure 4C) remained lowest in the VC3 group (p < 0.05), while GSH levels (Figure 4D) were significantly higher in the VC4 group (p < 0.05). The highest CAT activity (Figure 4E) was observed in the VC3 and VC6 groups (p < 0.05). t-test analysis revealed that the activities of T-AOC and SOD were significantly higher after heat stress compared to before heat stress (p < 0.05), with GSH levels significantly elevated in the VC2-VC5 groups.

3.4. Analysis of Antioxidant-Related Genes in the Intestine

Figure 5 illustrates the impact of varying VC levels in the diet on the antioxidant nrf2 signaling pathway in the intestines of M. salmoides before and after heat stress. Before heat stress, different VC levels did not substantially affect the expression of nrf2 (Figure 5A), keap1 (Figure 5B), sod (Figure 5C), or gpx (Figure 5D) (p > 0.05). However, the expression of cat (Figure 5E) in the VC3 group was substantially higher than in the VC1 group (p < 0.05). After heat stress, the expression levels of nrf2 (Figure 5A), sod (Figure 5C), gpx (Figure 5D), and cat (Figure 5E) showed no significant differences between the groups (p > 0.05). The expression of keap1 (Figure 5B) was notably higher in the VC3 group compared to the VC1 group (p < 0.05). t-test analysis revealed that after heat stress, gpx expression (Figure 5D) was significantly higher between the groups than before heat stress (p < 0.05), with keap1 (Figure 5B) showing similar trends in the VC1-VC4 groups.

3.5. Analysis of Immune-Related Genes in the Intestine

Figure 6 demonstrates the effects of different VC levels on antioxidant-related genes in the intestines of M. salmoides. Before heat stress, expressions of nf-κb (Figure 6A), il-8 (Figure 6D), and tnf-α (Figure 6E) showed a gradual decrease, being substantially lower in the VC4 and VC5 groups compared to the VC1 group (p < 0.05). The expression of tgf-β (Figure 6B) exhibited a gradual increase, reaching the highest level in the VC6 group (p < 0.05). The expression of il-10 (Figure 6C) was markedly higher in the VC3 group than in the VC1 group (p < 0.05). After heat stress, expressions of nf-κb (Figure 6A), il-8 (Figure 6D), and tnf-α (Figure 6E) followed a trend of initial decrease followed by an increase, with the lowest levels of nf-κb (Figure 6A) and il-8 (Figure 6D) observed in the VC4 group (p < 0.05), and the lowest tnf-α (Figure 6E) levels in the VC5 group (p < 0.05). The expression of tgf-β (Figure 6B) was significantly higher in the VC3 group (p < 0.05), while the expression of il-10 showed an initial increase followed by a decrease. t-test analysis revealed that expressions of il-10 (Figure 6C) and tnf-α (Figure 6E) were highly significant after heat stress compared to before heat stress (p < 0.01), while il-8 (Figure 6D) expressions also showed significant changes in the VC1-VC3 groups.

3.6. Expression of Apoptosis-Related Genes

Figure 7 illustrates the effects of different VC levels in the diet on apoptosis-related gene expression in the intestines of M. salmoides before and after heat stress. Before heat stress, the expression of bcl-2 (Figure 7B) was significantly higher in the VC3 group compared to the other groups (p < 0.05). The expression levels of caspase 8 (Figure 7D) and caspase 9 (Figure 7E) were significantly lower in the VC4 group compared to the VC1 group (p < 0.05). No significant differences were observed in the expression of bax (Figure 7A) and caspase 3 (Figure 7C) (p > 0.05). After heat stress, the expressions of bax (Figure 7A), caspase 8 (Figure 7D), and caspase 3 (Figure 7C) were significantly lower in the VC4 group compared to the VC1 group (p < 0.05). The expression of bcl-2 (Figure 7B) initially increased and then decreased, with the highest expression observed in the VC3 group (p < 0.05). The expressions of caspase 3 (Figure 7C) and caspase 9 (Figure 7E) were not markedly affected by VC addition (p > 0.05). t-test analysis revealed that the expression of bax (Figure 7A), caspase 9 (Figure 7E), and bcl-2 (Figure 7B) showed highly significant differences after heat stress compared to before heat stress (p < 0.01).

3.7. TUNEL (Red) Fluorescence Analysis

Table 7 presents the results of TUNEL (red) fluorescence analysis of apoptosis in the gills of M. salmoides after heat stress, showing the effects of different VC levels. The density of red-positive cells was significantly lower in the VC3–VC5 groups compared to the VC1 group (p < 0.05), with the lowest density observed in the VC4 group (p < 0.05). The red mean density was also markedly lower in the VC4 and VC6 groups than in the VC1 group (p < 0.05). As shown in Figure 8, the VC3–VC5 groups exhibited the lowest number of apoptotic cells, with increased VC supplementation.

4. Discussion

4.1. Effects of VC Supplementation in Low Fishmeal Diets on the Growth Performance of M. salmoides

VC is an essential nutrient for fish growth [39]. Dietary VC supplementation has been shown to significantly enhance growth performance in species such as gibel carp (Carassius gibelio) [40] and Amur carp (Cyprinus carpio haematopterus) [41]. In this experiment, the addition of VC to the diet resulted in an initial increase in FBW, WGR, and SGR, followed by a decline. The optimal growth results were observed in the VC3 and VC4 groups. VC supplementation can enhance iron absorption [12], improve immune function [14], and contribute to collagen synthesis [42], all of which support fish growth, health, and nutrient absorption. Consistent with these findings, the addition of VC to a low-fishmeal diet improved the growth performance of juvenile M. salmoides in this study. Additionally, based on quadratic regression analysis of SGR and WGR, the optimal dietary VC requirement for M. salmoides fed low-fishmeal diets was estimated to be 0.77 g/kg. However, when VC supplementation exceeded 0.81 g/kg, a decline in growth performance was observed. This aligns with previous research on juvenile cobia (Rachycentron canadum L.), which showed growth inhibition when VC levels in the diet exceeded 150 mg/kg [29]. Similarly, a study on hybrid groupers (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂) found that excessive VC levels led to growth suppression similar to the control group [43]. High doses of VC may disrupt physiological processes, thereby slowing growth. This finding is supported by earlier studies, which suggested that VC levels above a certain threshold do not further improve growth performance [44]. Additionally, in our study, the VC supplementation did not significantly affect the whole-body composition of M. salmoides, which aligns with findings from research on walleye pollock (Gadus chalcogrammus) [45].

4.2. Effects of VC Supplementation in Low Fishmeal Diets on Plasma ALT and AST Levels in M. salmoides

Plasma ALT and AST levels serve as indicators of physiological changes and stress in fish, with elevated concentrations reflecting liver and tissue damage [46]. In this experiment, under low fishmeal conditions, no significant changes in ALT and AST levels were observed prior to heat stress across the different VC supplementation groups. However, after heat stress, the VC4 group showed significantly reduced ALT and AST levels compared to the VC1 group. These results align with findings from studies on coho salmon (Oncorhynchus kisutch) [47], juvenile Chinese sucker (Myxocyprinus asiaticus) [48], and juvenile striped catfish (Pangasianodon hypophthalmus) [49], where appropriate VC supplementation effectively reduced plasma ALT and AST levels. These observations suggest that VC supplementation in low fishmeal diets can reduce ALT and AST levels, indicating its potential to protect hepatocytes from damage. Additionally, independent sample t-tests revealed that ALT and AST levels were significantly higher after stress compared to before stress within the same VC supplementation groups. This indicates that the temperature conditions in the experiment likely induced oxidative stress in fish, leading to excessive ALT and AST in the blood [50]. In summary, under heat stress conditions, VC supplementation in low fishmeal diets for M. salmoides can reduce ALT and AST levels, thereby improving fish health.

4.3. Effects of VC Supplementation in Low Fishmeal Diets on Plasma and Intestinal Antioxidant Capacity of M. salmoides

Antioxidant enzyme activities and related gene expression are closely linked to tissue health [51]. Nrf2 plays a pivotal role in antioxidant functions, regulating factors such as sod, cat, and gpx [52,53]. These enzymes counteract the toxicity of reactive oxygen species (ROS), while the activity of T-AOC and the levels of GSH effectively reflect the antioxidant capacity of fish [54]. In our experiment, prior to heat stress, the VC3 group exhibited higher expression levels of cat and greater CAT enzyme activity than the VC1 group. The downstream factors of nrf2 and enzyme activity indicators, including T-AOC and GSH-Px, peaked in the VC3 and VC4 groups. VC supplementation in the diets of juvenile yellow catfish (Pelteobagrus fulvidraco) [33] and black carp (Mylopharyngodon piceus) [55] enhances the activities of SOD, CAT, and GSH-Px. VC also promotes nrf2/keap1 signaling and gene expression, further boosting antioxidant capacity [56]. After heat stress, the VC3 group demonstrated the highest expression levels of keap1 and nrf2. T-AOC and GSH levels were highest in the VC4 group, while SOD and GSH-Px levels peaked in the VC5 group. Furthermore, studies have shown that Nrf2 expression increases during stress, indicating its protective role, and it is positively correlated with the expression of antioxidant factors [57]. However, sustained elevation of Nrf2 may lead to free radical damage, apoptosis, and tumorigenesis [58,59]. In contrast, increased expression of Keap1 enhances the regulation of Nrf2 abundance, reduces its gene expression, and thereby contributes to more effective antioxidant responses [58]. Heat stress experiments on golden shiners (Notemigonus crysoleucas) [60] and rats [61] have shown that dietary VC enhances heat stress resistance and cellular responses. In gibel carp (Carassius gibelio), VC activates the nrf2/keap1 pathway following acute stress, mitigating oxidative damage [40]. Before and after heat stress, MDA levels in the VC3 group were significantly lower compared to the VC1 group, indirectly indicating that adding 0.66 g/kg of VC benefits fish health. Heat stress increases mitochondrial respiration and ROS production [62]. The upregulation of genes (keap1, sod, cat) and the enhanced activities of antioxidant enzymes (CAT, SOD, GSH-Px) suggest that adding VC at this level improves antioxidant defenses and reduces oxidative damage induced by heat stress. Therefore, incorporating VC into low fishmeal diets enhances the antioxidant capacity of M. salmoides under heat stress, helping to alleviate the impacts of heat stress.

4.4. Effects of VC Supplementation in Low Fishmeal Diets on Intestinal Immune Function in M. salmoides

The NF-κB pathway plays a pivotal role in physiological processes such as inflammation and immune responses [63], regulating downstream immune factors [64]. VC has been demonstrated to modulate the innate immune system in fish [65]. In this experiment, the NF-κB pathway was activated before heat stress, with the expression of the anti-inflammatory factor il-10 being highest in the VC3 group. Additionally, the expression of tgf-β positively correlated with VC levels, while the pro-inflammatory factors il-8 and tnf-α were lowest in the VC5 group. Similar studies on juvenile grass carp [66] and yellow catfish [33] showed that VC supplementation down-regulated pro-inflammatory factors and up-regulated anti-inflammatory factors, enhancing immune capacity. Earlier research also indicated that VC enhanced immune-related gene expression in heat-stressed gibel carp, boosting lysozyme and complement C3 levels [40]. After heat stress in the present study, the NF-κB pathway remained activated, with the highest tgf-β expression observed in the VC3 group. The VC4 group exhibited the most reduced il-8 levels, and the VC5 group showed the lowest tnf-α expression. These results suggest that VC supplementation in a low fishmeal diet activates the NF-κB pathway, promotes anti-inflammatory factor expression, inhibits pro-inflammatory factors, and protects gut health. t-tests revealed that after heat stress, il-10 and tnf-α expressions significantly increased compared to pre-stress levels, while tgf-β and il-8 expressions were most evident in the VC1-VC3 groups. Heat stress activates both innate and adaptive immune responses in fish, including the upregulation of pro-inflammatory cytokines like il-1β, il-6, and tnf-α, indicating an inflammatory response [67]. Thus, VC supplementation in low fishmeal diets after heat stress promotes the expression of anti-inflammatory factors, reduces pro-inflammatory responses, and enhances immune function.

4.5. Effects of VC Supplementation in Low Fishmeal Diets on Intestinal Apoptosis in M. salmoides

Apoptosis is regulated by the bcl-2 family, where bax promotes apoptosis and bcl-2 inhibits it [68]. Caspase 8 and caspase 9 require activation by caspase 3, and elevated mRNA levels of these caspases are indicative of increased apoptosis [69,70]. In this experiment, prior to heat stress, the expression of bcl-2 was highest in the VC4 group, while caspase 3 expression was lowest. Expression levels of bax, caspase 8, and caspase 9 decreased with increasing VC supplementation. These results suggest that VC supplementation in a low-fishmeal diet enhances anti-apoptotic capacity, a conclusion also supported by studies on grass carp, where VC supplementation reduced pro-apoptotic genes (bax and caspase 3) and increased bcl-2 expression [68,71]. After heat stress, the VC4 group exhibited the lowest expressions of bax and caspase 8, with bcl-2 peaking in the VC3 group. Although changes in caspase 3 and caspase 9 expression were not significant, caspase 3 expression initially decreased before increasing, while caspase 9 expression declined with higher VC levels. Studies on gibel carp [40] and abalone [56] have shown that VC supplementation during stress reduces apoptosis. In a study on pikeperch (Sander lucioperca), acute heat stress significantly increased the expression of pro-apoptotic genes bax, caspase 3, and caspase 9. In this experiment, adding 0.81 g/kg VC to the diet effectively reduced apoptosis in fish [72]. Furthermore, bax, bcl-2, and caspase 3 expressions were significantly higher after heat stress compared to before, likely due to cell damage or apoptosis induced by high temperatures [73]. Based on our findings, VC-enriched diets likely promote anti-apoptotic gene expression while reducing pro-apoptotic gene expression. These results were further confirmed by immunofluorescence experiments on gills. After TUNEL (red) staining, it was observed that VC supplementation at levels of 0.66–0.97 g/kg (VC3–VC5 groups) in low fishmeal diets effectively reduced apoptosis under heat stress conditions.

5. Conclusions

In conclusion, the inclusion of VC in low fishmeal diets mitigates the growth inhibition, antioxidant capacity reduction, and immune suppression associated with low fishmeal while effectively reducing apoptosis in fish. Additionally, based on quadratic regression analysis of SGR and WGR, the optimal dietary VC requirement for M. salmoides fed low-fishmeal diets was estimated to be 0.77 g/kg. Under heat stress conditions, VC supplementation significantly enhances the antioxidant, immune, and anti-apoptotic capacities of fish, thereby improving their resistance to acute heat stress.

Author Contributions

Conceptualization, H.L.; Data curation, L.Z., D.H. and Y.W.; Formal analysis, S.Z.; Funding acquisition, M.R.; Investigation, Y.W.; Methodology, X.C., Z.C. and M.R.; Resources, X.C.; Validation, L.Z.; Writing—original draft, S.Z.; Writing—review and editing, H.L., D.H., Z.C. and M.R. All authors have read and agreed to the published version of the manuscript.

Funding

This study was financially supported by the National Key R&D Program of China (2024YFD2402005), the earmarked fund for CARS (CARS-46), and Natural Science Foundation of Jiangsu Province (BK20240324).

Institutional Review Board Statement

The study was approved by the Laboratory Animal Ethics Committee of the Freshwater Fisheries Research Center (LAECFFRC-2024-08-25).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

Xiaoru Chen, Lu Zhang and Yongli Wang were employed by Tongwei Agricultural Development Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Jannathulla, R.; Rajaram, V.; Kalanjiam, R.; Ambasankar, K.; Muralidhar, M.; Dayal, J.S. Fishmeal availability in the scenarios of climate change: Inevitability of fishmeal replacement in aquafeeds and approaches for the utilization of plant protein sources. Aquac. Res. 2019, 50, 3493–3506. [Google Scholar] [CrossRef]
  2. Dhar, V.; Singh, S.K.; Narsale, S.A.; Debbarma, S.; Saikia, P.; Yirang, Y. Fishmeal substitutions and their implications for aquatic animal immune and gut function: A review. Comp. Immunol. Rep. 2024, 7, 200171. [Google Scholar] [CrossRef]
  3. Macusi, E.D.; Cayacay, M.A.; Borazon, E.Q.; Sales, A.C.; Habib, A.; Fadli, N.; Santos, M.D. Protein Fishmeal Replacement in Aquaculture: A Systematic Review and Implications on Growth and Adoption Viability. Sustainability 2023, 15, 12500. [Google Scholar] [CrossRef]
  4. Bonvini, E.; Bonaldo, A.; Mandrioli, L.; Sirri, R.; Dondi, F.; Bianco, C.; Fontanillas, R.; Mongile, F.; Gatta, P.P.; Parma, L. Effects of feeding low fishmeal diets with increasing soybean meal levels on growth, gut histology and plasma biochemistry of sea bass. Animal 2018, 12, 923–930. [Google Scholar] [CrossRef] [PubMed]
  5. Hussain, S.M.; Bano, A.A.; Ali, S.; Rizwan, M.; Adrees, M.; Zahoor, A.F.; Sarker, P.K.; Hussain, M.; Arsalan, M.Z.U.H.; Yong, J.W.H.; et al. Substitution of fishmeal: Highlights of potential plant protein sources for aquaculture sustainability. Heliyon 2024, 10, e26573. [Google Scholar] [CrossRef]
  6. Chen, S.; Maulu, S.; Wang, J.; Xie, X.; Liang, X.; Wang, H.; Wang, J.; Xue, M. The application of protease in aquaculture: Prospects for enhancing the aquafeed industry. Anim. Nutr. 2024, 16, 105–121. [Google Scholar] [CrossRef]
  7. Onomu, A.J.; Okuthe, G.E. The Role of Functional Feed Additives in Enhancing Aquaculture Sustainability. Fishes 2024, 9, 167. [Google Scholar] [CrossRef]
  8. Wang, X.; Shao, J. Editorial: Beneficial effects of functional ingredients in feed on immunity improvement and growth promotion of aquaculture animals. Front. Mar. Sci. 2023, 10, 1229367. [Google Scholar] [CrossRef]
  9. Cai, Q.; Wu, X.; Gatlin, D.M.; Zhang, L.; Zhai, H.; Zhou, Z.; Yin, H.; Geng, L.; Irm, M. Dietary vitamin C affects growth, antioxidant status and serum immune parameter of juvenile hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂) fed low fishmeal diets. Aquaculture 2022, 556, 738285. [Google Scholar] [CrossRef]
  10. Lin, M.; Shiau, S. Dietary l-ascorbic acid affects growth, nonspecific immune responses and disease resistance in juvenile grouper, Epinephelus malabaricus. Aquaculture 2005, 244, 215–221. [Google Scholar] [CrossRef]
  11. Al-Amoudi, M.M.; El-Nakkadi, A.M.N.; El-Nouman, B.M. Evaluation of optimum dietary requirement of vitamin C for the growth of Oreochromis spilurus fingerlings in water from the Red Sea. Aquaculture 1992, 105, 165–173. [Google Scholar] [CrossRef]
  12. Soliman, A.K.; Jauncey, K.; Roberts, R.J. The effect of varying forms of dietary ascorbic acid on the nutrition of juvenile tilapias (Oreochromis niloticus). Aquaculture 1986, 52, 1–10. [Google Scholar] [CrossRef]
  13. Maage, A.; Waagbø, R.; Olsson, P.E.; Julshamn, K.; Sandnes, K. Ascorbate-2-sulfate as a dietary vitamin C source for Atlantic salmon (Salmo salar): 2. Effects of dietary levels and immunization on the metabolism of trace elements. Fish Physiol. Biochem. 1990, 8, 429–436. [Google Scholar] [CrossRef]
  14. Shiau, S.Y.; Hsu, T.S. Quantification of vitamin C requirement for juvenile hybrid tilapia, Oreochromis niloticus × Oreochromis aureus, with l-ascorbyl-2-monophosphate-Na and l-ascorbyl-2-monophosphate-Mg. Aquaculture 1999, 175, 317–326. [Google Scholar] [CrossRef]
  15. Sandell, L.J.; Daniel, J.C. Effects of Ascorbic Acid on Collagen Mrna Levels in Short Term Chondrocyte Cultures. Connect. Tissue Res. 2009, 17, 11–22. [Google Scholar] [CrossRef] [PubMed]
  16. Carr, A.; Frei, B. Does vitamin C act as a pro-oxidant under physiological conditions? FASEB J. 1999, 13, 1007–1024. [Google Scholar] [CrossRef] [PubMed]
  17. Xu, H.; Jiang, W.; Feng, L.; Liu, Y.; Wu, P.; Jiang, J.; Kuang, S.Y.; Tang, L.; Tang, W.N.; Zhang, Y.A.; et al. Dietary vitamin C deficiency depressed the gill physical barriers and immune barriers referring to Nrf2, apoptosis, MLCK, NF-κB and TOR signaling in grass carp (Ctenopharyngodon idella) under infection of Flavobacterium columnare. Fish Shellfish Immunol. 2016, 58, 177–192. [Google Scholar] [CrossRef]
  18. Chien, L.T.; Hwang, D.F. Effects of thermal stress and vitamin C on lipid peroxidation and fatty acid composition in the liver of thornfish Terapon jarbua. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2001, 128, 91–97. [Google Scholar] [CrossRef]
  19. Chien, L.T.; Hwang, D.F.; Jeng, S.S. Effect of Thermal Stress on Dietary Requirement of Vitamin C in Thornfish (Terapon jarbua). Fish. Sci. 1999, 65, 731–735. [Google Scholar] [CrossRef]
  20. Bai, J.; Lutz-Carrillo, D.J.; Quan, Y.; Liang, S. Taxonomic status and genetic diversity of cultured largemouth bass Micropterus salmoides in China. Aquaculture 2008, 278, 27–30. [Google Scholar] [CrossRef]
  21. Jiang, B.; Lu, G.; Du, J.; Wang, J.; Hu, Y.; Su, Y.; Li, A. First report of trypanosomiasis in farmed largemouth bass (Micropterus salmoides) from China: Pathological evaluation and taxonomic status. Parasitol. Res. 2019, 118, 1731–1739. [Google Scholar] [CrossRef]
  22. Yu, P.; Chen, H.; Liu, M.; Zhong, H.; Wang, X.; Wu, Y.; Sun, Y.; Wu, C.; Wang, S.; Zhao, C.; et al. Current status and application of largemouth bass (Micropterus salmoides) germplasm resources. Reprod. Breed. 2024, 4, 73–82. [Google Scholar] [CrossRef]
  23. Yin, Y.; Chen, X.; Gui, Y.; Zou, J.; Wang, Q.; Qiu, L.; Fan, L.; Meng, S.; Song, C. Risk and benefit assessment of potential neurodevelopment effect resulting from consumption of cultured largemouth bass (Micropterus salmoides) in China. Environ. Sci. Pollut. Res. 2022, 29, 89788–89795. [Google Scholar] [CrossRef] [PubMed]
  24. Du, J.; Xie, Y.; Li, M.; Zhu, T.; Lei, C.; Song, H.; Han, L.; Li, S. Effects of chronic heat stress on growth performance, liver histology, digestive enzyme activities, and expressions of HSP genes in different populations of Largemouth bass (Micropterus salmoides). Aquac. Rep. 2024, 35, 101972. [Google Scholar] [CrossRef]
  25. Yusuf, A.; Huang, X.; Chen, N.; Li, S.; Apraku, A.; Wang, W.; David, M.A. Growth and metabolic responses of juvenile largemouth bass (Micropterus salmoides) to dietary vitamin c supplementation levels. Aquaculture 2021, 534, 736243. [Google Scholar] [CrossRef]
  26. Verlhac, V.; Gabaudan, J. Influence of vitamin C on the immune system of salmonids. Aquac. Res. 1994, 25, 21–36. [Google Scholar] [CrossRef]
  27. Yusuf, A.; Huang, X.; Chen, N.; Apraku, A.; Wang, W.; Cornel, A.; Rahman, M.M. Impact of dietary vitamin c on plasma metabolites, antioxidant capacity and innate immunocompetence in juvenile largemouth bass, Micropterus salmoides. Aquac. Rep. 2020, 17, 100383. [Google Scholar] [CrossRef]
  28. Ai, Q.; Mai, K.; Zhang, C.; Xu, W.; Duan, Q.; Tan, B.; Liufu, Z. Effects of Dietary Vitamin C on Growth and Immune Response of Japanese Seabass, Lateolabrax Japonicus. Aquaculture 2004, 242, 489–500. [Google Scholar] [CrossRef]
  29. Zhou, Q.; Wang, L.; Wang, H.; Xie, F.; Wang, T. Effect of Dietary Vitamin C on the Growth Performance and Innate Immunity of Juvenile Cobia (Rachycentron Canadum). Fish Shellfish Immunol. 2012, 32, 969–975. [Google Scholar] [CrossRef]
  30. Liu, H.P.; Wen, B.; Chen, Z.Z.; Gao, J.Z.; Liu, Y.; Zhang, Y.C.; Wang, Z.X.; Peng, Y. Effects of Dietary Vitamin C and Vitamin E on the Growth, Antioxidant Defence and Digestive Enzyme Activities of Juvenile Discus Fish (Symphysodon Haraldi). Aquac. Nutr. 2019, 25, 176–183. [Google Scholar] [CrossRef]
  31. Tewary, A.; Patra, B.C. Use of Vitamin C as an Immunostimulant. Effect on Growth, Nutritional Quality, and Immune Response of Labeo rohita (Ham.). Fish Physiol. Biochem. 2008, 34, 251–259. [Google Scholar] [CrossRef]
  32. Ai, Q.; Mai, K.; Tan, B.; Xu, W.; Zhang, W.; Ma, H.; Liufu, Z. Effects of Dietary Vitamin C on Survival, Growth, and Immunity of Large Yellow Croaker, Pseudosciaena crocea. Aquaculture 2006, 261, 327–336. [Google Scholar] [CrossRef]
  33. Liang, X.P.; Li, Y.; Hou, Y.M.; Qiu, H.; Zhou, Q.C. Effect of Dietary Vitamin C on the Growth Performance, Antioxidant Ability and Innate Immunity of Juvenile Yellow Catfish (Pelteobagrus fulvidraco richardson). Aquac. Res. 2017, 48, 149–160. [Google Scholar] [CrossRef]
  34. Ren, M.; Liao, Y.; Xie, J.; Liu, B.; Zhou, Q.; Ge, X.; Cui, H.; Pan, L.; Chen, R. Dietary arginine requirement of juvenile blunt snout bream, Megalobrama amblycephala. Aquaculture 2013, 414–415, 229–234. [Google Scholar] [CrossRef]
  35. Huang, D.; Zhu, J.; Zhang, L.; Ge, X.; Ren, M.; Liang, H. Dietary Supplementation with Eucommia ulmoides Leaf Extract Improved the Intestinal Antioxidant Capacity, Immune Response, and Disease Resistance against Streptococcus agalactiae in Genetically Improved Farmed Tilapia (GIFT.; Oreochromis niloticus). Antioxidants 2022, 11, 1800. [Google Scholar] [CrossRef] [PubMed]
  36. Zhao, L.; Liang, J.; Chen, F.; Tang, X.; Liao, L.; Liu, Q.; Luo, J.; Du, Z.; Li, Z.; Luo, W.; et al. High carbohydrate diet induced endoplasmic reticulum stress and oxidative stress, promoted inflammation and apoptosis, impaired intestinal barrier of juvenile largemouth bass (Micropterus salmoides). Fish Shellfish Immunol. 2021, 119, 308–317. [Google Scholar] [CrossRef] [PubMed]
  37. Zhao, X.; Li, L.; Li, C.; Liu, E.; Zhu, H.; Ling, Q. Heat stress-induced endoplasmic reticulum stress promotes liver apoptosis in largemouth bass (Micropterus salmoides). Aquaculture 2022, 546, 737401. [Google Scholar] [CrossRef]
  38. Zhao, X.; Mao, W.; Lin, Z.; Ling, Q. Heat stress induced hepatocyte apoptosis in largemouth bass (Micropterus salmoides) via IRE1α/TRAF2/ASK1/JNK pathway. J. Oceanol. Limnol. 2024, 42, 988–1000. [Google Scholar] [CrossRef]
  39. Nasar, M.F.; Shah, S.Z.H.; Aftab, K.; Fatima, M.; Bilal, M.; Hussain, M. Dietary vitamin C requirement of juvenile grass carp (Ctenopharyngodon idella) and its effects on growth attributes, organ indices, whole-body composition and biochemical parameters. Aquac. Nutr. 2021, 27, 1903–1911. [Google Scholar] [CrossRef]
  40. Wu, L.; Xu, W.; Li, H.; Dong, B.; Geng, H.; Jin, J.; Han, D.; Liu, H.; Zhu, X.; Yang, Y.; et al. Vitamin C Attenuates Oxidative Stress, Inflammation, and Apoptosis Induced by Acute Hypoxia through the Nrf2/Keap1 Signaling Pathway in Gibel Carp (Carassius gibelio). Antioxidants 2022, 11, 935. [Google Scholar] [CrossRef]
  41. Kaur, R.; Batra, M.; Shah, T.K.; Saxena, A. Ameliorative effects of dietary Vitamin-C on growth performance and hemato-biochemical response of sodium fluoride-intoxicated Amur Carp, Cyprinus carpio haematopterus. Aquac. Res. 2022, 53, 2895–2909. [Google Scholar] [CrossRef]
  42. Grădinaru, A.C.; Popa, S. Vitamin C: From Self-Sufficiency to Dietary Dependence in the Framework of Its Biological Functions and Medical Implications. Life 2025, 15, 238. [Google Scholar] [CrossRef]
  43. Ebi, I.; Shapawi, R.; Lim, L.S.; Yong, A.S.K.; Mazlan, N.; Shah, M.D.; Basri, N.A.; Jaziri, A.A. Effects of dietary vitamins C and E on growth performance, hematological and biochemical parameters, skeletal abnormalities, and disease resistance against V. harveyi of hybrid groupers (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂). Aquac. Int. 2025, 33, 139. [Google Scholar] [CrossRef]
  44. Perera, A.D.; Bhujel, R.C. Potential role of L-ascorbic acid with Field cricket (Gryllus bimaculatus) meal in diets of Nile Tilapia (Oreochromis niloticus) during sex reversal and nursing. Isr. J. Aquac.—Bamidgeh 2021, 73, 1–17. [Google Scholar] [CrossRef]
  45. Lee, K.W.; Yoo, H.K.; Kim, S.S.; Han, G.S.; Jung, M.M.; Kim, H.S. Effect of Dietary Vitamin C Supplementation on Growth Performance and Biochemical Parameters in Grower Walleye Pollock, Gadus chalcogrammus. Animals 2024, 14, 1026. [Google Scholar] [CrossRef]
  46. Asztalos, B.; Nemcsók, J. Effect of pesticides on the LDH activity and isoenzyme pattern of carp (Cyprinus carpio L.) sera. Comp. Biochem. Physiol. Part C Comp. Pharmacol. 1985, 82, 217–219. [Google Scholar] [CrossRef] [PubMed]
  47. Xu, C.; Yu, H.; Li, L.; Li, M.; Qiu, X.; Fan, X.; Fan, Y.; Shan, L.; Xue, M. Effects of Dietary Vitamin C on the Growth Performance, Biochemical Parameters, and Antioxidant Activity of Coho Salmon Oncorhynchus kisutch (Walbaum, 1792) Postsmolts. Aquac. Nutr. 2022, 2022, 6866578. [Google Scholar] [CrossRef] [PubMed]
  48. Huang, F.; Wu, F.; Zhang, S.; Jiang, M.; Liu, W.; Tian, J.; Yang, C.; Wen, H. Dietary vitamin C requirement of juvenile Chinese sucker (Myxocyprinus asiaticus). Aquac. Res. 2017, 48, 37–46. [Google Scholar] [CrossRef]
  49. Daniel, N.; Muralidhar, A.P.; Srivastava, P.P.; Jain, K.K.; Pani Prasad, K.; Manish, J.; Sivaramakrishnan, T. Dietary ascorbic acid requirement for growth of striped catfish, Pangasianodon hypophthalmus(Sauvage, 1878) juveniles. Aquac. Nutr. 2018, 24, 616–624. [Google Scholar] [CrossRef]
  50. Ismail, H.T.H.; Mahboub, H.H.H. Effect of acute exposure to nonylphenol on biochemical, hormonal, and hematological parameters and muscle tissues residues of Nile tilapia; Oreochromis niloticus. Vet. World 2016, 9, 616–625. [Google Scholar] [CrossRef]
  51. Feng, L.; Xiao, W.; Liu, Y.; Jiang, J.; Hu, K.; Jiang, W.; Li, S.; Zhou, X. Methionine hydroxy analogue prevents oxidative damage and improves antioxidant status of intestine and hepatopancreas for juvenile Jian carp (Cyprinus carpio var. Jian). Aquac. Nutr. 2011, 17, 595–604. [Google Scholar] [CrossRef]
  52. Hou, D.X.; Korenori, Y.; Tanigawa, S.; Yamada-Kato, T.; Nagai, M.; He, X.; He, J. Dynamics of Nrf2 and Keap1 in ARE-Mediated NQO1 Expression by Wasabi 6-(Methylsulfinyl)hexyl Isothiocyanate. J. Agric. Food Chem. 2011, 59, 11975–11982. [Google Scholar] [CrossRef] [PubMed]
  53. Bellezza, I.; Giambanco, I.; Minelli, A.; Donato, R. Nrf2-Keap1 signaling in oxidative and reductive stress. Biochim. et Biophys. Acta (BBA)—Mol. Cell Res. 2018, 1865, 721–733. [Google Scholar] [CrossRef] [PubMed]
  54. Çiçek, S.; Özoğul, F. Effects of selenium nanoparticles on growth performance, hematological, serum biochemical parameters, and antioxidant status in fish. Anim. Feed Sci. Technol. 2021, 281, 115099. [Google Scholar] [CrossRef]
  55. Hu, Y.; Huang, Y.; Wen, H.; Huan, Z.; Zhong, L.; Mao, X.; Li, J.; Xiao, T. Effect of vitamin C on growth, immunity and anti-ammonia-nitrite stress ability in juvenile black carp (Mylopharyngodon piceus). J. Fish. China 2013, 37, 565. [Google Scholar] [CrossRef]
  56. Luo, K.; Li, X.; Wang, L.; Rao, W.; Wu, Y.; Liu, Y.; Pan, M.; Huang, D.; Zhang, W.; Mai, K. Ascorbic Acid Regulates the Immunity, Anti-Oxidation and Apoptosis in Abalone Haliotis discus hannai Ino. Antioxidants 2021, 10, 1449. [Google Scholar] [CrossRef]
  57. Zeng, L.; Ai, C.; Wang, Y.; Zhang, J.; Wu, C. Abrupt Salinity Stress Induces Oxidative Stress via the Nrf2-Keap1 Signaling Pathway in Large Yellow Croaker Pseudosciaena crocea. Fish Physiol. Biochem. 2017, 43, 955–964. [Google Scholar] [CrossRef]
  58. Katoh, Y.; Iida, K.; Kang, M.-I.; Kobayashi, A.; Mizukami, M.; Tong, K.I.; McMahon, M.; Hayes, J.D.; Itoh, K.; Yamamoto, M. Evolutionary Conserved N-Terminal Domain of Nrf2 Is Essential for the Keap1-Mediated Degradation of the Protein by Proteasome. Arch. Biochem. Biophys. 2005, 433, 342–350. [Google Scholar] [CrossRef]
  59. Kensler, T.W.; Wakabayashi, N.; Biswal, S. Cell Survival Responses to Environmental Stresses via the Keap1-Nrf2-ARE Pathway. Annu. Rev. Pharmacol. Toxicol. 2007, 47, 89–116. [Google Scholar] [CrossRef]
  60. Chen, R.; Lochmann, R.; Goodwin, A.; Praveen, K.; Dabrowski, K.; Lee, K.J. Alternative Complement Activity and Resistance to Heat Stress in Golden Shiners (Notemigonus crysoleucas) Are Increased by Dietary Vitamin C Levels in Excess of Requirements for Prevention of Deficiency Signs. J. Nutr. 2003, 133, 2281–2286. [Google Scholar] [CrossRef]
  61. Yun, S.H.; Moon, Y.S.; Sohn, S.H.; Jang, I.S. Effects of Cyclic Heat Stress or Vitamin C Supplementation during Cyclic Heat Stress on HSP70, Inflammatory Cytokines, and the Antioxidant Defense System in Sprague Dawley Rats. Exp. Anim. 2012, 61, 543–553. [Google Scholar] [CrossRef]
  62. Bolzan, L.P.; Barroso, D.C.; Souza, C.F.; Oliveira, F.C.; Wagner, R.; Baldisserotto, B.; Val, A.L.; Baldissera, M.D. Dietary supplementation with nerolidol improves the antioxidant capacity and muscle fatty acid profile of Brycon amazonicus exposed to acute heat stress. J. Therm. Biol. 2021, 99, 103003. [Google Scholar] [CrossRef]
  63. Qiu, W.; Hu, J.; Magnuson, J.T.; Greer, J.; Yang, M.; Chen, Q.; Fang, M.; Zheng, C.; Schlenk, D. Evidence linking exposure of fish primary macrophages to antibiotics activates the NF-kB pathway. Environ. Int. 2020, 138, 105624. [Google Scholar] [CrossRef] [PubMed]
  64. Liang, H.; Mokrani, A.; Ji, K.; Ge, X.; Ren, M.; Xie, J.; Liu, B.; Xi, B.; Zhou, Q. Dietary leucine modulates growth performance, Nrf2 antioxidant signaling pathway and immune response of juvenile blunt snout bream (Megalobrama amblycephala). Fish Shellfish Immunol. 2018, 73, 57–65. [Google Scholar] [CrossRef] [PubMed]
  65. Roberts, M.L.; Davies, S.J.; Pulsford, A.L. The influence of ascorbic acid (vitamin C) on non-specific immunity in the turbot (Scophthalmus maximus L.). Fish Shellfish Immunol. 1995, 5, 27–38. [Google Scholar] [CrossRef]
  66. Xu, H.; Jiang, W.; Feng, L.; Liu, Y.; Wu, P.; Jiang, J.; Kuang, S.; Tang, L.; Tang, W.; Zhang, Y.; et al. Dietary vitamin C deficiency depresses the growth, head kidney and spleen immunity and structural integrity by regulating NF-κB, TOR, Nrf2, apoptosis and MLCK signaling in young grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2016, 52, 111–138. [Google Scholar] [CrossRef] [PubMed]
  67. Singh, M.; Saini, V.P.; Meena, L.L. Heat stress induces oxidative stress and weakens the immune system in catfish Clarias magur: Evidence from physiological, histological, and transcriptomic analyses. Fish Shellfish Immunol. 2025, 161, 110294. [Google Scholar] [CrossRef]
  68. Raqib, R.; Ekberg, C.; Sharkar, P.; Bardhan, P.K.; Zychlinsky, A.; Sansonetti, P.J.; Andersson, J. Apoptosis in Acute Shigellosis Is Associated with Increased Production of Fas/Fas Ligand, Perforin, Caspase-1, and Caspase-3 but Reduced Production of Bcl-2 and Interleukin-2. Infect. Immun. 2002, 70, 3199–3207. [Google Scholar] [CrossRef]
  69. Ching, B.; Chen, X.L.; Yong, J.H.A.; Wilson, J.M.; Hiong, K.C.; Sim, E.W.L.; Wong, W.P.; Lam, S.H.; Chew, S.F.; Ip, Y.K. Increases in apoptosis, caspase activity and expression of p53 and bax, and the transition between two types of mitochondrion-rich cells, in the gills of the climbing perch, Anabas testudineus, during a progressive acclimation from freshwater to seawater. Front. Physiol. 2013, 4, 135. [Google Scholar] [CrossRef]
  70. Yabu, T.; Kishi, S.; Okazaki, T.; Yamashita, M. Characterization of zebrafish caspase-3 and induction of apoptosis through ceramide generation in fish fathead minnow tailbud cells and zebrafish embryo. Biochem. J. 2001, 360, 39–47. [Google Scholar] [CrossRef]
  71. Rahman, M.H.; Alam, M.A.; Flura; Sultana, S.; Islam, M.R. Effects of Dietary Vitamin C on the Growth Performance, Antioxidant Activity and Disease Resistance of Fish: A Review. Eur. J. Theor. Appl. Sci. 2023, 1, 744–768. [Google Scholar] [CrossRef] [PubMed]
  72. Liu, E.; Zhao, X.; Li, C.; Wang, Y.; Li, L.; Zhu, H.; Ling, Q. Effects of acute heat stress on liver damage, apoptosis and inflammation of pikeperch (Sander lucioperca). J. Therm. Biol. 2022, 106, 103251. [Google Scholar] [CrossRef] [PubMed]
  73. Wang, H.; Xing, G.; Qian, Y.; Sun, X.; Zhong, J.; Chen, K. Dihydromyricetin attenuates heat stress-induced apoptosis in dairy cow mammary epithelial cells through suppressing mitochondrial dysfunction. Ecotoxicol. Environ. Saf. 2021, 214, 112078. [Google Scholar] [CrossRef] [PubMed]
Antioxidants 14 01175 g001
Figure 1. Quadratic regression relationship between specific growth rate (SGR,%/day) and VC supplementation levels in low-fishmeal diets.
Figure 1. Quadratic regression relationship between specific growth rate (SGR,%/day) and VC supplementation levels in low-fishmeal diets.
Antioxidants 14 01175 g001
Antioxidants 14 01175 g002
Figure 2. Quadratic regression relationship between weight gain rate (WGR,%) and VC supplementation levels in low-fishmeal diets.
Figure 2. Quadratic regression relationship between weight gain rate (WGR,%) and VC supplementation levels in low-fishmeal diets.
Antioxidants 14 01175 g002
Antioxidants 14 01175 g003
Figure 3. Effect of different levels of VC added to low fishmeal diets on plasma biochemical parameters of M. salmoides before and after heat stress. Data after heat stress are marked with lowercase letters ‘a–b’. After t-test, ‘**’ for before and after heat stress data shows a extremely significant contrast (p < 0.01). Columns of identical color marked with different letters show significant variations between data points (p < 0.05). (A), ALT; (B), AST.
Figure 3. Effect of different levels of VC added to low fishmeal diets on plasma biochemical parameters of M. salmoides before and after heat stress. Data after heat stress are marked with lowercase letters ‘a–b’. After t-test, ‘**’ for before and after heat stress data shows a extremely significant contrast (p < 0.01). Columns of identical color marked with different letters show significant variations between data points (p < 0.05). (A), ALT; (B), AST.
Antioxidants 14 01175 g003
Antioxidants 14 01175 g004
Figure 4. Effect of different levels of VC added to low fishmeal diets on plasma antioxidant capacity of M. salmoides before and after heat stress. Data before heat stress are marked with uppercase letters ‘A–B’ and data after heat stress are marked with lowercase letters ‘a–d’. After t-test, ‘*’ for before and after heat stress data shows a statistically significant contrast (p < 0.05) and ‘**’ shows extremely significant (p < 0.01). Columns of identical color marked with different letters show significant variations between data points (p < 0.05). (A), T-AOC; (B), SOD; (C), MDA; (D), GSH; (E), GSH-Px; (F), CAT.
Figure 4. Effect of different levels of VC added to low fishmeal diets on plasma antioxidant capacity of M. salmoides before and after heat stress. Data before heat stress are marked with uppercase letters ‘A–B’ and data after heat stress are marked with lowercase letters ‘a–d’. After t-test, ‘*’ for before and after heat stress data shows a statistically significant contrast (p < 0.05) and ‘**’ shows extremely significant (p < 0.01). Columns of identical color marked with different letters show significant variations between data points (p < 0.05). (A), T-AOC; (B), SOD; (C), MDA; (D), GSH; (E), GSH-Px; (F), CAT.
Antioxidants 14 01175 g004
Antioxidants 14 01175 g005
Figure 5. Effects of different levels of VC added to low fishmeal diets on antioxidant-related genes in the intestine of M. salmoides before and after heat stress. Data before heat stress are marked with uppercase letters ‘A–D’ and data after heat stress are marked with lowercase letters ‘a–b’. After t-test, ‘*’ for before and after heat stress data shows a statistically significant contrast (p < 0.05) and ‘**’ shows extremely significant (p < 0.01). Columns of identical color marked with different letters show significant variations between data points (p < 0.05). (A), nrf2; (B), keap1; (C), sod; (D), gpx; (E), cat.
Figure 5. Effects of different levels of VC added to low fishmeal diets on antioxidant-related genes in the intestine of M. salmoides before and after heat stress. Data before heat stress are marked with uppercase letters ‘A–D’ and data after heat stress are marked with lowercase letters ‘a–b’. After t-test, ‘*’ for before and after heat stress data shows a statistically significant contrast (p < 0.05) and ‘**’ shows extremely significant (p < 0.01). Columns of identical color marked with different letters show significant variations between data points (p < 0.05). (A), nrf2; (B), keap1; (C), sod; (D), gpx; (E), cat.
Antioxidants 14 01175 g005
Antioxidants 14 01175 g006
Figure 6. Effects of different levels of VC added to low fishmeal diets on intestinal immune-related genes in M. salmoides before and after heat stress. Data before heat stress are marked with uppercase letters ‘A–D’ and data after heat stress are marked with lowercase letters ‘a–d’. After t-test, ‘*’ for before and after heat stress data shows a statistically significant contrast (p < 0.05) and ‘**’ shows extremely significant (p < 0.01). Columns of identical color marked with different letters show significant variations between data points (p < 0.05). (A), nf-κb; (B), tgf-β; (C), il-10; (D), il-8; (E), tnf-α.
Figure 6. Effects of different levels of VC added to low fishmeal diets on intestinal immune-related genes in M. salmoides before and after heat stress. Data before heat stress are marked with uppercase letters ‘A–D’ and data after heat stress are marked with lowercase letters ‘a–d’. After t-test, ‘*’ for before and after heat stress data shows a statistically significant contrast (p < 0.05) and ‘**’ shows extremely significant (p < 0.01). Columns of identical color marked with different letters show significant variations between data points (p < 0.05). (A), nf-κb; (B), tgf-β; (C), il-10; (D), il-8; (E), tnf-α.
Antioxidants 14 01175 g006
Antioxidants 14 01175 g007
Figure 7. Effects of different levels of VC added to low fishmeal diets on intestinal apoptosis-related genes in M. salmoides before and after heat stress. Data before heat stress are marked with uppercase letters ‘A–B’ and data after heat stress are marked with lowercase letters ‘a–c’. After t-test, ‘*’ for before and after heat stress data shows a statistically significant contrast (p < 0.05) and ‘**’ shows extremely significant (p < 0.01). Columns of identical color marked with different letters show significant variations between data points (p < 0.05). (A), bax; (B), bcl-2; (C), caspase 3; (D), caspase 8; (E), caspase 9.
Figure 7. Effects of different levels of VC added to low fishmeal diets on intestinal apoptosis-related genes in M. salmoides before and after heat stress. Data before heat stress are marked with uppercase letters ‘A–B’ and data after heat stress are marked with lowercase letters ‘a–c’. After t-test, ‘*’ for before and after heat stress data shows a statistically significant contrast (p < 0.05) and ‘**’ shows extremely significant (p < 0.01). Columns of identical color marked with different letters show significant variations between data points (p < 0.05). (A), bax; (B), bcl-2; (C), caspase 3; (D), caspase 8; (E), caspase 9.
Antioxidants 14 01175 g007
Antioxidants 14 01175 g008
Figure 8. The immunofluorescence of gills of M. salmoides after heat stress stained with Tunel (red). The red dots in the picture represent apoptotic cells. In order to show them more easily, we labelled them using green circles.
Figure 8. The immunofluorescence of gills of M. salmoides after heat stress stained with Tunel (red). The red dots in the picture represent apoptotic cells. In order to show them more easily, we labelled them using green circles.
Antioxidants 14 01175 g008
Table 1. Main and crude ingredients of experimental feeds.
Table 1. Main and crude ingredients of experimental feeds.
IngredientsVC1VC2VC3VC4VC5VC6
Fishmeal252525252525
Chicken meal 112.0012.0012.0012.0012.0012.00
Soy concentrated protein 113.4113.4113.4113.4113.4113.41
Soybean meal 115.7015.7015.7015.7015.7015.70
Wheat gluten 15.005.005.005.005.005.00
Blood meal 12.002.002.002.002.002.00
Wheat flour 18.008.008.008.008.008.00
Tapioca starch5.005.005.005.005.005.00
Fish oil2.802.802.802.802.802.80
Soybean oil5.005.005.005.005.005.00
Calcium dihydrogen phosphate3.003.003.003.003.003.00
Premix 22.002.002.002.002.002.00
Choline chloride0.500.500.500.500.500.50
VC 3 (%)0.000.050.100.150.200.25
Microcrystalline cellulose0.250.200.150.100.050.00
L-Lysine 4 (98.5%)0.230.230.230.230.230.23
L-Methionine 40.110.110.110.110.110.11
Total100.00100.00100.00100.00100.00100.00
Analyzed proximate composition
Crude protein (%)48.8548.2648.8749.1148.6548.50
Crude lipid (%)12.7312.3212.0212.2412.0212.47
Actual VC content (g/kg)0.390.510.660.810.971.11
1 Fishmeal, crude protein 65.6%, crude lipid 9.5%; Chicken meal, crude protein 62.00%, crude lipid 9.00%; Soy concentrated protein, crude protein 63.00%, crude lipid 4.10%; Soybean meal, crude protein 46.00%, crude lipid 4.25%; Wheat gluten, crude protein 80.00%, crude lipid 2.00%; Blood meal, crude protein 91.45%; Wheat flour, crude protein 13.1%, crude lipid 4.0%. They are provided from Biomar Tongwei (Wuxi) Biotech Co., Ltd. 2 Premixes are provided by China Wuxi Hanover Animal Health Products Co. 3 VC purchased from Biomar Tongwei (Wuxi) Biotech Co. 4 L-Lysine and L-Methionine were obtained from Feeer Co., Ltd., Shanghai, China.
Table 2. Formulae for calculating relevant growth properties.
Table 2. Formulae for calculating relevant growth properties.
ItemsFull NameComputational Formula
IBW (g)initial body weight (g)Total weight (g)/number of fish per bucket at the start of the culture
FBW (g)final body weight (g)Total weight (g)/number of fish per bucket at the end of the culture
FCRfeed conversion ratiodry feed fed (g)/(final body weight (g) − initial body weight (g))
WGR (%)weight gain rate (%)100 × (final body weight (g) − initial body weight (g))/initial body weight (g)
SGR (%/day)specific growth rate (%/day)100 × [(Ln (final body weight (g)) − Ln(initial body weight (g)))/days]
SR (%)survival rate (%)100 × (survival fish number/total fish number)
Table 3. Reference table of experimental methods, kits and experimental equipment.
Table 3. Reference table of experimental methods, kits and experimental equipment.
ItemsMethodsAssay Kits/Testing Equipment
Composition of diets/whole body
MoistureDrying method (ID 920.36)Electric blast drying oven (Shanghai Yiheng Scientific Instrument Co., Ltd., Shanghai, China)
ProteinKjeldahl (ID984.13)Auto kieldahl apparatus: Hanon K1100 (Jinan Hanon Instruments Co., Ltd., Jinan, China).
LipidSoxhlet (ID 991.36)Auto fat analyzer: Hanon SOX606 (Jinan Hanon Instruments Co., Ltd., Jinan, China)
AshCombustion (ID 923.03)Muffle: XL-2A (Hangzhou Zhuochi Instrument Co., Ltd., Hangzhou, China).
Plasma parameters
ALT
AST		International
Federation of
Clinical Chemistry
recommended		Assay kits (ALT: 105-000442-00.AST: 15-00443-000 purchased from
Mindray Medical International Ltd. (Shenzhen, China); Mindray BS 400 automatic biochemical analyzer (Mindray Medical International Ltd., Shenzhen, China).
Plasma parameters related antioxidant capacity
MDATBA method Ammonium
CATMolybdenum acid methodAssay kits (MDA: A003-1-2. CAT: A007-1-1. SOD: A001-3-2. GSH:A006-1-1. GPx: A005-1-2.T-AOC:A015-2-1)
purchased from Jian Cheng Bioengineering Institute (Nanjing, China); Spectrophotometer (Thermo Fisher Multiskan GO, Shanghai, China).
SODWST-1 method
GSHMicroplate method
GSH-PxColorimetric method
T-AOCABTS method
Note: ALT, alanine aminotransferase; AST, aspartate aminotransferase. MDA, malondialdehyde; CAT, catalase; SOD, superoxide dismutase; GSH, glutathione; GSH-Px, glutathione peroxidase; T-AOC, total antioxidant capacity.
Table 4. All primers and internal references used in the experiment.
Table 4. All primers and internal references used in the experiment.
GenesForward (5′-3′)Reverse (5′-3′)Primer Source
nrf2CACAGCAGCAGCAGGAAAAGAAGATGCTGCCGTCTGTTGAXM_038720536.1
keap1CGTACGTCCAGGCCTTACTCTGACGGAAATAACCCCCTGCXP_018520553.1
catCTATGGCTCTCACACCTTCTCCTCTACTGGCAGATTCTMK614708.1
sodGGTGTTTAAAGCCGTTTGTGTTCCTCTGATTTCTCCTGTCACCTXM_038708943.1
gpxATGGCTCTCATGACTGATCCAAAGACCAACCAGGAACTTCTCAAAXM_038697220.1
nf-κbAGAAGACGACTCGGGGATGAGCTTCTGCAGGTTCTGGTCTXM_038699793.1
tgf-βCACCAAGGAGATGCTGATTCGTATGTTAGAGATGCTGAAGXM_038693206.1
il-10CGGCACAGAAATCCCAGAGCCAGCAGGCTCACAAAATAAACATCTXM_038696252.1
tnf-αCTTCGTCTACAGCCAGGCATCGTTTGGCACACCGACCTCACCXM_038710731.1
il-8GAGGGTACATGTCTGGGGGACCTTGAAGGTTTGTTCTTCATCGTXM_038713529.1
baxACTTTGGATTACCTGCGGGATGCCAGAAATCAGGAGCAGARef. [36]
bcl-2TGTGGGGCTACTTTTTGGCATTCGACTGCCACCCCAATACRef. [37]
caspase3GAGGCGATGGACAAGAGTCACACAGACGAATGAAGCGTGGXM_038713063.1
caspase8GAGACAGACAGCAGACAACCATTCCATTTCAGCAAACACATCRef. [38]
caspase9CTGGAATGCCTTCAGGAGACGGGGGGAGGGGCAAGACAACAGGGTGRef. [36]
β-actionGGTGTGATGGTTGGTATGGCTCGTTGTAGAAGGTGTGATMH018565.1
Note: Mean values and standard error (±SE; n = 3 × 3) are presented for each parameter. nrf2, nuclear factor erythroid 2-related factor 2; keap1, recombinant kelch like ech associated protein 1; cat, catalase; sod, superoxide dismutase; gpx, glutathione peroxidase; nf-κb, nuclear factor kappa-β; tgf-β, transforming growth factor-β; il-10, interleukin-10; tnf-α, tumor necrosis factor-α; il-8, interleukin-8; bax, bcl-2-associated x protein; bcl-2, b-cell lymphoma-2; caspase3, caspase8 and caspase9 belong to cysteine aspartic acid specific proteases; β-action, beta-actin.
Table 5. Impact of VC supplementation in low fishmeal feeds on M. salmoides growth performance.
Table 5. Impact of VC supplementation in low fishmeal feeds on M. salmoides growth performance.
Diets (VC mg/kg)IBW (g)FBW (g)FCRWGR(%)SGR (%/Day)SR (%)
VC12.22 ± 0.0041.16 ± 0.20 a0.72 ± 0.01 c1758.10 ± 8.87 a4.87 ± 0.01 a96.70 ± 1.67
VC22.22 ± 0.0144.35 ± 0.55 b0.69 ± 0.01 a1897.50 ± 22.25 b4.99 ± 0.02 b100.00 ± 0.00
VC32.22 ± 0.0147.22 ± 1.14 c0.71 ± 0.01 c2025.20 ± 46.73 c5.09 ± 0.04 c96.70 ± 1.67
VC42.22 ± 0.0047.24 ± 0.19 c0.72 ± 0.00 c2032.80 ± 5.97 c5.10 ± 0.00 c98.30 ± 1.67
VC52.21 ± 0.0143.97 ± 0.48 b0.68 ± 0.00 ab1889.40 ± 21.64 b4.98 ± 0.02 b100.00 ± 0.00
VC62.21 ± 0.0042.90 ± 0.36 ab0.68 ± 0.00 ab1844.10 ± 15.41 b4.95 ± 0.01 b98.30 ± 1.67
Note: Mean values and standard error (±SE) are presented for each parameter. The results of this data analysis are presented as mean ± standard error (Mean ± S.E.). Values with distinct alphabetical superscripts differ significantly (p < 0.05).
Table 6. Impact of different VC addition levels on whole fish body composition of M. salmoides (dry weight; %).
Table 6. Impact of different VC addition levels on whole fish body composition of M. salmoides (dry weight; %).
Diets (VC mg/kg)Moisture (%)Lipid (%)Ash (%)Protein (%)
VC169.58 ± 0.199.77 ± 0.233.04 ± 0.1816.79 ± 0.19
VC269.48 ± 0.499.47 ± 0.683.12 ± 0.1816.84 ± 0.19
VC369.35 ± 0.469.56 ± 0.373.03 ± 0.1216.56 ± 0.09
VC469.17 ± 0.629.82 ± 0.753.13 ± 0.1517.39 ± 0.35
VC569.35 ± 0.399.45 ± 0.413.26 ± 0.0317.29 ± 0.48
VC669.49 ± 0.2010.59 ± 0.373.11 ± 0.0616.46 ± 0.25
Note: Mean values and standard error (±SE; n = 3 × 3) are presented for each parameter.
Table 7. Effects of different VC addition levels on apoptosis in M. salmoides gills after heat stress.
Table 7. Effects of different VC addition levels on apoptosis in M. salmoides gills after heat stress.
DietsVC1VC2VC3VC4VC5VC6
Red Positive Cells%0.45 ± 0.01 c0.43 ± 0.02 c0.19 ± 0.02 a0.17 ± 0.04 a0.28 ± 0.02 b0.36 ± 0.05 bc
Red Positive Cells Density,
number/104 pixels		0.25 ± 0.02 b0.20 ± 0.03 ab0.21 ± 0.01 ab0.17 ± 0.04 a0.19 ± 0.01 ab0.22 ± 0.00 ab
Red Mean Density0.55 ± 0.06 b0.50 ± 0.04 ab0.49 ± 0.06 ab0.37 ± 0.03 a0.44 ± 0.01 ab0.39 ± 0.03 a
Note: Mean values and standard error (±SE; n = 3 × 3) are presented for each parameter. Red Positive Cells% = Red Cells Amount/Total Cells Amount; Red Positive Cells Density (number/104 pixels) = Red Cells Amount/issue Area (pixel); Red Mean Density = Red Positive Density/Red Positive Area (pixel). Values with distinct alphabetical superscripts differ significantly (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhao, S.; Liang, H.; Chen, X.; Zhang, L.; Huang, D.; Wang, Y.; Cheng, Z.; Ren, M. Optimizing Low Fishmeal Diets with Vitamin C Supplementation: A Comprehensive Study on Growth, Immunity, and Heat Stress Resistance in Largemouth Bass (Micropterus salmoides) Juveniles. Antioxidants 2025, 14, 1175. https://doi.org/10.3390/antiox14101175

AMA Style

Zhao S, Liang H, Chen X, Zhang L, Huang D, Wang Y, Cheng Z, Ren M. Optimizing Low Fishmeal Diets with Vitamin C Supplementation: A Comprehensive Study on Growth, Immunity, and Heat Stress Resistance in Largemouth Bass (Micropterus salmoides) Juveniles. Antioxidants. 2025; 14(10):1175. https://doi.org/10.3390/antiox14101175

Chicago/Turabian Style

Zhao, Shengqi, Hualiang Liang, Xiaoru Chen, Lu Zhang, Dongyu Huang, Yongli Wang, Zhenyan Cheng, and Mingchun Ren. 2025. "Optimizing Low Fishmeal Diets with Vitamin C Supplementation: A Comprehensive Study on Growth, Immunity, and Heat Stress Resistance in Largemouth Bass (Micropterus salmoides) Juveniles" Antioxidants 14, no. 10: 1175. https://doi.org/10.3390/antiox14101175

APA Style

Zhao, S., Liang, H., Chen, X., Zhang, L., Huang, D., Wang, Y., Cheng, Z., & Ren, M. (2025). Optimizing Low Fishmeal Diets with Vitamin C Supplementation: A Comprehensive Study on Growth, Immunity, and Heat Stress Resistance in Largemouth Bass (Micropterus salmoides) Juveniles. Antioxidants, 14(10), 1175. https://doi.org/10.3390/antiox14101175

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop