Study on the In Vitro and In Vivo Antioxidant Activity and Potential Mechanism of Polygonum viviparum L.
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials and Reagents
2.2. Preparation of PV
2.3. Detection of In Vitro Antioxidant Activity
2.3.1. DPPH Radical Scavenging Ability
2.3.2. Hydroxyl Radical Scavenging Ability
2.3.3. Ferrous Ion Chelating Ability
2.3.4. Ferric Reducing Power
2.4. Detection of In Vivo Antioxidant Activity
2.4.1. Animals
2.4.2. Establishment of Diarrhea Model in Rats
2.4.3. Detection of Antioxidant Indexes in Intestinal Tissue
2.5. Detection of Intracellular Antioxidant Activity
2.5.1. Cell Culture
2.5.2. Cell Viability Assay
2.5.3. Detection of Cellular ROS Production
2.6. Network Pharmacology Analysis
2.6.1. Active Ingredients of PV
2.6.2. Common Targets Between Drug and Disease
2.6.3. Protein–Protein Interaction Network
2.6.4. GO and KEGG Pathway Enrichment
2.7. Detection of mRNA Expression
2.8. Western Blotting Analysis
2.9. Statistical Analysis
3. Results
3.1. In Vitro Antioxidant Activity of PV
3.2. In Vivo Antioxidant Activity of PV
3.2.1. Effect of PV on Body Weight and Thymus Index of Diarrhea Rats
3.2.2. Effect of PV on Antioxidant Enzyme Activity of Diarrhea Rats
3.3. Intracellular Antioxidant Activity of PV
3.3.1. Effect of PV on the Viability of RAW264.7 Cells
3.3.2. Effect of PV on Intracellular ROS Production
3.4. Results of Network Pharmacology Analysis
3.4.1. Screening of Bioactive Components of PV
3.4.2. Screening of Common Targets Between Bioactive Components of PV and Diseases
3.4.3. Analyses of GO Enrichment and KEGG Pathway Enrichment
3.4.4. Construction of PPI Network
3.5. mRNA Expression Levels of Antioxidant-Related Targets of PV
3.6. Protein Expression Levels of Antioxidant-Related Targets of PV
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Ungvari, Z.; Bagi, Z.; Feher, A.; Recchia, F.A.; Sonntag, W.E.; Pearson, K.; de Cabo, R.; Csiszar, A. Resveratrol confers endothelial protection via activation of the antioxidant transcription factor Nrf2. Am. J. Physiol. Heart Circ. Physiol. 2010, 299, H18–H24. [Google Scholar] [CrossRef] [PubMed]
- Ramalingam, V.; Rajendran, R. A paradoxical role of reactive oxygen species in cancer signaling pathway: Physiology and pathology. Process Biochem. 2021, 100, 69–81. [Google Scholar] [CrossRef]
- Schieber, M.; Chandel, N. Ros function in redox signaling and oxidative stress. Curr. Biol. 2014, 24, R453–R462. [Google Scholar] [CrossRef]
- Carvalho, M.J.; Pedrosa, S.S.; Mendes, A.; Azevedo-Silva, J.; Fernandes, J.; Pintado, M.; Oliveira, A.L.S.; Madureira, A.R. Anti-Aging Potential of a Novel Ingredient Derived from Sugarcane Straw Extract (SSE). Int. J. Mol. Sci. 2023, 25, 21. [Google Scholar] [CrossRef] [PubMed]
- Kong, X.Q.; Sha, Y.Y.; Xiang, M.H. Research progress on the role of oxidative stress and antioxidants in natural foods in dry eye. New Adv. Ophthalmol. 2024, 44, 235–238. [Google Scholar]
- Chakrabarty, N.; Chung, H.J.; Alam, R.; Emon, N.U.; Alam, S.; Kabir, M.F.; Islam, M.M.; Hong, S.T.; Sarkar, T.; Sarker, M.M.R.; et al. Chemico-Pharmacological Screening of the Methanol Extract of Gynura nepalensis D.C. Deciphered Promising Antioxidant and Hepatoprotective Potentials: Evidenced from in vitro, in vivo, and Computer-Aided Studies. Molecules 2022, 27, 3474. [Google Scholar] [CrossRef] [PubMed]
- Petersen, P.M. Variation of the population structure of Polygonum viviparum L. in relation to certain environmental conditions. Meddelelser Gronl. 1981, 4, 3–19. [Google Scholar] [CrossRef]
- Qian, Z.M.; Cheng, X.J.; Wang, Q.; Huang, Q.; Jin, L.L.; Ma, Y.F.; Xie, J.S.; Li, D.Q. On-line pre-column FRAP-based antioxidant reaction coupled with HPLC-DAD-TOF/MS for rapid screening of natural antioxidants from different parts of Polygonum viviparum. RSC Adv. 2023, 13, 9585–9594. [Google Scholar] [CrossRef]
- Pharmacopoeia Commission of the People’s Republic of China. Pharmaceutical Standards of the Ministry of Health of the People’s Republic of China—Volume 1 of Tibetan Medicine; People’s Health Press: Beijing, China, 1995; p. 75. [Google Scholar]
- Chang, M.L.; Chang, J.S.; Yu, W.Y.; Cheah, K.P.; Li, J.S.; Cheng, H.W.; Hu, C.M. Polygonum viviparum L. induces vasorelaxation in the rat thoracic aorta via activation of nitric oxide synthase in endothelial cells. BMC Complement. Altern. Med. 2014, 14, 150–158. [Google Scholar] [CrossRef]
- Cheng, H.W.; Lee, K.C.; Cheah, K.P.; Chang, M.L.; Lin, C.W.; Li, J.S.; Yu, W.Y.; Liu, E.T.; Hu, C.M. Polygonum viviparum L. inhibits the lipopolysaccharide-induced inflammatory response in RAW264.7 macrophages through haem oxygenase-1 induction and activation of the Nrf2 pathway. J. Sci. Food Agric. 2013, 93, 491–497. [Google Scholar] [CrossRef] [PubMed]
- Shi, G.; Kim, H.; Koo, S. Oxo-Carotenoids as Efficient Superoxide Radical Scavengers. Antioxidants 2022, 11, 1525. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Guo, R.; Liang, X.; Ji, Y.; Zhang, J.; Gai, G.; Guo, Z. Preparation and Antioxidant Activity of New Carboxymethyl Chitosan Derivatives Bearing Quinoline Groups. Mar. Drugs 2023, 21, 606. [Google Scholar] [CrossRef] [PubMed]
- Sierakowska, A.; Jasiewicz, B.; Piosik, Ł.; Mrówczyńska, L. New C8-substituted caffeine derivatives as promising antioxidants and cytoprotective agents in human erythrocytes. Sci. Rep. 2023, 13, 1785. [Google Scholar] [CrossRef] [PubMed]
- Parolia, S.; Maley, J.; Sammynaiken, R.; Green, R.; Nickerson, M.; Ghosh, S. Structure—Functionality of lentil protein-polyphenol conjugates. Food Chem. 2022, 367, 130603. [Google Scholar] [CrossRef] [PubMed]
- Jia, W.; He, X.; Jin, W.; Gu, J.; Yu, S.; He, J.; Yi, Z.; Cai, B.; Gao, H.; Yang, L. Ramulus Cinnamomi essential oil exerts an anti-inflammatory effect on RAW264.7 cells through N-acylethanolamine acid amidase inhibition. J. Ethnopharmacol. 2023, 317, 116747. [Google Scholar] [CrossRef]
- Zhou, T.Y.; Xiang, X.W.; Du, M.; Zhang, L.F.; Cheng, N.X.; Liu, X.L.; Zheng, B.; Wen, Z.S. Protective effect of polysaccharides of sea cucumber Acaudina leucoprocta on hydrogen peroxide-induced oxidative injury in RAW264.7 cells. Int. J. Biol. Macromol. 2019, 139, 1133–1140. [Google Scholar] [CrossRef]
- Mei, H.; Zhao, L.; Li, W.; Zheng, Z.; Tang, D.; Lu, X.; He, Y. Inhibition of ferroptosis protects House Ear Institute-Organ of Corti 1 cells and cochlear hair cells from cisplatin-induced ototoxicity. J. Cell. Mol. Med. 2020, 24, 12065–12081. [Google Scholar] [CrossRef]
- Rezaei-Sadabady, R.; Eidi, A.; Zarghami, N.; Barzegar, A. Intracellular ROS protection efficiency and free radical-scavenging activity of quercetin and quercetin-encapsulated liposomes. Artif. Cell. Nanomed. Biotechnol. 2016, 44, 128–134. [Google Scholar] [CrossRef]
- Kim, J.S. Antioxidant activity of Maillard reaction products derived from aqueous and ethanolic glucose-glycine and its oligomer solutions. Food Sci. Biotechnol. 2013, 22, 39–46. [Google Scholar] [CrossRef]
- Xiong, Q.P.; Li, X.; Zhou, R.Z.; Hao, H.R.; Li, S.L.; Jing, Y.; Zhu, C.; Zhang, Q.; Shi, Y. Extraction, characterization and antioxidant activities of polysaccharides from E. corneum gigeriae galli. Carbohydr. Polym. 2014, 108, 247–256. [Google Scholar] [CrossRef]
- Kim, J.H.; Nam, S.H.; Rico, C.W.; Kang, M.Y. A comparative study on the antioxidative and anti-allergic activities of fresh and aged black garlic extracts. Int. J. Food Sci. Technol. 2012, 47, 1176–1182. [Google Scholar] [CrossRef]
- Khedher, A.; Dhibi, S.; Bouzenna, H.; Akermi, S.; El Feki, A.; Teles, P.H.V.; Almeida, J.R.G.S.; Hfaiedh, N. Antiulcerogenic and antioxidant activities of Plantago ovata ethanolic extract in rats. Braz. J. Biol. 2022, 84, e255120. [Google Scholar] [CrossRef] [PubMed]
- Mokrani, A.; Madani, K. Effect of solvent, time and temperature on the extraction of phenolic compounds and antioxidant capacity of peach (Prunus persica L.) fruit. Sep. Purif. Technol. 2016, 162, 68–76. [Google Scholar] [CrossRef]
- Yang, C.; Jin, X.; Zhang, N.; Xue, L.Y.; Chen, Y.; Li, S.H. Preparation and Antioxidant Evaluation of Chlorogenic Acid Coffee. Food Res. Dev. 2023, 44, 140–145. [Google Scholar]
- Yang, J.; Liu, J.; Liang, J.; Li, F.; Wang, W.; Chen, H.; Xie, X. Epithelial-mesenchymal transition in age-associated thymic involution: Mechanisms and therapeutic implications. Ageing Res. Rev. 2023, 92, 102115. [Google Scholar] [CrossRef] [PubMed]
- Jodayree, S.; Patterson, Z.R.; Mackay, H.; Abizaid, A.B.; Tsopmo, A. Blood and liver antioxidant capacity of mice fed high fat diet supplemented with digested oat bran proteins. Int. J. Food Sci. Nutr. Eng. 2014, 4, 6. [Google Scholar]
- Yi, R.; Deng, L.; Mu, J.; Li, C.; Tan, F.; Zhao, X. The Impact of Antarctic Ice Microalgae Polysaccharides on D-Galactose-Induced Oxidative Damage in Mice. Front. Nutr. 2021, 8, 651088. [Google Scholar] [CrossRef]
- Baker, A.; Lin, C.C.; Lett, C.; Karpinska, B.; Wright, M.H.; Foyer, C.H. Catalase: A critical node in the regulation of cell fate. Free Radic. Biol. Med. 2023, 199, 56–66. [Google Scholar] [CrossRef] [PubMed]
- Balendra, V.; Singh, S.K. Therapeutic potential of astaxanthin and superoxide dismutase in Alzheimer’s disease. Open Biol. 2021, 11, 210013. [Google Scholar] [CrossRef]
- Mas-Bargues, C.; Escrivá, C.; Dromant, M.; Borrás, C.; Viña, J. Lipid peroxidation as measured by chromatographic determination of malondialdehyde. Human plasma reference values in health and disease. Arch. Biochem. Biophys. 2021, 709, 108941. [Google Scholar] [CrossRef] [PubMed]
- Wetzels, S.; Wouters, K.; Schalkwijk, C.G.; Vanmierlo, T.; Hendriks, J.J. Methylglyoxal-Derived Advanced Glycation Endproducts in Multiple Sclerosis. Int. J. Mol. Sci. 2017, 18, 421. [Google Scholar] [CrossRef]
- Averill-Bates, D.A. The antioxidant glutathione. Vitam. Horm. 2023, 121, 109–141. [Google Scholar] [PubMed]
- Aboushousha, R.; van der Velden, J.; Hamilton, N.; Peng, Z.; MacPherson, M.; Erickson, C.; White, S.; Wouters, E.F.M.; Reynaert, N.L.; Seward, D.J.; et al. Glutaredoxin attenuates glutathione levels via deglutathionylation of Otub1 and subsequent destabilization of system xC. Sci. Adv. 2023, 9, eadi5192. [Google Scholar] [CrossRef]
- Zhang, L.X.; Sun, X.M.; Jia, Y.B.; Liu, X.G.; Dong, M.D.; Xu, Z.P.; Liu, R.T. Nanovaccine’s rapid induction of anti-tumor immunity significantly improves malignant cancer immunotherapy. Nano Today 2020, 35, 100923. [Google Scholar] [CrossRef]
- Hajam, Y.A.; Rani, R.; Ganie, S.Y.; Sheikh, T.A.; Javaid, D.; Qadri, S.S.; Pramodh, S.; Alsulimani, A.; Alkhanani, M.F.; Harakeh, S.; et al. Oxidative Stress in Human Pathology and Aging: Molecular Mechanisms and Perspectives. Cells 2022, 11, 552. [Google Scholar] [CrossRef] [PubMed]
- García-Sánchez, A.; Miranda-Díaz, A.G.; Cardona-Muñoz, E.G. The Role of Oxidative Stress in Physiopathology and Pharmacological Treatment with Pro- and Antioxidant Properties in Chronic Diseases. Oxid. Med. Cell. Longev. 2020, 2020, 2082145. [Google Scholar] [CrossRef] [PubMed]
- Stavely, R.; Ott, L.C.; Sahakian, L.; Rashidi, N.; Sakkal, S.; Nurgali, K. Oxidative Stress and Neural Dysfunction in Gastrointestinal Diseases: Can Stem Cells Offer a Solution? Stem Cells Transl. Med. 2023, 12, 801–810. [Google Scholar] [CrossRef]
- Liang, B.; Zhu, Y.C.; Lu, J.; Gu, N. Effects of Traditional Chinese Medication-Based Bioactive Compounds on Cellular and Molecular Mechanisms of Oxidative Stress. Oxid. Med. Cell. Longev. 2021, 2021, 3617498. [Google Scholar] [CrossRef] [PubMed]
- Akbari, B.; Baghaei-Yazdi, N.; Bahmaie, M.; Mahdavi Abhari, F. The role of plant-derived natural antioxidants in reduction of oxidative stress. Biofactors 2022, 48, 611–633. [Google Scholar] [CrossRef] [PubMed]
- Qian, Z.M.; Chen, L.; Wu, M.Q.; Li, D.Q. Rapid screening and characterization of natural antioxidants in Polygonum viviparum by an on-line system integrating the pressurised liquid micro-extraction, HPLC-DAD-QTOF-MS/MS analysis and antioxidant assay. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 2020, 1137, 121926. [Google Scholar] [CrossRef] [PubMed]
- Fu, Z.L.; Yang, Y.; Ma, L.; Malmuthuge, N.; Guan, L.L.; Bu, D.P. Dynamics of oxidative stress and immune responses in neonatal calves during diarrhea. J. Dairy Sci. 2024, 107, 1286–1298. [Google Scholar] [CrossRef]
- Poeta, M.; Cioffi, V.; Tarallo, A.; Damiano, C.; Lo Vecchio, A.; Bruzzese, E.; Parenti, G.; Guarino, A. Postbiotic Preparation of Lacticaseibacillus rhamnosus GG against Diarrhea and Oxidative Stress Induced by Spike Protein of SARS-CoV-2 in Human Enterocytes. Antioxidants 2023, 12, 1878. [Google Scholar] [CrossRef]
- Zeeshan, M.; Atiq, A.; Ain, Q.U.; Ali, J.; Khan, S.; Ali, H. Evaluating the mucoprotective effects of glycyrrhizic acid-loaded polymeric nanoparticles in a murine model of 5-fluorouracil-induced intestinal mucositis via suppression of inflammatory mediators and oxidative stress. Inflammopharmacology 2021, 29, 1539–1553. [Google Scholar] [CrossRef] [PubMed]
- Song, P.; Zhang, R.; Wang, X.; He, P.; Tan, L.; Ma, X. Dietary grape-seed procyanidins decreased postweaning diarrhea by modulating intestinal permeability and suppressing oxidative stress in rats. J. Agric. Food Chem. 2011, 59, 6227–6232. [Google Scholar] [CrossRef] [PubMed]
- Forman, H.J.; Zhang, H. Targeting oxidative stress in disease: Promise and limitations of antioxidant therapy. Nat. Rev. Drug Discov. 2021, 20, 689–709. [Google Scholar] [CrossRef]
- Guan, G.; Lan, S. Implications of Antioxidant Systems in Inflammatory Bowel Disease. Biomed Res. Int. 2018, 2018, 1290179. [Google Scholar] [CrossRef] [PubMed]
- Mirończuk-Chodakowska, I.; Witkowska, A.M.; Zujko, M.E. Endogenous non-enzymatic antioxidants in the human body. Adv. Med. Sci. 2018, 63, 68–78. [Google Scholar] [CrossRef]
- Nogales, C.; Mamdouh, Z.M.; List, M.; Kiel, C.; Casas, A.I.; Schmidt, H.H.H.W. Network pharmacology: Curing causal mechanisms instead of treating symptoms. Trends Pharmacol. Sci. 2022, 43, 136–150. [Google Scholar] [CrossRef]
- Pfeiffer, A.; Schneider, J.; Bueno, D.; Dolga, A.; Voss, T.D.; Lewerenz, J.; Wüllner, V.; Methner, A. Bcl-xL knockout attenuates mitochondrial respiration and causes oxidative stress that is compensated by pentose phosphate pathway activity. Free Radic. Biol. Med. 2017, 112, 350–359. [Google Scholar] [CrossRef]
- Park, H.A.; Broman, K.; Jonas, E.A. Oxidative stress battles neuronal Bcl-xL in a fight to the death. Neural Regen. Res. 2021, 16, 12–15. [Google Scholar] [CrossRef] [PubMed]
- Wu, G.J.; Wang, W.; Lin, Y.L.; Liu, S.H.; Chen, R.M. Oxidative stress-induced apoptotic insults to rat osteoblasts are attenuated by nitric oxide pretreatment via GATA-5-involved regulation of Bcl-XL gene expression and protein translocation. Arch. Toxicol. 2016, 90, 905–916. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Wei, L.; Li, Q.; Lai, Y. HIF-1α protects osteoblasts from ROS-induced apoptosis. Free Radic. Res. 2022, 56, 143–153. [Google Scholar] [CrossRef]
- Mukherjee, U.; Samanta, A.; Biswas, S.; Ghosh, S.; Das, S.; Banerjee, S.; Maitra, S. Chronic exposure to nonylphenol induces oxidative stress and liver damage in male zebrafish (Danio rerio): Mechanistic insight into cellular energy sensors, lipid accumulation and immune modulation. Chem. Biol. Interact. 2022, 351, 109762. [Google Scholar] [CrossRef]
- Hazman, Ö.; Sarıova, A.; Bozkurt, M.F.; Ciğerci, İ.H. The anticarcinogen activity of β-arbutin on MCF-7 cells: Stimulation of apoptosis through estrogen receptor-α signal pathway, inflammation and genotoxicity. Mol. Cell. Biochem. 2021, 476, 349–360. [Google Scholar] [CrossRef]
- Yao, F.; Abdel-Rahman, A.A. Estrogen receptor ERα plays a major role in ethanol-evoked myocardial oxidative stress and dysfunction in conscious female rats. Alcohol 2016, 50, 27–35. [Google Scholar] [CrossRef]
- Liang, M.; Ye, S.; Jing, R.; Zhu, B.; Yuan, W.; Chu, X.; Li, Y.; Zhang, W. Estrogen receptor alpha-mediated mitochondrial damage in intrahepatic bile duct epithelial cells leading to the pathogenesis of primary biliary cholangitis. Environ. Toxicol. 2023, 38, 2803–2818. [Google Scholar] [CrossRef] [PubMed]
- Mahalingaiah, P.K.S.; Ponnusamy, L.; Singh, K.P. Chronic oxidative stress causes estrogen-independent aggressive phenotype, and epigenetic inactivation of estrogen. Breast Cancer Res. Treat. 2015, 153, 41–56. [Google Scholar] [CrossRef] [PubMed]
- Attah, O.C.; Umar, I.A.; Ameh, D.A.; Forcados, G.E.; Muhammad, A.; Sani, I. Kolaviron pre-treatment suppresses 7, 12 dimethylbenzanthracene-induced alterations in estrogen receptor-α, CYP 1A1, oxidative stress and inflammation in female Wistar rats. J. Food Biochem. 2022, 46, e13984. [Google Scholar] [CrossRef]
- Li, H.; Xu, W.; Liu, X.; Wang, T.; Wang, S.; Liu, J.; Jiang, H. JAK2 deficiency improves erectile function in diabetic mice through attenuation of oxidative stress, apoptosis, and fibrosis. Andrology 2021, 9, 1662–1671. [Google Scholar] [CrossRef]
- Comità, S.; Femmino, S.; Thairi, C.; Alloatti, G.; Boengler, K.; Pagliaro, P.; Penna, C. Regulation of STAT3 and its role in cardioprotection by conditioning: Focus on non-genomic roles targeting mitochondrial function. Basic Res. Cardiol. 2021, 116, 56. [Google Scholar] [CrossRef] [PubMed]
- Butturini, E.; Carcereri de Prati, A.; Mariotto, S. Redox Regulation of STAT1 and STAT3 Signaling. Int. J. Mol. Sci. 2020, 21, 7034. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Cheng, M.; Liang, X.; Chen, S.; Wang, M.; Zhang, X. JAK2/STAT3 involves oxidative stress-induced cell injury in N2a cells and a rat MCAO model. Int. J. Neurosci. 2020, 130, 1142–1150. [Google Scholar] [CrossRef]
- Xi, Y.; Hou, X.; Huang, Y.; Zhou, Y.; Chen, Y.; Wang, Y.; Cheng, H. Loganin attenuates the inflammation, oxidative stress, and apoptosis through the JAK2/STAT3 pathway in cerebral ischemia-reperfusion injury. J. Stroke Cerebrovasc. Dis. 2024, 34, 108114. [Google Scholar] [CrossRef]
- Zhong, Y.; Yin, B.; Ye, Y.; Dekhel, O.Y.A.T.; Xiong, X.; Jian, Z.; Gu, L. The bidirectional role of the JAK2/STAT3 signaling pathway and related mechanisms in cerebral ischemia-reperfusion injury. Exp. Neurol. 2021, 341, 113690. [Google Scholar] [CrossRef] [PubMed]
- Zhou, G.Y.; Yi, Y.X.; Jin, L.X.; Lin, W.; Fang, P.P.; Lin, X.Z.; Zheng, Y.; Pan, C.W. The protective effect of juglanin on fructose-induced hepatitis by inhibiting inflammation and apoptosis through TLR4 and JAK2/STAT3 signaling pathways in fructose-fed rats. Biomed. Pharmacother. 2016, 81, 318–328. [Google Scholar] [CrossRef]
- Zhao, X.; Zhao, B.; Zhao, Y.; Zhang, Y.; Qian, M. Protective effect of anisodamine on bleomycin-induced acute lung injury in immature rats via modulating oxidative stress, inflammation, and cell apoptosis by inhibiting the JAK2/STAT3 pathway. Ann. Transl. Med. 2021, 9, 859. [Google Scholar] [CrossRef]
- He, Z.; Liu, J.; Liu, Y. Daphnetin attenuates intestinal inflammation, oxidative stress, and apoptosis in ulcerative colitis via inhibiting REG3A-dependent JAK2/STAT3 signaling pathway. Environ. Toxicol. 2023, 38, 2132–2142. [Google Scholar] [CrossRef] [PubMed]
- Hughes, B.G.; Schulz, R. Targeting MMP-2 to treat ischemic heart injury. Basic Res. Cardiol. 2014, 109, 424. [Google Scholar] [CrossRef] [PubMed]
- Oda, T.; Gotoh, N.; Kasamatsu, T.; Handa, H.; Saitoh, T.; Sasaki, N. DNA damage-induced cellular senescence is regulated by 53BP1 accumulation in the nuclear foci and phase separation. Cell Prolif. 2023, 56, e13398. [Google Scholar] [CrossRef]
- Diwanji, N.; Bergmann, A. Basement membrane damage by ROS- and JNK-mediated Mmp2 activation drives macrophage recruitment to overgrown tissue. Nat. Commun. 2020, 11, 3631. [Google Scholar] [CrossRef]
- Nogueira, R.C.; Sanches-Lopes, J.M.; Oliveira-Paula, G.H.; Tanus-Santos, J.E. Inhibitors of gastric acid secretion increase oxidative stress and matrix metalloproteinase-2 activity leading to vascular remodeling. Mol. Cell. Biochem. 2024, 479, 3141–3152. [Google Scholar] [CrossRef]
- Bulboaca, A.E.; Boarescu, P.M.; Porfire, A.S.; Dogaru, G.; Barbalata, C.; Valeanu, M.; Munteanu, C.; Râjnoveanu, R.M.; Nicula, C.A.; Stanescu, I.C. The Effect of Nano-Epigallocatechin-Gallate on Oxidative Stress and Matrix Metalloproteinases in Experimental Diabetes Mellitus. Antioxidants 2020, 9, 172. [Google Scholar] [CrossRef] [PubMed]
- Deng, X.; Zhang, Y.; He, X.; Li, L.; Yue, Z.; Liang, Y.; Huang, Y. Effects of MMP2 and its inhibitor TIMP2 on DNA damage, apoptosis and senescence of human lens epithelial cells induced by oxidative stress. J. Bioenerg. Biomembr. 2024, 56, 619–630. [Google Scholar] [CrossRef] [PubMed]
Gene Symbol | Accession Number | Sequence (5′ → 3′) |
---|---|---|
β-actin | 11461 | (F) TGTTACCAACTGGGACGACA |
(R) GGGGTGTTGAAGGTCTCAAA | ||
MMP2 | 17390 | (F) GCAACGATGGAGGCACGAGTG |
(R) GGGAACTTGATGATGGGCGATGG | ||
STAT3 | 20848 | (F) CGGTTCAGTGAGAGCAGCAAGG |
(R) AGTGAGACAAGAGGAGCAGGTGAG | ||
ESR1 | 13982 | (F) CGCTCTGTGTTGGACTCTGTTAAGG |
(R) ATGGAGATGAAGACAATGGCTGGAAG | ||
JAK2 | 16452 | (F) ATGAGAAGGAGGAGGAGGAGGAG |
(R) TCTGAGGAACTAAGGACAGGTATGC | ||
BCL2L1 | 12048 | (F) TGGTCTTGCTGCTCCTCCTTG |
(R) CTGGTTGCTGTCTCGGTGAATG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, Z.; Man, J.; Liu, H.; Wu, D.; Gu, Q.; Zhang, H.; Liu, Y.; Shao, D.; Hao, B.; Wang, S. Study on the In Vitro and In Vivo Antioxidant Activity and Potential Mechanism of Polygonum viviparum L. Antioxidants 2025, 14, 41. https://doi.org/10.3390/antiox14010041
Yang Z, Man J, Liu H, Wu D, Gu Q, Zhang H, Liu Y, Shao D, Hao B, Wang S. Study on the In Vitro and In Vivo Antioxidant Activity and Potential Mechanism of Polygonum viviparum L. Antioxidants. 2025; 14(1):41. https://doi.org/10.3390/antiox14010041
Chicago/Turabian StyleYang, Zhen, Jingyuan Man, Haoyu Liu, Di Wu, Qiangwen Gu, Hongjuan Zhang, Yu Liu, Dan Shao, Baocheng Hao, and Shengyi Wang. 2025. "Study on the In Vitro and In Vivo Antioxidant Activity and Potential Mechanism of Polygonum viviparum L." Antioxidants 14, no. 1: 41. https://doi.org/10.3390/antiox14010041
APA StyleYang, Z., Man, J., Liu, H., Wu, D., Gu, Q., Zhang, H., Liu, Y., Shao, D., Hao, B., & Wang, S. (2025). Study on the In Vitro and In Vivo Antioxidant Activity and Potential Mechanism of Polygonum viviparum L. Antioxidants, 14(1), 41. https://doi.org/10.3390/antiox14010041