Ameliorative Effects of HT074-Inula and Paeonia Extract Mixture on Acute Reflux Esophagitis in Rats via Antioxidative Activity
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Sample Preparation
2.3. High-Performance Liquid Chromatography (HPLC) Analysis
2.4. Cell Culture
2.5. Cell Viability Assay
2.6. Determination of Nitric Oxide (NO) Production
2.7. RNA Extraction and Real Time PCR Analyses
2.8. Animal Management
2.9. RE Surgery Rat Models and Treatment
2.10. Determination of Gastric Acid pH
2.11. Esophageal Mucosal Lesion Ratio
2.12. Esophageal Histological Analysis
2.13. Western Blot
2.14. Statistical Analysis
3. Results
3.1. HPLC Analysis of HT074
3.2. Effect of HT074 on Cell Viability in RAW264.7 Macrophages
3.3. HT074 Attenuated LPS-Induced NO Production and Induced Antioxidant Gene Expression in RAW264.7 Macrophage Cells
3.4. Effects of HT074 on Esophageal Mucosal Lesion Ratio and pH of Gastric Contents Induced by Reflux Esophagitis (RE)
3.5. Effects of HT074 on Histological Changes in Esophagus Triggered by RE
3.6. HT074 Regulated Antioxidant Effect on Rat Esophageal Tissue
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
ANOVA | Analysis of variance |
CAT | Catalase |
CGA | Chlorogenic acid |
DAD | Diode array detector |
DMEM | Dulbecco’s modified Eagle medium |
DMSO | Dimethyl sulfoxide |
GER | Gastroesophageal reflux |
GERD | Gastroesophageal reflux disease |
GPx | Glutathione peroxidase |
H2 blockers | Type 2 histamine receptor antagonists |
H&E | Hematoxylin and eosin |
HPLC | High-performance liquid chromatography |
LPS | Lipopolysaccharide |
MTT | 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide |
NO | Nitric oxide |
Nrf2 | Nuclear factor erythroid 2-related factor 2 |
PBS | Phosphate-buffered saline |
PPIs | Proton pump inhibitors |
RE | Reflux esophagitis |
ROS | Reactive oxygen species |
SD | Standard deviation |
SOD | Superoxide dismutase |
References
- Vakil, N.; van Zanten, S.V.; Kahrilas, P.; Dent, J.; Jones, R.; Global Consensus, G. The Montreal definition and classification of gastroesophageal reflux disease: A global evidence-based consensus. Am. J. Gastroenterol. 2006, 101, 1900–1920, quiz 1943. [Google Scholar] [CrossRef]
- El-Serag, H.B.; Sweet, S.; Winchester, C.C.; Dent, J. Update on the epidemiology of gastro-oesophageal reflux disease: A systematic review. Gut 2014, 63, 871–880. [Google Scholar] [CrossRef]
- Jung, H.K. Epidemiology of gastroesophageal reflux disease in Asia: A systematic review. J. Neurogastroenterol. Motil. 2011, 17, 14–27. [Google Scholar] [CrossRef]
- Fujiwara, Y.; Higuchi, K.; Watanabe, Y.; Shiba, M.; Watanabe, T.; Tominaga, K.; Oshitani, N.; Matsumoto, T.; Nishikawa, H.; Arakawa, T. Prevalence of gastroesophageal reflux disease and gastroesophageal reflux disease symptoms in Japan. J. Gastroenterol. Hepatol. 2005, 20, 26–29. [Google Scholar] [CrossRef]
- Kahrilas, P.J.; Lee, T.J. Pathophysiology of gastroesophageal reflux disease. Thorac. Surg. Clin. 2005, 15, 323–333. [Google Scholar] [CrossRef]
- Fox, M.; Forgacs, I. Gastro-oesophageal reflux disease. BMJ 2006, 332, 88–93. [Google Scholar] [CrossRef]
- Tsuboi, K.; Hoshino, M.; Sundaram, A.; Yano, F.; Mittal, S.K. Role of the lower esophageal sphincter on esophageal acid exposure—A review of over 2000 patients. Trop. Gastroenterol. 2012, 33, 107–111. [Google Scholar] [CrossRef]
- Nelkine, L.; Vrolijk, M.F.; Drent, M.; Bast, A. Role of antioxidants in the treatment of gastroesophageal reflux disease-associated idiopathic pulmonary fibrosis. Curr. Opin. Pulm. Med. 2020, 26, 363–371. [Google Scholar] [CrossRef]
- Chiba, N.; De Gara, C.J.; Wilkinson, J.M.; Hunt, R.H. Speed of healing and symptom relief in grade II to IV gastroesophageal reflux disease: A meta-analysis. Gastroenterology 1997, 112, 1798–1810. [Google Scholar] [CrossRef]
- Chen, C.H.; Lin, C.L.; Kao, C.H. Gastroesophageal reflux disease with proton pump inhibitor use is associated with an increased risk of osteoporosis: A nationwide population-based analysis. Osteoporos. Int. 2016, 27, 2117–2126. [Google Scholar] [CrossRef]
- Malfertheiner, P.; Kandulski, A.; Venerito, M. Proton-pump inhibitors: Understanding the complications and risks. Nat. Rev. Gastroenterol. Hepatol. 2017, 14, 697–710. [Google Scholar] [CrossRef]
- Perisetti, A.; Goyal, H.; Tharian, B. The ‘burn’ of ranitidine recall: Current insights and mitigation strategies. Eur. J. Gastroenterol. Hepatol. 2021, 33, e1013–e1016. [Google Scholar] [CrossRef]
- Altomare, A.; Guarino, M.P.; Cocca, S.; Emerenziani, S.; Cicala, M. Gastroesophageal reflux disease: Update on inflammation and symptom perception. World J. Gastroenterol. 2013, 19, 6523–6528. [Google Scholar] [CrossRef]
- Wetscher, G.J.; Hinder, R.A.; Bagchi, D.; Hinder, P.R.; Bagchi, M.; Perdikis, G.; McGinn, T. Reflux esophagitis in humans is mediated by oxygen-derived free radicals. Am. J. Surg. 1995, 170, 552–556, discussion 556–557. [Google Scholar] [CrossRef]
- Deng, Y.; Pan, L.; Qian, W. Associations between the severity of reflux esophagitis in children and changes in oxidative stress, serum inflammation, vasoactive intestinal peptide and motilin. Exp. Ther. Med. 2019, 18, 3509–3513. [Google Scholar] [CrossRef]
- Del-Toro-Sánchez, C.L.; Rodríguez-Félix, F.; Cinco-Moroyoqui, F.J.; Juárez, J.; Ruiz-Cruz, S.; Wong-Corral, F.J.; Borboa-Flores, J.; Castro-Enríquez, D.D.; Barreras-Urbina, C.G.; Tapia-Hernández, J.A. Recovery of phytochemical from three safflower (Carthamus tinctorius L.) by-products: Antioxidant properties, protective effect of human erythrocytes and profile by UPLC-DAD-MS. J. Food Process. Preserv. 2021, 45, e15765. [Google Scholar] [CrossRef]
- Cho, J.H.; Yoon, H.; Shin, C.M.; Park, Y.S.; Kim, N.; Lee, D.H. Efficacy of DA-5204 (Stillen 2X) for patients with gastroesophageal reflux disease: A randomized, double-blind, placebo-controlled pilot study. Medicine 2020, 99, e22729. [Google Scholar] [CrossRef]
- Molina, V.; Valdes, S.; Carbajal, D.; Arruzazabala, L.; Menendez, R.; Mas, R. Antioxidant Effect of D-002 on Gastric Mucosa of Rats with Experimentally Induced Injury. J. Med. Food 2001, 4, 79–83. [Google Scholar] [CrossRef]
- Shimoyama, A.T.; Santin, J.R.; Machado, I.D.; de Oliveira e Silva, A.M.; de Melo, I.L.; Mancini-Filho, J.; Farsky, S.H. Antiulcerogenic activity of chlorogenic acid in different models of gastric ulcer. Naunyn Schmiedebergs Arch. Pharmacol. 2013, 386, 5–14. [Google Scholar] [CrossRef]
- Perez, Y.; Oyarzabal, A.; Mas, R.; Molina, V.; Jimenez, S. Protective effect of D-002, a mixture of beeswax alcohols, against indomethacin-induced gastric ulcers and mechanism of action. J. Nat. Med. 2013, 67, 182–189. [Google Scholar] [CrossRef]
- Zamora, Z.; Molina, V.; Mas, R.; Ravelo, Y.; Perez, Y.; Oyarzabal, A. Protective effects of D-002 on experimentally induced gastroesophageal reflux in rats. World J. Gastroenterol. 2014, 20, 2085–2090. [Google Scholar] [CrossRef]
- Huh, K.; Kwon, T.H.; Shin, U.S.; Kim, W.B.; Ahn, B.O.; Oh, T.Y.; Kim, J.A. Inhibitory effects of DA-9601 on ethanol-induced gastrohemorrhagic lesions and gastric xanthine oxidase activity in rats. J. Ethnopharmacol. 2003, 88, 269–273. [Google Scholar] [CrossRef]
- Oh, T.Y.; Lee, J.S.; Ahn, B.O.; Cho, H.; Kim, W.B.; Kim, Y.B.; Surh, Y.J.; Cho, S.W.; Hahm, K.B. Oxidative damages are critical in pathogenesis of reflux esophagitis: Implication of antioxidants in its treatment. Free Radic. Biol. Med. 2001, 30, 905–915. [Google Scholar] [CrossRef]
- Lee, J.A.; Shin, M.R.; Kim, M.J.; Lee, J.H.; Park, H.J.; Roh, S.S. Protective Effects of Inflammation of Curcumae Longae Rhizoma 30% EtOH Extract on Acute Reflux Esophagitis Rats. Biomed. Res. Int. 2021, 2021, 8854945. [Google Scholar] [CrossRef]
- Liu, S.; Liu, H.; Yan, W.; Zhang, L.; Bai, N.; Ho, C.T. Studies on 1-O-acetylbritannilactone and its derivative, (2-O-butyloxime-3-phenyl)-propionyl-1-O-acetylbritannilactone ester. Bioorg Med. Chem. Lett. 2004, 14, 1101–1104. [Google Scholar] [CrossRef]
- Zhang, W.; Dai, S.M. Mechanisms involved in the therapeutic effects of Paeonia lactiflora Pallas in rheumatoid arthritis. Int. Immunopharmacol. 2012, 14, 27–31. [Google Scholar] [CrossRef]
- Kim, Y.S.; Park, H.J.; Kim, H.; Song, J.; Lee, D. Gastroprotective Effects of Paeonia Extract Mixture HT074 against Experimental Gastric Ulcers in Rats. Evid. Based Complement. Alternat Med. 2019, 2019, 3546258. [Google Scholar] [CrossRef]
- Khan, A.L.; Hussain, J.; Hamayun, M.; Gilani, S.A.; Ahmad, S.; Rehman, G.; Kim, Y.H.; Kang, S.M.; Lee, I.J. Secondary metabolites from Inula britannica L. and their biological activities. Molecules 2010, 15, 1562–1577. [Google Scholar] [CrossRef]
- Yang, L.; Wang, X.; Hou, A.; Zhang, J.; Wang, S.; Man, W.; Yu, H.; Zheng, S.; Wang, Q.; Jiang, H.; et al. A review of the botany, traditional uses, phytochemistry, and pharmacology of the Flos Inulae. J. Ethnopharmacol. 2021, 276, 114125. [Google Scholar] [CrossRef]
- Kim, Y.S.; Lee, J.H.; Song, J.; Kim, H. Gastroprotective Effects of Inulae Flos on HCl/Ethanol-Induced Gastric Ulcers in Rats. Molecules 2020, 25, 5623. [Google Scholar] [CrossRef]
- Parker, S.; May, B.; Zhang, C.; Zhang, A.L.; Lu, C.; Xue, C.C. A Pharmacological Review of Bioactive Constituents of Paeonia lactiflora Pallas and Paeonia veitchii Lynch. Phytother. Res. 2016, 30, 1445–1473. [Google Scholar] [CrossRef] [PubMed]
- Bae, J.Y.; Kim, C.Y.; Kim, H.J.; Park, J.H.; Ahn, M.J. Differences in the chemical profiles and biological activities of Paeonia lactiflora and Paeonia obovata. J. Med. Food 2015, 18, 224–232. [Google Scholar] [CrossRef] [PubMed]
- Asai, M.; Kawashima, D.; Katagiri, K.; Takeuchi, R.; Tohnai, G.; Ohtsuka, K. Protective effect of a molecular chaperone inducer, paeoniflorin, on the HCl- and ethanol-triggered gastric mucosal injury. Life Sci. 2011, 88, 350–357. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.S.; Park, H.J.; Song, J.; Lee, D.; Kim, H. Anti-ulcer effects of HT074 on HCl/EtOH induced gastric injury. Kor. J. Herbol. 2018, 33, 9–18. [Google Scholar]
- Taciak, B.; Bialasek, M.; Braniewska, A.; Sas, Z.; Sawicka, P.; Kiraga, L.; Rygiel, T.; Krol, M. Evaluation of phenotypic and functional stability of RAW 264.7 cell line through serial passages. PLoS ONE 2018, 13, e0198943. [Google Scholar] [CrossRef] [PubMed]
- Elisia, I.; Pae, H.B.; Lam, V.; Cederberg, R.; Hofs, E.; Krystal, G. Comparison of RAW264.7, human whole blood and PBMC assays to screen for immunomodulators. J. Immunol. Methods 2018, 452, 26–31. [Google Scholar] [CrossRef] [PubMed]
- Chun, S.C.; Jee, S.Y.; Lee, S.G.; Park, S.J.; Lee, J.R.; Kim, S.C. Anti-inflammatory activity of the methanol extract of moutan cortex in LPS-activated Raw264.7 cells. Evid. Based Complement. Alternat Med. 2007, 4, 327–333. [Google Scholar] [CrossRef]
- Hussain, T.; Tan, B.; Yin, Y.; Blachier, F.; Tossou, M.C.; Rahu, N. Oxidative Stress and Inflammation: What Polyphenols Can Do for Us? Oxid. Med. Cell Longev. 2016, 2016, 7432797. [Google Scholar] [CrossRef]
- Xu, X.; Li, H.; Hou, X.; Li, D.; He, S.; Wan, C.; Yin, P.; Liu, M.; Liu, F.; Xu, J. Punicalagin Induces Nrf2/HO-1 Expression via Upregulation of PI3K/AKT Pathway and Inhibits LPS-Induced Oxidative Stress in RAW264.7 Macrophages. Mediators Inflamm. 2015, 2015, 380218. [Google Scholar] [CrossRef]
- Jabri, M.A.; Tounsi, H.; Rtibi, K.; Marzouki, L.; Sakly, M.; Sebai, H. Ameliorative and antioxidant effects of myrtle berry seed (Myrtus communis) extract during reflux-induced esophagitis in rats. Pharm. Biol. 2016, 54, 1575–1585. [Google Scholar] [CrossRef]
- Hirschowitz, B.I. A critical analysis, with appropriate controls, of gastric acid and pepsin secretion in clinical esophagitis. Gastroenterology 1991, 101, 1149–1158. [Google Scholar] [CrossRef]
- Omura, N.; Kashiwagi, H.; Chen, G.; Suzuki, Y.; Yano, F.; Aoki, T. Establishment of surgically induced chronic acid reflux esophagitis in rats. Scand. J. Gastroenterol. 1999, 34, 948–953. [Google Scholar] [CrossRef]
- Reimer, C.; Sondergaard, B.; Hilsted, L.; Bytzer, P. Proton-pump inhibitor therapy induces acid-related symptoms in healthy volunteers after withdrawal of therapy. Gastroenterology 2009, 137, 80–87, 87.e81. [Google Scholar] [CrossRef]
- Li, F.; Liu, H.; Zhang, L.; Huang, X.; Liu, Y.; Li, B.; Xu, C.; Lyu, J.; Yin, H. Effects of Gastric Acid Secretion Inhibitors for Ventilator-Associated Pneumonia. Front. Pharmacol. 2022, 13, 898422. [Google Scholar] [CrossRef]
- Peng, D.; Lu, H.; Zhu, S.; Zhou, Z.; Hu, T.; Chen, Z.; Zaika, A.; El-Rifai, W. NRF2 antioxidant response protects against acidic bile salts-induced oxidative stress and DNA damage in esophageal cells. Cancer Lett. 2019, 458, 46–55. [Google Scholar] [CrossRef]
- Itoh, K.; Wakabayashi, N.; Katoh, Y.; Ishii, T.; O’Connor, T.; Yamamoto, M. Keap1 regulates both cytoplasmic-nuclear shuttling and degradation of Nrf2 in response to electrophiles. Genes. Cells 2003, 8, 379–391. [Google Scholar] [CrossRef]
- Kwon, O.J.; Choo, B.K.; Lee, J.Y.; Kim, M.Y.; Shin, S.H.; Seo, B.I.; Seo, Y.B.; Rhee, M.H.; Shin, M.R.; Kim, G.N.; et al. Protective effect of Rhei Rhizoma on reflux esophagitis in rats via Nrf2-mediated inhibition of NF-kappaB signaling pathway. BMC Complement. Altern. Med. 2016, 16, 7. [Google Scholar] [CrossRef]
- Kim, S.H.; Shin, M.R.; Lee, A.R.; Seo, B.I.; Park, H.J.; Roh, S.S. Improvement of Inflammation through Antioxidant Pathway of Gardeniae Fructus 50% EtOH Extract (GE) from Acute Reflux Esophagitis Rats. Biomed. Res. Int. 2020, 2020, 4826176. [Google Scholar] [CrossRef]
- Bajpai, V.K.; Alam, M.B.; Quan, K.T.; Kwon, K.R.; Ju, M.K.; Choi, H.J.; Lee, J.S.; Yoon, J.I.; Majumder, R.; Rather, I.A.; et al. Antioxidant efficacy and the upregulation of Nrf2-mediated HO-1 expression by (+)-lariciresinol, a lignan isolated from Rubia philippinensis, through the activation of p38. Sci. Rep. 2017, 7, 46035. [Google Scholar] [CrossRef]
- Mates, J.M. Effects of antioxidant enzymes in the molecular control of reactive oxygen species toxicology. Toxicology 2000, 153, 83–104. [Google Scholar] [CrossRef]
- Pei, J.; Pan, X.; Wei, G.; Hua, Y. Research progress of glutathione peroxidase family (GPX) in redoxidation. Front. Pharmacol. 2023, 14, 1147414. [Google Scholar] [CrossRef] [PubMed]
- Jimenez, P.; Piazuelo, E.; Sanchez, M.T.; Ortego, J.; Soteras, F.; Lanas, A. Free radicals and antioxidant systems in reflux esophagitis and Barrett’s esophagus. World J. Gastroenterol. 2005, 11, 2697–2703. [Google Scholar] [CrossRef] [PubMed]
- Dong, M.; Hong, T.; Liu, S.; Zhao, J.; Meng, Y.; Mu, J. Hepatoprotective effect of the flavonoid fraction isolated from the flower of Inula britannica against D-Galactosamine-induced hepatic injury. Mol. Med. Rep. 2013, 7, 1919–1923. [Google Scholar] [CrossRef] [PubMed]
- Zangeneh, M.M.; Zangeneh, A.; Almasi, M.; Tahvilian, R.; Hosseini, F.; Moradi, R. A comparative study of hepatoprotective effect of Inula britannica L. aqueous extract and glibenclamide in streptozotocin-induced diabetic mice. Comp. Clin. Pathol. 2018, 27, 1649–1657. [Google Scholar] [CrossRef]
- Kim, S.R.; Park, M.J.; Lee, M.K.; Sung, S.H.; Park, E.J.; Kim, J.; Kim, S.Y.; Oh, T.H.; Markelonis, G.J.; Kim, Y.C. Flavonoids of Inula britannica protect cultured cortical cells from necrotic cell death induced by glutamate. Free Radic. Biol. Med. 2002, 32, 596–604. [Google Scholar] [CrossRef] [PubMed]
- Shin, M.R.; Lee, S.H.; Roh, S.S. The Potential Hepatoprotective Effect of Paeoniae Radix Alba in Thioacetamide-Induced Acute Liver Injury in Rats. Evid. Based Complement. Alternat Med. 2022, 2022, 7904845. [Google Scholar] [CrossRef]
- Xu, X.; Li, F.; Zhang, X.; Li, P.; Zhang, X.; Wu, Z.; Li, D. In vitro synergistic antioxidant activity and identification of antioxidant components from Astragalus membranaceus and Paeonia lactiflora. PLoS ONE 2014, 9, e96780. [Google Scholar] [CrossRef]
Research Objective/Test Model | Type of Study/ Species | Samples | Dose/Administration | Results/Mechanisms | Reference |
---|---|---|---|---|---|
Radical scavenging effects /DPPH, ABTS | In vitro | HT074 | 0–1000 μg/mL (DPPH) 20–20,000 μg/mL (ABTS) | DPPH, ABTS radial↓ | Kim et al. (2018) [34] |
PGE2 levels | In vitro/ AGS cell | HT074 | 50, 100, 200 μg/mL | PGE2 levels↑ | Kim et al. (2019) [27] |
Gastroprotection against HCl/EtOH | In vivo SD rats | HT074 | 30, 100, 300 mg/kg oral | Gastric lesions (100, 300 mg/kg)↓ Gastric wall mucus↑ mediated by endogenous sulfhydryl compounds | Kim et al. (2019) [27] |
Gastroprotection against HCl/EtOH | In vivo SD rats | HT074 | 100, 300 mg/kg oral | Gastric lesions↓ Gastric SOD, GSH, CAT levels ↑ MUC5AC mRNA expression↑ Gastric wall mucus↑ | Kim et al. (2018) [34] |
Gastroprotection against HCl/EtOH | In vivo SD rats | Inulae Flos extract | 100, 300 mg/kg, oral | Gastric lesions↓ SOD, GSH, CAT activities↑ MDA levels↓ PGE2 concentrations↑ | Kim et al. (2020) [30] |
Gastroprotection against HCl/EtOH | In vivo ICR mice | P. lactiflora extract | 10, 100 mg/kg, oral | Gastric lesions↓ NO production↓ | Bae et al. (2015) [32] |
Gastroprotection against water immersion restraint stress | In vivo/ SD rats | HT074 | 30, 100, 300 mg/kg | Gastric lesions (300 mg/kg)↓ | Kim et al. (2019) [27] |
Gastroprotection against indomethacin | In vivo/ SD rats | HT074 | 30, 100, 300 mg/kg | Gastric lesions (300 mg/kg)↓ | Kim et al. (2019) [27] |
Gastric secretion /Pylorus-ligation | In vivo/ SD rats | HT074 | 100, 300 mg/kg | Gastric volume↓ Acidity↓ Total acidity↓ | Kim et al. (2019) [27] |
Genes | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|
GAPDH | GGCACAGTCAAGGCTGAGAATG | ATGGTGGTGAAGACGCCAGTA |
SOD | TTCTGGACAAACCTGAGCCCTAA | GAACCTTGGACTCCCACAGACAC |
HO-1 | ATTTGTCCGAGGCCTTGAA | CCAGGGCCGTATAGATATGGTA |
CAT | CAGATGTGAAGCGCTTCAACAG | GTTGGCAATGTTCTCACACAGG |
GPx2 | TGCCCTACCCTTATGACGAC | TCGATGTTGATGGTCTGGAA |
Nrf2 | ATTGCCACCGCCAGGACTAC | CCAAGATCTATGTCTTGCCTCCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, Y.-S.; Park, Y.; Kim, Y.; Son, H.-E.; Rhee, J.; Pyun, C.-W.; Park, C.; Kim, H. Ameliorative Effects of HT074-Inula and Paeonia Extract Mixture on Acute Reflux Esophagitis in Rats via Antioxidative Activity. Antioxidants 2024, 13, 891. https://doi.org/10.3390/antiox13080891
Kim Y-S, Park Y, Kim Y, Son H-E, Rhee J, Pyun C-W, Park C, Kim H. Ameliorative Effects of HT074-Inula and Paeonia Extract Mixture on Acute Reflux Esophagitis in Rats via Antioxidative Activity. Antioxidants. 2024; 13(8):891. https://doi.org/10.3390/antiox13080891
Chicago/Turabian StyleKim, Young-Sik, Yeonjin Park, Yongbin Kim, Hyo-Eun Son, Jinhui Rhee, Chang-Won Pyun, Chanoh Park, and Hocheol Kim. 2024. "Ameliorative Effects of HT074-Inula and Paeonia Extract Mixture on Acute Reflux Esophagitis in Rats via Antioxidative Activity" Antioxidants 13, no. 8: 891. https://doi.org/10.3390/antiox13080891
APA StyleKim, Y.-S., Park, Y., Kim, Y., Son, H.-E., Rhee, J., Pyun, C.-W., Park, C., & Kim, H. (2024). Ameliorative Effects of HT074-Inula and Paeonia Extract Mixture on Acute Reflux Esophagitis in Rats via Antioxidative Activity. Antioxidants, 13(8), 891. https://doi.org/10.3390/antiox13080891