The Therapeutic Potential of Two Egyptian Plant Extracts for Mitigating Dexamethasone-Induced Osteoporosis in Rats: Nrf2/HO-1 and RANK/RANKL/OPG Signals
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals and Kits
2.2. Plant Sources and Preparation of Different Extracts
2.2.1. Preparation of Aqueous Chicory Root Extract (ACE)
2.2.2. Preparation of Ethanolic Purslane Leaf Extract (EPE)
2.3. In Vitro Analysis for Characterization of ACE and EPE
2.3.1. Total Phenolic Content
2.3.2. Total Flavonoid Content
2.3.3. Total Alkaloid Content
2.3.4. Inulin Content
2.3.5. HPLC Analysis of Phenolic and Flavonoid Compounds
2.3.6. Minerals Analysis in ACE and EPE
2.4. Antioxidant Properties of ACE, EPE, and Their Combination
2.4.1. 2,2-Diphenyl-1-picrylhydrazyl (DPPH) Scavenging Activity
2.4.2. Ferric Radical Antioxidant Power (FRAP)
2.4.3. Nitric Oxide (NO) Scavenging Activity
2.5. In Vivo Study
2.5.1. Animals
2.5.2. Model of GIO-Induced Bone Loss and Treatment
2.5.3. Blood and Tissue Collection and Their Preparation
2.5.4. Bone Mineral Content, Bone Mineral Density, and Bone Index
2.5.5. Biochemical analysis
- a.
- Determination of bone formation and bone turnover parameters
- b.
- Oxidative stress biomarkers
- Bone lipid peroxidation:
- Bone nitric oxide (NO):
- Bone glutathione-s-transferase (GST) activity (EC.2.5.1.18):
- Bone superoxide dismutase (SOD) activity (EC.1.15.1.1):
- Bone glutathione peroxidase (GPx) activity (EC.1.11.1.9):
- Bone reduced glutathione (GSH) level:
2.5.6. Molecular Analysis
- a.
- Isolation of total RNA and quantitative real-time PCR analysis (qRT-PCR)
- b.
- Western Blot Analysis
2.6. Combination Index Analysis
2.7. Histopathological Study
2.8. Statistical Analysis
3. Results
3.1. Characterization Analysis of ACE and EPE
3.2. In Vitro Antioxidant Properties of ACE, EPE, and Their Mixture
3.3. Bone Mineral Density (BMD), Bone Mineral Content (BMC), and Bone Index
3.4. The Effect of Different Treatments on Serum Ionized Ca and PTH Levels
3.5. The Effect of Different Treatments on Bone Growth and Bone Turnover Parameters
3.6. The Effect of Different Treatments on Bone Oxidative Stress Markers
3.7. The Effect of Different Treatments on the Protein Expression Levels of HO-1, Nrf2, NFATc1, and p-IKK
3.8. Histopathologic Outcomes and Morphometric Analysis of Experimental Groups’ Bone Tissues
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Akkawi, I.; Zmerly, H. Osteoporosis: Current concepts. Joints 2018, 6, 122–127. [Google Scholar] [CrossRef] [PubMed]
- Iantomasi, T.; Romagnoli, C.; Palmini, G.; Donati, S.; Falsetti, I.; Miglietta, F.; Aurilia, C.; Marini, F.; Giusti, F.; Brandi, M.L. Oxidative Stress and Inflammation in Osteoporosis: Molecular Mechanisms Involved and the Relationship with microRNAs. Int. J. Mol. Sci. 2023, 24, 3772. [Google Scholar] [CrossRef] [PubMed]
- Dhakal, K.S.; Dhakal, S.; Aryal, B. Prevalence of osteoporosis among middle aged women in Chitwan District of Nepal. Age 2010, 51, 12–65. [Google Scholar]
- Sarkar, M.; Bhardwaj, R.; Madabhavi, I.; Khatana, J. Osteoporosis in chronic obstructive pulmonary disease. Clin. Med. Insights Circ. Respir. Pulm. Med. 2015, 9, 5–21. [Google Scholar] [CrossRef] [PubMed]
- Lane, N.E. Glucocorticoid-induced osteoporosis: New insights into the pathophysiology and treatments. Curr. Osteoporos. Rep. 2019, 17, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Hildebrandt, S.; Baschant, U.; Thiele, S.; Tuckermann, J.; Hofbauer, L.C.; Rauner, M. Glucocorticoids suppress Wnt16 expression in osteoblasts in vitro and in vivo. Sci. Rep. 2018, 8, 8711. [Google Scholar] [CrossRef] [PubMed]
- Abdelfattah, M.A.; Mohamed, A.S.; Ibrahim, S.A.; Fahmy, S.R. Allolobophora caliginosa coelomic fluid and extract alleviate glucocorticoid-induced osteoporosis in mice by suppressing oxidative stress and regulating osteoblastic/osteoclastic-related markers. Sci. Rep. 2023, 13, 2090. [Google Scholar] [CrossRef]
- Wang, H.; Yang, L.; Chao, J. Antiosteoporosis and bone protective effect of dieckol against glucocorticoid-induced osteoporosis in rats. Front. Endocrinol. 2022, 13, 932488. [Google Scholar] [CrossRef]
- Huang, X.L.; Huang, L.Y.; Cheng, Y.T.; Li, F.; Zhou, Q.; Wu, C.; Shi, Q.H.; Guan, Z.Z.; Liao, J.; Hong, W. Zoledronic acid inhibits osteoclast differentiation and function through the regulation of NF-κB and JNK signalling pathways. Int. J. Mol. Med. 2019, 44, 582–592. [Google Scholar] [CrossRef]
- Saleh, S.R.; Ghareeb, D.A.; Masoud, A.A.; Sheta, E.; Nabil, M.; Masoud, I.M.; Maher, A.M. Phoenix dactilyfera L. Pits Extract Restored Bone Homeostasis in Glucocorticoid-Induced Osteoporotic Animal Model through the Antioxidant Effect and Wnt5a Non-Canonical Signaling. Antioxidants 2022, 11, 508. [Google Scholar] [CrossRef]
- Marcadet, L.; Bouredji, Z.; Argaw, A.; Frenette, J. The Roles of RANK/RANKL/OPG in Cardiac, Skeletal, and Smooth Muscles in Health and Disease. Front. Cell Dev. Biol. 2022, 10, 903657. [Google Scholar] [CrossRef] [PubMed]
- Florencio-Silva, R.; Sasso, G.R.d.S.; Sasso-Cerri, E.; Simões, M.J.; Cerri, P.S. Biology of bone tissue: Structure, function, and factors that influence bone cells. BioMed Res. Int. 2015, 2015, 421746. [Google Scholar] [CrossRef] [PubMed]
- Kobayashi, Y.; Uehara, S.; Udagawa, N. Roles of non-canonical Wnt signaling pathways in bone resorption. J. Oral Biosci. 2018, 60, 31–35. [Google Scholar] [CrossRef]
- Tobeiha, M.; Moghadasian, M.H.; Amin, N.; Jafarnejad, S. RANKL/RANK/OPG Pathway: A Mechanism Involved in Exercise-Induced Bone Remodeling. Biomed Res. Int. 2020, 2020, 6910312. [Google Scholar] [CrossRef] [PubMed]
- Kondo, T.; Kitazawa, R.; Yamaguchi, A.; Kitazawa, S. Dexamethasone promotes osteoclastogenesis by inhibiting osteoprotegerin through multiple levels. J. Cell. Biochem. 2008, 103, 335–345. [Google Scholar] [CrossRef]
- Xu, Y.; Guan, J.; Xu, J.; Chen, S.; Sun, G. Z-Guggulsterone attenuates glucocorticoid-induced osteoporosis through activation of Nrf2/HO-1 signaling. Life Sci. 2019, 224, 58–66. [Google Scholar] [CrossRef]
- Marques-Carvalho, A.; Kim, H.-N.; Almeida, M. The role of reactive oxygen species in bone cell physiology and pathophysiology. Bone Rep. 2023, 19, 101664. [Google Scholar] [CrossRef]
- Han, J.; Yang, K.; An, J.; Jiang, N.; Fu, S.; Tang, X. The Role of NRF2 in Bone Metabolism—Friend or Foe? Front. Endocrinol. 2022, 13, 813057. [Google Scholar] [CrossRef]
- Che, J.; Yang, X.; Jin, Z.; Xu, C. Nrf2: A promising therapeutic target in bone-related diseases. Biomed. Pharmacother. 2023, 168, 115748. [Google Scholar] [CrossRef]
- Priddy, C.; Li, J. The role of the Nrf2/Keap1 signaling cascade in mechanobiology and bone health. Bone Rep 2021, 15, 101149. [Google Scholar] [CrossRef]
- Florczyk-Soluch, U.; Józefczuk, E.; Stępniewski, J.; Bukowska-Strakova, K.; Mendel, M.; Viscardi, M.; Nowak, W.N.; Józkowicz, A.; Dulak, J. Various roles of heme oxygenase-1 in response of bone marrow macrophages to RANKL and in the early stage of osteoclastogenesis. Sci. Rep. 2018, 8, 10797. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.-X.; Xu, A.-H.; Yang, Y.; Li, J. Role of Nrf2 in bone metabolism. J. Biomed. Sci. 2015, 22, 101. [Google Scholar] [CrossRef] [PubMed]
- Yin, Y.; Corry, K.A.; Loughran, J.P.; Li, J. Moderate Nrf2 Activation by Genetic Disruption of Keap1 Has Sex-Specific Effects on Bone Mass in Mice. Sci. Rep. 2020, 10, 348. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Hu, S.-L.; Xie, J.; Yan, D.-Y.; Weng, S.-J.; Tang, J.-H.; Wang, B.-Z.; Xie, Z.-J.; Wu, Z.-Y.; Yang, L. Proanthocyanidins-mediated Nrf2 activation ameliorates glucocorticoid-induced oxidative stress and mitochondrial dysfunction in osteoblasts. Oxidative Med. Cell. Longev. 2020, 2020, 9102012. [Google Scholar] [CrossRef] [PubMed]
- Nandagopal, S.; Kumari, B.R. Phytochemical and antibacterial studies of Chicory (Cichorium intybus L.)-A multipurpose medicinal plant. Adv. Biol. Res. 2007, 1, 17–21. [Google Scholar]
- Perović, J.; Šaponjac, V.T.; Kojić, J.; Krulj, J.; Moreno, D.A.; García-Viguera, C.; Bodroža-Solarov, M.; Ilić, N. Chicory (Cichorium intybus L.) as a food ingredient–Nutritional composition, bioactivity, safety, and health claims: A review. Food Chem. 2021, 336, 127676. [Google Scholar] [CrossRef] [PubMed]
- Abbas, Z.K.; Saggu, S.; Sakeran, M.I.; Zidan, N.; Rehman, H.; Ansari, A.A. Phytochemical, antioxidant and mineral composition of hydroalcoholic extract of chicory (Cichorium intybus L.) leaves. Saudi J. Biol. Sci. 2015, 22, 322–326. [Google Scholar] [CrossRef]
- Saleh, S.R.; Manaa, A.; Sheta, E.; Ghareeb, D.A.; Abd-Elmonem, N.M. The Synergetic Effect of Egyptian Portulaca oleracea L. (Purslane) and Cichorium intybus L. (Chicory) Extracts against Glucocorticoid-Induced Testicular Toxicity in Rats through Attenuation of Oxidative Reactions and Autophagy. Antioxidants 2022, 11, 1272. [Google Scholar] [CrossRef]
- Roberfroid, M.; Gibson, G.R.; Hoyles, L.; McCartney, A.L.; Rastall, R.; Rowland, I.; Wolvers, D.; Watzl, B.; Szajewska, H.; Stahl, B. Prebiotic effects: Metabolic and health benefits. Br. J. Nutr. 2010, 104, S1–S63. [Google Scholar] [CrossRef]
- Okafor, I.; Ezejindu, D. Phytochemical studies on Portulaca oleracea (purslane) plant. GJBAHS 2014, 3, 132–136. [Google Scholar]
- Nemzer, B.; Al-Taher, F.; Abshiru, N. Phytochemical composition and nutritional value of different plant parts in two cultivated and wild purslane (Portulaca oleracea L.) genotypes. Food Chem. 2020, 320, 126621. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.; Wang, Y.; Liu, Y.; Xia, Y.; Tang, T. Analysis of flavonoids in Portulaca oleracea L. by UV–vis spectrophotometry with comparative study on different extraction technologies. Food Anal. Methods 2010, 3, 90–97. [Google Scholar] [CrossRef]
- Moraes-de-Souza, R.; Oldoni, T.; Regitano-d’Arce, M.; Alencar, S. Antioxidant activity and phenolic composition of herbal infusions consumed in brazil activid ad antioxidante y compuestos fenólicos en infusiones herbarias consumid as en Brasil. CYTA-J. Food 2008, 6, 41–47. [Google Scholar] [CrossRef]
- Lysiuk, R.; Hudz, N. Differential spectrophotometry: Application for quantification of flavonoids in herbal drugs and nutraceuticals. Int. J. Trends Food Nutr. 2017, 1, e102. [Google Scholar]
- Soni, A.; Sosa, S. Phytochemical analysis and free radical scavenging potential of herbal and medicinal plant extracts. J. Pharmacogn. Phytochem. 2013, 2, 22–29. [Google Scholar]
- Petkova, N.; Vrancheva, R.; Mihaylova, D.; Ivanov, I.; Pavlov, A.; Denev, P. Antioxidant activity and fructan content in root extracts from elecampane (Inula helenium L.). J. BioScience Biotechnol. 2015, 4, 101–107. [Google Scholar]
- Lin, Y.-L.; Juan, I.M.; Chen, Y.-L.; Liang, Y.-C.; Lin, J.-K. Composition of Polyphenols in Fresh Tea Leaves and Associations of Their Oxygen-Radical-Absorbing Capacity with Antiproliferative Actions in Fibroblast Cells. J. Agric. Food Chem. 1996, 44, 1387–1394. [Google Scholar] [CrossRef]
- Kuntić, V.; Pejić, N.; Ivković, B.; Vujić, Z.; Ilić, K.; Mićić, S.; Vukojević, V. Isocratic RP-HPLC method for rutin determination in solid oral dosage forms. J. Pharm. Biomed. Anal. 2007, 43, 718–721. [Google Scholar] [CrossRef]
- USEPA. Method 200.7: Trace Elements in Water, Solids, and Biosolids by Inductively Coupled Plasma-Atomic Emission Spectrometry; Rev. 5. EPA-821-R-01-010; USEPA, Office of Science and Technology: Washington, DC, USA, 2001. [Google Scholar]
- EPA/600/R-94/111; Method 200.7: Determination of Metals and Trace Elements in Water and Wastes by Inductively Coupled Plasma-Atomic Emission Spectrometry. Rev. 4.4 in Methods for the Determination of Metals in Environmental Samples-Supplement I’; USEPA Office of Research and Development: Washington, DC, USA, 1994.
- Manzocco, L.; Anese, M.; Nicoli, M.C. Antioxidant Properties of Tea Extracts as Affected by Processing. LWT—Food Sci. Technol. 1998, 31, 694–698. [Google Scholar] [CrossRef]
- Maitra, I.; Marcocci, L.; Droy-Lefaix, M.T.; Packer, L. Peroxyl radical scavenging activity of Ginkgo biloba extract EGb 761. Biochem. Pharmacol. 1995, 49, 1649–1655. [Google Scholar] [CrossRef]
- Marcocci, L.; Maguire, J.J.; Droylefaix, M.T.; Packer, L. The nitric oxide-scavenging properties of Ginkgo biloba extract EGb 761. Biochem. Biophys. Res. Commun. 1994, 201, 748–755. [Google Scholar] [CrossRef] [PubMed]
- Hozayen, W.G.; El-Desouky, M.A.; Soliman, H.A.; Ahmed, R.R.; Khaliefa, A.K. Antiosteoporotic effect of Petroselinum crispum, Ocimum basilicum and Cichorium intybus L. in glucocorticoid-induced osteoporosis in rats. BMC Complement. Altern. Med. 2016, 16, 165. [Google Scholar] [CrossRef] [PubMed]
- Smith, O.L.; Wong, C.Y.; Gelfand, R.A. Influence of glucocorticoids on skeletal muscle proteolysis in normal and diabetic-adrenalectomized eviscerated rats. Metabolism 1990, 39, 641–646. [Google Scholar] [CrossRef] [PubMed]
- Oršolić, N.; Goluža, E.; Đikić, D.; Lisičić, D.; Sašilo, K.; Rođak, E.; Jeleč, Ž.; Lazarus, M.V.; Orct, T. Role of flavonoids on oxidative stress and mineral contents in the retinoic acid-induced bone loss model of rat. Eur. J. Nutr. 2014, 53, 1217–1227. [Google Scholar] [CrossRef] [PubMed]
- Tappel, A.; Zalkin, H. Lipide peroxidation in isolated mitochondria. Arch. Biochem. Biophys. 1959, 80, 326–332. [Google Scholar] [CrossRef]
- Ostjen, C.A.; Rosa, C.G.S.; Hartmann, R.M.; Schemitt, E.G.; Colares, J.R.; Marroni, N.P. Anti-inflammatory and antioxidant effect of melatonin on recovery from muscular trauma induced in rats. Exp. Mol. Pathol. 2019, 106, 52–59. [Google Scholar] [CrossRef]
- Habig, W.H.; Pabst, M.J.; Jakoby, W.B. Glutathione S-transferases: The first enzymatic step in mercapturic acid formation. J. Biol. Chem. 1974, 249, 7130–7139. [Google Scholar] [CrossRef]
- Marklund, S.; Marklund, G. Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur. J. Biochem. 1974, 47, 469–474. [Google Scholar] [CrossRef]
- Paglia, D.E.; Valentine, W.N. Studies on the quantitative and qualitative characterization of erythrocyte glutathione peroxidase. J. Lab. Clin. Med. 1967, 70, 158–169. [Google Scholar]
- Chiu, D.T.; Stults, F.H.; Tappel, A.L. Purification and properties of rat lung soluble glutathione peroxidase. Biochim. Biophys. Acta (BBA)-Enzymol. 1976, 445, 558–566. [Google Scholar] [CrossRef]
- Naskar, S.; Islam, A.; Mazumder, U.; Saha, P.; Haldar, P.; Gupta, M. In vitro and in vivo antioxidant potential of hydromethanolic extract of Phoenix dactylifera fruits. J. Sci. Res. 2010, 2, 144–157. [Google Scholar] [CrossRef]
- Lowry, O.; Rosebrough, N.; Farr, A.; Randall, R. Protein Measurement with Folin Phenol Reagent. Biol. Chem. 1951, 193, 265–275. [Google Scholar] [CrossRef]
- Zhou, J.-R.; Li, L.; Pan, W. Dietary soy and tea combinations for prevention of breast and prostate cancers by targeting metabolic syndrome elements in mice. Am. J. Clin. Nutr. 2007, 86, 882S–888S. [Google Scholar] [CrossRef] [PubMed]
- Shaban, N.Z.; Abdelrahman, S.A.; El-Kersh, M.A.; Mogahed, F.A.; Talaat, I.M.; Habashy, N.H. The synergistic hepatoprotective potential of Beta vulgaris juice and 2, 3-dimercaptosuccinic acid in lead-intoxicated rats via improving the hepatic oxidative and inflammatory stress. BMC Complement. Med. Ther. 2020, 20, 268. [Google Scholar] [CrossRef]
- Şipos, R.S.; Fechete, R.; Moldovan, D.; Şuş, I.; Szasz, S.; Pávai, Z. Assessment of femoral bone osteoporosis in rats treated with simvastatin or fenofibrate. Open Life Sci. 2015, 10, 379–387. [Google Scholar] [CrossRef]
- Qi, S. Synergistic effects of genistein and zinc on bone metabolism and the femoral metaphyseal histomorphology in the ovariectomized rats. Biol. Trace Elem. Res. 2018, 183, 288–295. [Google Scholar] [CrossRef]
- Chotiyarnwong, P.; McCloskey, E.V. Pathogenesis of glucocorticoid-induced osteoporosis and options for treatment. Nat. Rev. Endocrinol. 2020, 16, 437–447. [Google Scholar] [CrossRef]
- Hachemi, Y.; Rapp, A.E.; Picke, A.-K.; Weidinger, G.; Ignatius, A.; Tuckermann, J. Molecular mechanisms of glucocorticoids on skeleton and bone regeneration after fracture. J. Mol. Endocrinol. 2018, 61, R75. [Google Scholar] [CrossRef]
- Canalis, E.; Giustina, A. Glucocorticoid-induced osteoporosis: Summary of a workshop. J. Clin. Endocrinol. Metab. 2001, 86, 5681–5685. [Google Scholar] [CrossRef]
- Tariq, S.; Tariq, S.; Lone, K.P.; Khaliq, S. Alkaline phosphatase is a predictor of Bone Mineral Density in postmenopausal females. Pak. J. Med. Sci. 2019, 35, 749–753. [Google Scholar] [CrossRef]
- Chen, Z.; Xue, J.; Shen, T.; Mu, S.; Fu, Q. Curcumin alleviates glucocorticoid-induced osteoporosis through the regulation of the Wnt signaling pathway. Int. J. Mol. Med. 2016, 37, 329–338. [Google Scholar] [CrossRef] [PubMed]
- Mukaiyama, K.; Kamimura, M.; Uchiyama, S.; Ikegami, S.; Nakamura, Y.; Kato, H. Elevation of serum alkaline phosphatase (ALP) level in postmenopausal women is caused by high bone turnover. Aging Clin. Exp. Res. 2015, 27, 413–418. [Google Scholar] [CrossRef] [PubMed]
- Vimalraj, S. Alkaline phosphatase: Structure, expression and its function in bone mineralization. Gene 2020, 754, 144855. [Google Scholar] [CrossRef]
- Neve, A.; Corrado, A.; Cantatore, F.P. Osteocalcin: Skeletal and extra-skeletal effects. J. Cell. Physiol. 2013, 228, 1149–1153. [Google Scholar] [CrossRef] [PubMed]
- Hou, T.; Zhang, L.; Yang, X. Ferulic acid, a natural polyphenol, protects against osteoporosis by activating SIRT1 and NF-κB in neonatal rats with glucocorticoid-induced osteoporosis. Biomed. Pharmacother. 2019, 120, 109205. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Yang, J.; Pan, T.; Zhong, X. Liraglutide increases bone formation and inhibits bone resorption in rats with glucocorticoid-induced osteoporosis. J. Endocrinol. Investig. 2019, 42, 1125–1131. [Google Scholar] [CrossRef]
- Govindarajan, P.; Khassawna, T.; Kampschulte, M.; Böcker, W.; Huerter, B.; Dürselen, L.; Faulenbach, M.; Heiss, C. Implications of combined ovariectomy and glucocorticoid (dexamethasone) treatment on mineral, microarchitectural, biomechanical and matrix properties of rat bone. Int. J. Exp. Pathol. 2013, 94, 387–398. [Google Scholar] [CrossRef]
- Farley, J.; Stilt-Coffing, B. Apoptosis may determine the release of skeletal alkaline phosphatase activity from human osteoblast-line cells. Calcif. Tissue Int. 2001, 68, 43–52. [Google Scholar] [CrossRef]
- Bull, H.; Murray, P.G.; Thomas, D.; Fraser, A.M.; Nelson, P.N. Acid phosphatases. Mol. Pathol. 2002, 55, 65–72. [Google Scholar] [CrossRef]
- Boyle, W.J.; Simonet, W.S.; Lacey, D.L. Osteoclast differentiation and activation. Nature 2003, 423, 337–342. [Google Scholar] [CrossRef]
- Han, D.; Zhang, P.; Jiang, B. Local administration of IKK small molecule inhibitor may enhance fracture healing in osteoporosis patient. Int. J. Clin. Exp. Med. 2015, 8, 1411–1415. [Google Scholar] [PubMed]
- Hermoso, M.A.; Cidlowski, J.A. Putting the brake on inflammatory responses: The role of glucocorticoids. IUBMB Life 2003, 55, 497–504. [Google Scholar] [CrossRef] [PubMed]
- Ward, L.M. Glucocorticoid-Induced Osteoporosis: Why Kids Are Different. Front. Endocrinol. 2020, 11, 576. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.; Yuan, W.; Xiong, X.; Zhang, Z.; Liu, J.; Zheng, Y.; Wang, J.; Liu, J. HO-1 in Bone Biology: Potential Therapeutic Strategies for Osteoporosis. Front. Cell Dev. Biol. 2021, 9, 791585. [Google Scholar] [CrossRef] [PubMed]
- Che, J.; Yang, J.; Zhao, B.; Shang, P. HO-1: A new potential therapeutic target to combat osteoporosis. Eur. J. Pharmacol. 2021, 906, 174219. [Google Scholar] [CrossRef] [PubMed]
- Xiao, H.-H.; Gao, Q.-G.; Zhang, Y.; Wong, K.-C.; Dai, Y.; Yao, X.-S.; Wong, M.-S. Vanillic acid exerts oestrogen-like activities in osteoblast-like UMR 106 cells through MAP kinase (MEK/ERK)-mediated ER signaling pathway. J. Steroid Biochem. Mol. Biol. 2014, 144, 382–391. [Google Scholar] [CrossRef] [PubMed]
- Zych, M.; Folwarczna, J.; Trzeciak, H.I. Natural phenolic acids may increase serum estradiol level in ovariectomized rats. Acta Biochim. Pol. 2009, 56, 503–507. [Google Scholar] [CrossRef] [PubMed]
- Domazetovic, V.; Marcucci, G.; Iantomasi, T.; Brandi, M.L.; Vincenzini, M.T. Oxidative stress in bone remodeling: Role of antioxidants. Clin. Cases Miner. Bone Metab. 2017, 14, 209. [Google Scholar] [CrossRef]
- Elshal, M.F.; Almalki, A.L.; Hussein, H.K.; Khan, J.A. Synergistic antiosteoporotic effect of Lepidium sativum and alendronate in glucocorticoid-induced osteoporosis in Wistar rats. Afr. J. Tradit. Complement. Altern. Med. 2013, 10, 267–273. [Google Scholar] [CrossRef]
- Vrahnas, C.; Buenzli, P.R.; Pearson, T.A.; Pennypacker, B.L.; Tobin, M.J.; Bambery, K.R.; Duong, L.T.; Sims, N.A. Differing Effects of Parathyroid Hormone, Alendronate, and Odanacatib on Bone Formation and on the Mineralization Process in Intracortical and Endocortical Bone of Ovariectomized Rabbits. Calcif. Tissue Int. 2018, 103, 625–637. [Google Scholar] [CrossRef]
- Zhao, J.; Li, Y.; Zhang, H.; Shi, D.; Li, Q.; Meng, Y.; Zuo, L. Preventative effects of metformin on glucocorticoid-induced osteoporosis in rats. J. Bone Miner. Metab. 2019, 37, 805–814. [Google Scholar] [CrossRef] [PubMed]
- Inoue, R.; Matsuki, N.A.; Jing, G.; Kanematsu, T.; Abe, K.; Hirata, M. The inhibitory effect of alendronate, a nitrogen-containing bisphosphonate on the PI3K-Akt-NFkappaB pathway in osteosarcoma cells. Br. J. Pharmacol. 2005, 146, 633–641. [Google Scholar] [CrossRef] [PubMed]
- Chakraborty, K.; Dhara, S. Polygalacto-fucopyranose biopolymer structured nanoparticle conjugate attenuates glucocorticoid-induced osteoporosis: An in vivo study. Int. J. Biol. Macromol. 2021, 190, 739–753. [Google Scholar] [CrossRef] [PubMed]
- Papadaki, H.A.; Tsatsanis, C.; Christoforidou, A.; Malliaraki, N.; Psyllaki, M.; Pontikoglou, C.; Miliaki, M.; Margioris, A.N.; Eliopoulos, G.D. Alendronate reduces serum TNFalpha and IL-1beta, increases neutrophil counts, and improves bone mineral density and bone metabolism indices in patients with chronic idiopathic neutropenia (CIN)-associated osteopenia/osteoporosis. J. Bone Miner. Metab. 2004, 22, 577–587. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.-J.; Jun, Y.-J.; Yu, H.-I.; Yang, S.-Y.; Oh, W.-M.; Kim, S.-H.; Kim, M.-S. Altered Expression of RANKL/OPG after Alendronate Administration in the Developing Teeth of Postnatal Rats. Int. J. Oral Biol. 2011, 36, 37–42. [Google Scholar]
- Eslami, B.; Zhou, S.; Van Eekeren, I.; LeBoff, M.S.; Glowacki, J. Reduced osteoclastogenesis and RANKL expression in marrow from women taking alendronate. Calcif. Tissue Int. 2011, 88, 272–280. [Google Scholar] [CrossRef] [PubMed]
- Wei, D.; PENG, H.-f.; LIANG, Y.-q.; FENG, X.-j.; LIAO, N.-n.; QI, M.-c. Effect of bisphosphonates on NFATc1 and correlators p-NF-κB and pc-Jun in osteoclast differentiation. Med. J. Chin. People’s Lib. Army 2015, 40, 778–781. [Google Scholar]
- Sheng, H.; Lao, Y.; Zhang, S.; Ding, W.; Lu, D.; Xu, B. Combined Pharmacotherapy with Alendronate and Desferoxamine Regulate the Bone Resorption and Bone Regeneration for Preventing Glucocorticoids-Induced Osteonecrosis of the Femoral Head. Biomed Res. Int. 2020, 2020, 3120458. [Google Scholar] [CrossRef]
- Sharma, M.; Abhijeet, S.; Verma, R.; Ali, D.; Amla, B. Influence of PGRS for the in vitro plant regeneration and flowering in Portulaca oleracea (L.): A medicinal and ornamental plant. Int. J. Bot. 2011, 7, 103–107. [Google Scholar] [CrossRef]
- Saleh, S.R.; Masry, A.M.; Ghareeb, D.A.; Newairy, A.-S.A.; Sheta, E.; Maher, A.M. Trichoderma reesei fungal degradation boosted the potentiality of date pit extract in fighting scopolamine-induced neurotoxicity in male rats. Sci. Rep. 2021, 11, 14872. [Google Scholar] [CrossRef]
- Wang, Y.; Liu, J.; Pang, Q.; Tao, D. Alpinumisoflavone protects against glucocorticoid-induced osteoporosis through suppressing the apoptosis of osteoblastic and osteocytic cells. Biomed. Pharmacother. 2017, 96, 993–999. [Google Scholar] [CrossRef] [PubMed]
- Lin, B.; Xu, P.; Zheng, J.; Deng, X.; Ye, Q.; Huang, Z.; Wang, N. Effects and mechanisms of natural alkaloids for prevention and treatment of osteoporosis. Front. Pharmacol. 2022, 13, 1014173. [Google Scholar] [CrossRef] [PubMed]
- Sahan, Y.; Gurbuz, O.; Guldas, M.; Degirmencioglu, N.; Begenirbas, A. Phenolics, antioxidant capacity and bioaccessibility of chicory varieties (Cichorium spp.) grown in Turkey. Food Chem. 2017, 217, 483–489. [Google Scholar] [CrossRef] [PubMed]
- Iqbal, Y.; Ponnampalam, E.N.; Suleria, H.A.; Cottrell, J.J.; Dunshea, F.R. LC-ESI/QTOF-MS profiling of chicory and lucerne polyphenols and their antioxidant activities. Antioxidants 2021, 10, 932. [Google Scholar] [CrossRef] [PubMed]
- Uddin, M.K.; Juraimi, A.S.; Ali, M.E.; Ismail, M.R. Evaluation of antioxidant properties and mineral composition of purslane (Portulaca oleracea L.) at different growth stages. Int. J. Mol. Sci. 2012, 13, 10257–10267. [Google Scholar] [CrossRef] [PubMed]
- Lim, Y.Y.; Quah, E.P. Antioxidant properties of different cultivars of Portulaca oleracea. Food Chem. 2007, 103, 734–740. [Google Scholar] [CrossRef]
- El Kashef, R.; Soliman, A.S.; Hassan, H.; Abd-Elhak, N.A. Evaluation of total phenolic content and antioxidant activity of different solvent extracts of Egyptian purslane leaves. Curr. Sci. 2018, 7, 616–623. [Google Scholar]
- Wołonciej, M.; Milewska, E.; Roszkowska-Jakimiec, W. Trace elements as an activator of antioxidant enzymes. Adv. Hyg. Exp. Med. 2016, 70, 1483–1498. [Google Scholar] [CrossRef]
- Castiglioni, S.; Cazzaniga, A.; Albisetti, W.; Maier, J.A. Magnesium and osteoporosis: Current state of knowledge and future research directions. Nutrients 2013, 5, 3022–3033. [Google Scholar] [CrossRef]
- Ciosek, Ż.; Kot, K.; Kosik-Bogacka, D.; Łanocha-Arendarczyk, N.; Rotter, I. The Effects of Calcium, Magnesium, Phosphorus, Fluoride, and Lead on Bone Tissue. Biomolecules 2021, 11, 506. [Google Scholar] [CrossRef]
- Szentmihályi, K.; Kéry, Á.; Then, M.; Lakatos, B.; Sándor, Z.; Vinkler, P. Potassium–sodium ratio for the characterization of medicinal plant extracts with diuretic activity. Phytother. Res. Int. J. Devoted Pharmacol. Toxicol. Eval. Nat. Prod. Deriv. 1998, 12, 163–166. [Google Scholar] [CrossRef]
- Roberfroid, M.B.; Cumps, J.; Devogelaer, J.-P. Dietary chicory inulin increases whole-body bone mineral density in growing male rats. J. Nutr. 2002, 132, 3599–3602. [Google Scholar] [CrossRef] [PubMed]
- Janda, K.; Gutowska, I.; Geszke-Moritz, M.; Jakubczyk, K. The Common Cichory (Cichorium intybus L.) as a Source of Extracts with Health-Promoting Properties-A Review. Molecules 2021, 26, 1814. [Google Scholar] [CrossRef] [PubMed]
- Bayazid, A.B.; Park, S.H.; Kim, J.G.; Lim, B.O. Green chicory leaf extract exerts anti-inflammatory effects through suppressing LPS-induced MAPK/NF-κB activation and hepatoprotective activity in vitro. Food Agric. Immunol. 2020, 31, 513–532. [Google Scholar] [CrossRef]
- Miao, L.; Tao, H.; Peng, Y.; Shengpeng, W.; Zhong, Z.; El-Seedi, H.; Dragan, S.; Zengin, G.; Cheang, W.S.; Wang, Y.; et al. The anti-inflammatory potential of Portulaca oleracea L. (purslane) extract by partial suppression on NF-κB and MAPK activation. Food Chem. 2019, 290, 239–245. [Google Scholar] [CrossRef] [PubMed]
- Baradaran Rahimi, V.; Rakhshandeh, H.; Raucci, F.; Buono, B.; Shirazinia, R.; Samzadeh Kermani, A.; Maione, F.; Mascolo, N.; Askari, V.R. Anti-Inflammatory and Anti-Oxidant Activity of Portulaca oleracea Extract on LPS-Induced Rat Lung Injury. Molecules 2019, 24, 139. [Google Scholar] [CrossRef]
- Kim, J.-Y.; Oh, H.M.; Kwak, S.C.; Cheon, Y.-H.; Lee, M.S.; Rho, M.C.; Oh, J. Purslane suppresses osteoclast differentiation and bone resorbing activity via inhibition of Akt/GSK3β-c-Fos-NFATc1 signaling in vitro and prevents lipopolysaccharide-induced bone loss in vivo. Biol. Pharm. Bull. 2015, 38, 66–74. [Google Scholar] [CrossRef]
- Samir, D.; Sara, C.; Widad, A. The effects of aqueous leaf extract of Portulaca oleracea on haemato-biochemical and histopathological changes induced by sub-chronic aluminium toxicity in male wistar rats. Pharmacol. Res.—Mod. Chin. Med. 2022, 4, 100101. [Google Scholar] [CrossRef]
- Birsa, M.L.; Sarbu, L.G. Health Benefits of Key Constituents in Cichorium intybus L. Nutrients 2023, 15, 1322. [Google Scholar] [CrossRef]
Plant Name/Family | Used Part | Place and Time of Collection | Used Solvent | Weight of Dry Powder |
---|---|---|---|---|
Chicory (Cichorium intybus L.)/Asteraceae | Roots | Egyptian farmers (Kafr El Dawar, El Beheira, Egypt)/winter (2019) | Water | 500 g |
Purslane (Portulaca oleracea L.)/Portulacaceae | Leaves | Ethanol (70%) | 300 g |
Gene Name/Accession Number | Primers’ Sequence | Annealing Temp. (°C) | |
---|---|---|---|
Forward | Reverse | ||
GAPDH/NM_017008.4 | TCCCTCAAGATTGTCAGCAA | AGATCCACAACGGATACATT | 52 |
OPG/NM_012870.2 | GTTCTTGCACAGCTTCACCA | AAACAGCCCAGTGACCATTC | 54 |
RANKL/NM_057149.2 | ACCAGCATCAAAATCCCAAG | GGCCGCTAATTTCCTCACCA | 52 |
TNF-α/NM_012675.3 | ACACACGAGACGCTGAAGTA | GGAACAGTCTGGGAAGCTCT | 62 |
IL-6/NM_012589.2 | GCCAGAGTCATTCAGAGCAATA | GTTGGATGGTCTTGGTCCTTAG | 55 |
Parameter | ACE Content | EPE Content |
---|---|---|
Yield (g%) | 10.32 ± 0.41 | 16.61 ± 0.32 |
Phytochemical constituents | ||
Total Phenolics (mg gallic acid Eq/g extract) | 21.61 ± 0.51 | 31.86 ± 0.61 |
Total flavonoids (mg quercetin Eq/g extract) | 103.91 ± 1.74 | 111.36 ± 3.6 |
Total alkaloids (%) | 22.68 ± 0.14 | 31.73 ± 1.2 |
Inulin content (g%) | 22.75 ± 0.18 | - |
Minerals content (µg/mg extract) | ||
Sodium | 147.087 | 1339.584 |
Potassium | 677.287 | 136.755 |
Calcium | 95.840 | 682.019 |
Phosphorus | 97.842 | 432.704 |
Magnesium | 21.589 | 601.108 |
Iron | 21.967 | 74.395 |
Aluminum | 5.155 | 32.612 |
Zinc | 0.694 | 3.671 |
Manganese | 0.508 | 1.635 |
Cupper | 0.645 | 1.317 |
Selenium | 0.015 | 0.030 |
Lead | 0.077 | 0.040 |
Nickel | 0.035 | 0.151 |
Chromium | 0.278 | 0.308 |
Cobalt | 0.01 | 0.029 |
Phenolic Compounds (mg/g Extract) | |||
---|---|---|---|
RT# | Compound | ACE | EPE |
5.0 | Syringic acid | 1.082 | 2.850 |
5.8 | p-Coumaric acid | 0.824 | 0.872 |
7.0 | Cinnamic acid | 2.444 | ND |
8.1 | Caffeic acid | 0.636 | ND |
9.0 | Pyrogallol | ND | 1.638 |
9.8 | Gallic acid | 3.330 | 1.490 |
10.7 | Ferulic acid | 1.228 | 0.620 |
13.0 | Ellagic acid | ND | 2.592 |
Flavonoid Compounds (mg/g extract) | |||
4.0 | Naringin | 3.078 | 1.300 |
6.2 | Myricetin | 1.844 | ND |
7.0 | Quercetin | ND | 2.940 |
8.0 | Kampferol | 1.038 | 1.022 |
9.1 | Luteolin | ND | 0.798 |
10.0 | Apigenin | 1.556 | 2.548 |
Parameter | CI | Effect |
---|---|---|
DPPH scavenging (mg/mL) | 0.939 ± 0.1 | Additive |
NO scavenging (mg/mL) | 0.301 ± 0.12 | Synergistic |
FRAP (mg/mL) | 0.215 ± 0.28 | Synergistic |
BMD (g/cm2) | 0.642 ± 0.01 | Synergistic |
BMC (g) | 0.547 ± 0.16 | Synergistic |
Bone index | 0.500 ± 0.02 | Synergistic |
Ca-I (mg/dl) | 0.506 ± 0.01 | Synergistic |
PTH (pg/mL) | 0.326 ± 0.06 | Synergistic |
OCN (ng/mL) | 0.578 ± 0.21 | Synergistic |
ACP activity (U/L) | 0.359 ± 0.598 | Synergistic |
ALP activity (U/L) | 0.332 ± 0.63 | Synergistic |
TNF- α fold change | 0.306 ± 0.01 | Synergistic |
IL-6 fold change | 0.389 ± 0.02 | Synergistic |
OPG fold change | 0.588 ± 0.02 | Synergistic |
RANKL fold change | 0.254 ± 0.01 | Synergistic |
OPG/RANKL ratio | 0.859 ± 0.02 | Synergistic |
NO level (µmol/mg protein) | 0.365 ± 0.12 | Synergistic |
MDA level (µmol/mg protein) | 0.353 ± 0.001 | Synergistic |
GSH content (mM/mg protein) | 0.359 ± 0.01 | Synergistic |
GPx activity (U/mg protein) | 0.772 ± 0.05 | Synergistic |
SOD activity (U/mg protein) | 0.434 ± 0.08 | Synergistic |
GST activity (U/mg protein) | 0.422 ± 0.001 | Synergistic |
HO-1 relative expression level | 0.747 ± 0.31 | Synergistic |
Nrf2 relative expression level | 0.703 ± 0.01 | Synergistic |
p-IKK relative expression level | 0.091 ± 0.05 | Synergistic |
NFATc1 relative expression level | 0.388 ± 0.03 | Synergistic |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Saleh, S.R.; Saleh, O.M.; El-Bessoumy, A.A.; Sheta, E.; Ghareeb, D.A.; Eweda, S.M. The Therapeutic Potential of Two Egyptian Plant Extracts for Mitigating Dexamethasone-Induced Osteoporosis in Rats: Nrf2/HO-1 and RANK/RANKL/OPG Signals. Antioxidants 2024, 13, 66. https://doi.org/10.3390/antiox13010066
Saleh SR, Saleh OM, El-Bessoumy AA, Sheta E, Ghareeb DA, Eweda SM. The Therapeutic Potential of Two Egyptian Plant Extracts for Mitigating Dexamethasone-Induced Osteoporosis in Rats: Nrf2/HO-1 and RANK/RANKL/OPG Signals. Antioxidants. 2024; 13(1):66. https://doi.org/10.3390/antiox13010066
Chicago/Turabian StyleSaleh, Samar R., Omnia M. Saleh, Ashraf A. El-Bessoumy, Eman Sheta, Doaa A. Ghareeb, and Saber M. Eweda. 2024. "The Therapeutic Potential of Two Egyptian Plant Extracts for Mitigating Dexamethasone-Induced Osteoporosis in Rats: Nrf2/HO-1 and RANK/RANKL/OPG Signals" Antioxidants 13, no. 1: 66. https://doi.org/10.3390/antiox13010066
APA StyleSaleh, S. R., Saleh, O. M., El-Bessoumy, A. A., Sheta, E., Ghareeb, D. A., & Eweda, S. M. (2024). The Therapeutic Potential of Two Egyptian Plant Extracts for Mitigating Dexamethasone-Induced Osteoporosis in Rats: Nrf2/HO-1 and RANK/RANKL/OPG Signals. Antioxidants, 13(1), 66. https://doi.org/10.3390/antiox13010066