Evaluation of the Antimicrobial Resistance of Different Serotypes of Salmonella enterica from Livestock Farms in Southern Italy
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strain Isolation and Identification
2.2. Antimicrobial Susceptibility Tests
2.3. Molecular Detection of Extended Spectrum β-Lactamase Genes
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Cassini, A.; Högberget, L.D.; Plachouras, D.; Quattrocchi, A.; Hoxha, A.; Gunnar, S.S.; Colomb-Cotinat, M.; Kretzschmar, M.E.; Devleesschauwer, B.; Cecchini, M.; et al. Attributable deaths and disability-adjusted life-years caused by infections with antibiotic-resistant bacteria in the EU and the European Economic Area in 2015: A population-level modelling analysis. Lancet Inf. Dis. 2019, 19, 56–66. [Google Scholar] [CrossRef] [PubMed]
- Kumar, A.; Pal, D. Antibiotic resistance and wastewater: Correlation, impact and critical human health challenges. J. Environ. Chem. Eng. 2017, 6, 52–58. [Google Scholar] [CrossRef]
- Sánchez-Salazar, E.; Gudiño, M.E.; Sevillano, G.; Zurita, J.; Guerrero-López, R.; Jaramillo, K.; Calero-Cáceres, W. Antibiotic resistance of Salmonella strains from layer poultry farms in central Ecuador. J. Appl. Microbiol. 2020, 128, 1347–1354. [Google Scholar] [CrossRef] [PubMed]
- Chattopadhyay, M.K. Use of antibiotics as feed additives: A burning question. Front. Microbiol. 2014, 5, 334. [Google Scholar] [CrossRef]
- Eagar, H.; Swan, G.; Van Vuuren, M. A survey of antimicrobial usage in animals in South Africa with specific reference to food animals. J. S. Afr. Vet. Assoc. 2012, 83, 15–23. [Google Scholar] [CrossRef] [PubMed]
- FAO/WHO. Codex Alimentarius. Commission Codex Texts on Foodborne Antimicrobial Resistance. 2015. Available online: http://www.fao.org/3/a-i4296t.pdf (accessed on 12 October 2021).
- Tiseo, K.; Huber, L.; Gilbert, M.; Robinson, T.P.; Van Boeckel, T.P. Global Trends in Antimicrobial Use in Food Animals from 2017 to 2030. Antibiotics 2020, 9, 918. [Google Scholar] [CrossRef] [PubMed]
- Alessiani, A.; Goffredo, E.; Mancini, M.; Occhiochiuso, G.; Faleo, S.; Didonna, A.; Fischetto, R.; Suglia, F.; De Vito, D.; Stallone, A.; et al. Evaluation of Antimicrobial Resistance in Salmonella Strains Isolated from Food, Animal and Human Samples between 2017 and 2021 in Southern Italy. Microorganisms 2022, 10, 812. [Google Scholar] [CrossRef]
- European Food Safety Authority (EFSA). The European Union Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents and Food-Borne Outbreaks in 2016. EFSA J. 2017, 15, e05077. [Google Scholar]
- WHO. Salmonella. 2017. Available online: http://www.who.int/foodsafety/areas_work/foodborne-diseases/salmonella/en/ (accessed on 12 October 2021).
- Schatten, H.; Eisenstark, A. Salmonella, Methods and Protocols; Humana Press: New York, NY, USA, 2015. [Google Scholar]
- Grimont, P.A.; Weill, F.X. Antigenic Formulae of the Salmonella Servovars, 9th ed.; Institut Pasteur: Paris, France, 2007; Volume 13. [Google Scholar]
- Emond-Rheault, J.G.; Hamel, J.; Jeukens, J.; Freschi, L.; Kukavica-Ibrulj, I.; Boyle, B.; Tamber, S.; Malo, D.; Franz, E.; Burnett, E.; et al. The Salmonella enterica plasmidome as a reservoir of antibiotic resistance. Microorganisms 2020, 8, 1016. [Google Scholar] [CrossRef]
- Foley, S.; Nayak, R.; Hanning, I.B.; Johnson, T.J.; Han, J.; Ricke, S.C. Population dynamics of Salmonella enterica serotypes in commercial egg and poultry production. Appl. Environ. Microbiol. 2011, 77, 4273–4279. [Google Scholar] [CrossRef]
- Cosby, D.E.; Cox, N.A.; Harrison, M.A.; Wilson, J.L.; Buhr, R.J.; Fedorka-Cray, P.J. Salmonella and antimicrobial resistance in broilers: A review: Table 1. J. Appl. Poult. Res. 2015, 24, 408–426. [Google Scholar] [CrossRef]
- Antunes, P.; Mour~ao, J.; Campos, J.; Peixe, L. Salmonellosis: The role of poultry meat. Clin. Microbiol. Infect. 2016, 22, 110–121. [Google Scholar] [CrossRef] [PubMed]
- Liljebjelke, K.A.; Hofacre, C.L.; White, D.G.; Ayers, S.; Lee, M.D.; Maurer, J.J. Diversity of antimicrobial resistance phenotypes in Salmonella isolated from commercial poultry farms. Front. Vet. Sci. 2017, 4, 96. [Google Scholar] [CrossRef] [PubMed]
- Khadka, P.; Thapaliya, J.; Thapa, S. Susceptibility pattern of Salmonella enterica against commonly prescribed antibiotics, to febrile-pediatric cases, in low-income countries. BMC Pediatr. 2021, 21, 38. [Google Scholar] [CrossRef]
- Mthembu, T.P.; Zishiri, O.T.; El Zowalaty, M.E. Molecular detection of multidrug-resistant Salmonella isolated from livestock production systems in South Africa. Infect. Drug Resist. 2019, 12, 3537–3548. [Google Scholar] [CrossRef]
- Jensen, A.N.; Sørensen, G.; Baggesen, D.L.; Bødker, R.; Hoorfar, J. Addition of Novobiocin in pre-enrichment step can improve Salmonella culture protocol of modified semisolid Rappaport-Vassiliadis. J. Microbiol. Methods 2003, 55, 249–255. [Google Scholar] [CrossRef]
- Popoff, M.Y.; Le Minor, L. Antigenic Formulas of the Salmonella Serovars; WHO Collaborating Centre for Reference and Research on Salmonella: Paris, France, 1997. [Google Scholar]
- Sugumar, M.; Kumar, K.M.; Manoharan, A.; Anbarasu, A.; Ramaiah, S. Detection of OXA-1 β-lactamase gene of Klebsiella pneumoniae from blood stream infections (BSI) by conventional PCR and in-silico analysis to understand the mechanism of OXA mediated resistance. PLoS ONE 2014, 9, e91800. [Google Scholar] [CrossRef]
- Kim, J.; Jeon, S.; Rhie, H.; Lee, B.; Park, M.; Lee, H.; Lee, J.; Kim, S. Rapid Detection of Extended Spectrum beta-Lactamase (ESBL) for Enterobacteriaceae by use of a Multiplex PCR-based Method. Infect Chemother. 2009, 41, 181–184. [Google Scholar] [CrossRef]
- Gargano, V.; Gambino, D.; Migliore, S.; Vitale, M.; Sciortino, S.; Costa, A.; Vicari, D. Can Human Handling Increase the Presence of Multidrug Resistance (MDR) in Salmonella spp. Isolated from Food Sources? Microorganisms 2021, 9, 2018. [Google Scholar] [CrossRef]
- European Food Safety Authority (EFSA); European Centre for Disease Prevention and Control (ECDC). The European Union Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents and Food-borne Outbreaks in 2017. EFSA J. 2018, 16, e05500. [Google Scholar]
- European Food Safety Authority (EFSA); European Centre for Disease Prevention and Control. The European Union One Health 2019 Zoonoses Report. EFSA J. 2021, 19, e06406. [Google Scholar]
- Murakami, K.; Horikawa, K.; Ito, T.; Otsuki, K. Environmental survey of Salmonella and comparison of genotypic character with human isolates in Western Japan. Epidemiol. Infect. 2001, 126, 159–171. [Google Scholar] [CrossRef] [PubMed]
- Rumyantsev, S. Toward molecular level of the “Salmonella-Victim” Ecology, Genetics, and Evolution. Sci. World J. 2004, 4, 193–199. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Van den Bogaard, A.E.; Stobberingh, E.E. Epidemiology of resistance to antibiotics: Links between animals and humans. Intern. J. Antimicr. Agents 2000, 4, 327–335. [Google Scholar] [CrossRef] [PubMed]
- Crump, J.A.; Sjölund-Karlsson, M.; Gordon, M.A.; Parry, C.M. Epidemiology, clinical presentation, laboratory diagnosis, antimicrobial resistance, and antimicrobial management of invasive Salmonella infections. Clin. Microbiol. Rev. 2015, 28, 901–937. [Google Scholar] [CrossRef]
- Kariuki, S.; Gordon, M.A.; Feasey, N.; Parry, C.M. Antimicrobial resistance and management of invasive Salmonella disease. Vaccine. 2015, 33, C21–C29. [Google Scholar] [CrossRef] [PubMed]
- van Vuuren, M. Bacterial resistance against antibiotics: Global and local trends. Stockfarm 2017, 7, 51. [Google Scholar]
- Gillings, M.R. Integrons: Past, present, and future. Microbiol. Mol. Biol. Rev. 2014, 78, 257–277. [Google Scholar] [CrossRef] [PubMed]
- Hall, R.M. Integrons and gene cassettes: Hotspots of diversity in bacterial genomes. Ann. N. Y. Acad. Sci. 2012, 1267, 71–78. [Google Scholar] [CrossRef]
- Marshall, B.M.; Levy, S.B. Food animals and antimicrobials: Impacts on human health. Clin. Microbiol. Rev. 2011, 24, 718–733. [Google Scholar] [CrossRef]
- Tauxe, R.V. Emerging foodborne pathogens. Int. J. Food Microbiol. 2002, 78, 31–41. [Google Scholar] [CrossRef] [PubMed]
- Dhama, K.; Rajagunalan, S.; Chakraborty, S.; Verma, A.K.; Kumar, A.; Tiwari, R.; Kapoor, S. Food-borne pathogens of animal origin-diagnosis, prevention, control and their zoonotic significance: A review. Pak. J. Biol. Sci. 2013, 15, 1076–1085. [Google Scholar] [CrossRef] [PubMed]
- Bellissima, P.; Amato, R.; Aurnia, G.; Cannizzo, R.; Bonfante, S. Epidemiology of salmonellosis in Caltagirone area (Sicily). Infez. Med. 2004, 12, 60–64. [Google Scholar] [PubMed]
- Di Marcantonio, L.; Romantini, R.; Marotta, F.; Chiaverini, A.; Zilli, K.; Abass, A.; Di Giannatale, E.; Garofolo, G.; Janowicz, A. The Current Landscape of Antibiotic Resistance of Salmonella Infantis in Italy: The Expansion of Extended-Spectrum Beta-Lactamase Producers on a Local Scale. Front. Microbiol. 2022, 13, 812481. [Google Scholar] [CrossRef] [PubMed]
- Frye, J.G.; Jackson, C.R. Genetic mechanisms of antimicrobial resistance identified in Salmonella enterica, Escherichia coli, and Enteroccocus spp. isolated from US food animals. Front. Microbiol. 2013, 4, 135. [Google Scholar] [CrossRef]
- Parry, C.M.; Threlfall, E. Antimicrobial resistance in typhoidal and nontyphoidal Salmonellae. Curr. Opin. Infect. Dis. 2008, 21, 531–538. [Google Scholar] [CrossRef]
- Sun, J.; Deng, Z.; Yan, A. Bacterial multidrug efflux pumps: Mechanisms, physiology and pharmacological exploitations. Biochem. Biophys. Res. Commun. 2014, 453, 254–267. [Google Scholar] [CrossRef]
- Delcour, A.H. Outer membrane permeability and antibiotic resistance. Biochim. Biophys. Acta 2009, 1794, 808–816. [Google Scholar] [CrossRef]
- van der Heijden, J.; Reynolds, L.A.; Deng, W.; Mills, A.; Scholz, R.; Imami, K.; Foster, L.J.; Duong, F.; Finlay, B.B. Salmonella rapidly regulates membrane permeability to survive oxidative stress. MBio 2016, 7, e01216–e01238. [Google Scholar] [CrossRef]
- McDermott, P.F.; Zhao, S.; Tate, H. Antimicrobial Resistance in Nontyphoidal Salmonella. Microbiol. Spectr. 2018, 6, ARBA-0014-2017. [Google Scholar] [CrossRef]
- Guerra, B.; Soto, S.; Helmuth, R.; Mendoza, M.C. Characterization of a self-transferable plasmid from Salmonella enterica serotype Typhimurium clinical isolates carrying two integron-borne gene cassettes together with virulence and drug resistance genes. Antimicrob. Agents Chemother. 2002, 46, 2977–2981. [Google Scholar] [CrossRef] [PubMed]
- Lian, X.; Wang, X.; Liu, X.; Xia, J.; Fang, L.; Sun, J.; Liao, X.; Liu, Y. OqxAB-Positive IncHI2 Plasmid PHXY0908 Increase Salmonella enterica serotype typhimurium strains tolerance to ciprofloxacin. Front. Cell. Infect. Microbiol. 2019, 9, 242. [Google Scholar] [CrossRef] [PubMed]
- Soares, F.B.; Camargo, C.H.; Cunha, M.P.V.; de Almeida, E.A.; de Jesus, A.M.B.; de Carvalho, E.; de Paiva, J.B.; Fernandes, S.A.; Tiba-Casas, M.R. Subtyping of plasmid-mediated quinolone resistance among Salmonella serotypes by whole genome sequencing. Diagn. Microbiol. Infect. Dis. 2019, 94, 403–406. [Google Scholar] [CrossRef] [PubMed]
- Munita, J.M.; Arias, C.A. Mechanisms of Antibiotic Resistance. Microbiol. Spectr. 2016, 4, 4.2.15. [Google Scholar] [CrossRef] [PubMed]
- Aminov, R.I. The role of antibiotics and antibiotic resistance in nature. Environ. Microbiol. 2009, 11, 2970–2988. [Google Scholar] [CrossRef] [PubMed]
- Bush, K.; Bradford, P.A. β-Lactams and β-lactamase inhibitors: An overview. Cold Spring Harb. Perspect. Med. 2016, 6, a025247. [Google Scholar] [CrossRef]
- Jang, J.; Suh, Y.S.; Di, D.Y.; Unno, T.; Sadowsky, M.J.; Hur, H.G. Pathogenic Escherichia coli strains producing extended-spectrum β-lactamases in the Yeongsan River Basin of South Korea. Environ. Sci. Technol. 2012, 47, 1128–1136. [Google Scholar] [CrossRef]
- Ouedraogo, S.A.; Sanou, M.; Kissou, A.; Sanou, S.; Solaré, H.; Kaboré, F.; Poda, A.; Aberkane, S.; Bouzinbi, N.; Sano, I.; et al. High prevalence of extended-spectrum β-lactamase producing enterobacteriaceae among clinical isolates in Burkina Faso. BMC Infect. Dis. 2016, 16, 326. [Google Scholar] [CrossRef]
- Wales, A.; Davies, R.H. Environmental aspects of Salmonella. In Salmonella in Domestic Animals; Barrow, P.A., Methner, U., Eds.; Centre for Agriculture and Bioscience International (CABI): Wallingford, UK, 2013. [Google Scholar]
| Target Gene | Primer Sequence (5′ → 3′) | Amplicon Size (bp) | Ref | |
|---|---|---|---|---|
| Set 1 | CTX-M IV F | GACAAAGAGAGTGCAACGGATG | 501 | [23] |
| CTX-M IV R | TCAGTGCGATCCAGACGAAA | |||
| TEM F | AGTGCTGCCATAACCATGAGTG | 431 | ||
| TEM R | CTGACTCCCC GTCGTGTAGATA | |||
| OXA F | ATTATCTACAGCAGCGCCAGTG | 296 | ||
| OXA R | TGCATCCACGTCTTTGGTG | |||
| SHV F | ATTATCTACAGCAGCGCCAGTG | 214 | ||
| SHV R | CGCTGTTATCGCTCATGGTAA | |||
| Set 2 | CMY II F | AGCGATCCGGTCACGAAATA | 695 | [23] |
| CMY II R | CCCGTTTTATG CACCCATGA | |||
| CTX M I F | TCCAGAATAAGGAATCCCATGG | 621 | ||
| CTX M I R | TGCTTTACCCAGCGTCAGAT | |||
| CTX M II F | ACCGCCGATAATTCGCAGAT | 588 | ||
| CTX M II R | GATATCGTTGGTGGTGCCATAA | |||
| DHA F | GTGGTGGACAGCACCATTAAA | 314 | ||
| DHA R | CCTGCGGTATAGGTAGCCAGAT |
| Salmonella serotypes | Host Species/Source | Antibiotic Drugs Breakpoint EUCAST | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SMX | AZI | TGC | TET | NAL | TMP | AMP | CIP | CHL | MERO | FOT | TAZ | COL | GEN | ||
| S ≤ 2 R ≥ 4 | --- | S ≤ 0.5 R ≥ 0.5 | ---- | --- | S ≤ 4 R ≥ 4 | S ≤ 8 R ≥ 8 | S ≤ 0.06 R ≥ 0.06 | S ≤ 8 R ≥ 8 | S ≤ 2 R ≥ 8 | S ≤ 1 R ≥ 2 | S ≤ 1 R ≥ 4 | S ≤ 2 R ≥ 2 | S ≤ 2 R ≥ 2 | ||
| S. Typhimurium | Cattle/feces | ≥1024 | ≥16 | ≥0.5 | ≥64 | ≥32 | ≥2 | ≥64 | ≥0.25 | ≥32 | ≥16 | ≤0.5 | 0 | ≥1 | 0 |
| S. Corvallis | Cattle/meat | ≥16 | ≥4 | ≥0.5 | 0 | 0 | 0 | ≤1 | ≤0.015 | 0 | ≤0.12 | 0 | 0 | ≤1 | ≤0.5 |
| S. Derby | Pig/feces | ≥1024 | ≥4 | ≥0.5 | ≥16 | ≥128 | ≥32 | ≥64 | ≥0.12 | ≥64 | ≤1 | ≥4 | ≥1 | 0 | 0 |
| S. Hadar | Insect | ≥512 | ≥4 | ≥0.5 | ≥32 | ≥128 | ≥16 | ≥64 | ≥4 | 0 | ≤0.12 | 0 | 0 | 0 | 0 |
| S. salamae | Pig/skin | ≥128 | ≥64 | ≥8 | ≥16 | ≥32 | ≥32 | ≥64 | ≥0.12 | ≥64 | ≥1 | ≥4 | ≥2 | ≤1 | ≤2 |
| S. houtenae | Chicken/skin | ≥1024 | ≥32 | ≥2 | ≥16 | ≥128 | ≥32 | ≥64 | ≥8 | ≥64 | ≤0.03 | 0 | 0 | ≥16 | ≤0.5 |
| S. Enteritidis | Chicken/feces | ≥32 | ≥64 | ≥0.5 | ≥64 | ≥8 | 0 | ≤1 | ≥2 | 0 | ≥2 | 0 | 0 | ≥2 | ≤2 |
| S. Corvallis | Chicken/feather | ≥8 | ≥4 | ≥0.5 | ≥2 | 0 | 0 | 0 | ≤0.015 | 0 | ≤0.03 | 0 | 0 | ≤1 | 0 |
| S. Infantis | Pig/feces | ≥16 | ≥8 | ≥2 | ≥2 | ≥128 | 0 | ≤1 | ≥0.5 | ≥16 | ≤0.03 | 0 | 0 | ≤1 | 0 |
| S. Corvallis | Goat/milk | ≥8 | ≥4 | ≥1 | 0 | 0 | 0 | ≤2 | ≤0.015 | 0 | 0 | 0 | 0 | ≥2 | 0 |
| S. Derby | Cattle/feces | ≥8 | ≥4 | ≥8 | ≥2 | ≥64 | ≤0.25 | ≤1 | ≤0.015 | ≥16 | ≤0.03 | 0 | ≥4 | ≤1 | 0 |
| S. Typhimurium | Pig/meat | ≥8 | ≥2 | ≥0.5 | 0 | 0 | ≥8 | ≤1 | ≤0.03 | 0 | 0 | 0 | 0 | 0 | 0 |
| S. Cardoner | Chicken/meat | ≥64 | ≥64 | ≥8 | ≥4 | 0 | ≥4 | ≥16 | 0 | 0 | ≥8 | 0 | 0 | ≥16 | ≥8 |
| S. Veneziana | Chicken/meat | ≥8 | ≥4 | ≤0.25 | 0 | 0 | ≤0.25 | ≤1 | ≤0.015 | 0 | 0 | 0 | 0 | 0 | 0 |
| S. Infantis | Chicken/meat | ≥1024 | ≥4 | ≥1 | ≥32 | ≥128 | ≥32 | ≥64 | ≥0.12 | 0 | 0 | ≥1 | ≥2 | 0 | 0 |
| ESLB Genes | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| Salmonella serotypes | TEM | OXA | SHV | DHA | CTXM-1 | CTXM-2 | CTXM-4 | CMY-2 | EHXA |
| S. Typhimurium | + | - | - | - | - | - | - | - | - |
| S. Corvallis | - | - | - | - | - | - | - | - | - |
| S. Derby | + | - | - | - | - | - | - | - | - |
| S. Hadar | + | - | - | - | - | - | - | - | - |
| S. salamae | + | - | - | - | - | - | - | - | - |
| S. houtenae | + | - | - | - | - | - | - | - | - |
| S. Enteritidis | - | - | - | - | - | - | - | - | - |
| S. Corvallis | - | - | - | - | - | - | - | - | - |
| S. Infantis | - | - | - | - | - | - | - | - | - |
| S. Corvallis | - | - | - | - | - | - | - | - | - |
| S. Derby | - | - | - | - | - | - | - | - | - |
| S. Typhimurium | - | - | - | - | - | - | - | - | - |
| S. Cardoner | + | - | - | - | - | - | - | - | - |
| S. Veneziana | - | - | - | - | - | - | - | - | - |
| S. Infantis | - | - | - | - | + | - | - | - | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Castronovo, C.; Agozzino, V.; Schirò, G.; Mira, F.; Di Bella, S.; Lastra, A.; Antoci, F.; Pennisi, M.; Giudice, E.; Guercio, A. Evaluation of the Antimicrobial Resistance of Different Serotypes of Salmonella enterica from Livestock Farms in Southern Italy. Appl. Sci. 2023, 13, 442. https://doi.org/10.3390/app13010442
Castronovo C, Agozzino V, Schirò G, Mira F, Di Bella S, Lastra A, Antoci F, Pennisi M, Giudice E, Guercio A. Evaluation of the Antimicrobial Resistance of Different Serotypes of Salmonella enterica from Livestock Farms in Southern Italy. Applied Sciences. 2023; 13(1):442. https://doi.org/10.3390/app13010442
Chicago/Turabian StyleCastronovo, Calogero, Vincenzo Agozzino, Giorgia Schirò, Francesco Mira, Santina Di Bella, Antonio Lastra, Francesco Antoci, Melissa Pennisi, Elisabetta Giudice, and Annalisa Guercio. 2023. "Evaluation of the Antimicrobial Resistance of Different Serotypes of Salmonella enterica from Livestock Farms in Southern Italy" Applied Sciences 13, no. 1: 442. https://doi.org/10.3390/app13010442
APA StyleCastronovo, C., Agozzino, V., Schirò, G., Mira, F., Di Bella, S., Lastra, A., Antoci, F., Pennisi, M., Giudice, E., & Guercio, A. (2023). Evaluation of the Antimicrobial Resistance of Different Serotypes of Salmonella enterica from Livestock Farms in Southern Italy. Applied Sciences, 13(1), 442. https://doi.org/10.3390/app13010442

