Next Article in Journal
Development of an Advanced Inspection of the Degradation of Volatile Organic Compounds in Electrochemical Water Treatment of Paint-Industrial Water Effluents
Previous Article in Journal
A Methodical Approach to 3D Scanning of Heritage Objects Being under Continuous Display
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Evaluation of the Antimicrobial Resistance of Different Serotypes of Salmonella enterica from Livestock Farms in Southern Italy

1
Istituto Zooprofilattico Sperimentale della Sicilia “A. Mirri”, Via G. Marinuzzi, 3, 90129 Palermo, Italy
2
Department of Veterinary Sciences, Polo Universitario dell’Annunziata, University of Messina, 98168 Messina, Italy
*
Author to whom correspondence should be addressed.
Appl. Sci. 2023, 13(1), 442; https://doi.org/10.3390/app13010442
Submission received: 24 November 2022 / Revised: 19 December 2022 / Accepted: 26 December 2022 / Published: 29 December 2022
(This article belongs to the Section Applied Microbiology)

Abstract

The antimicrobial susceptibility profiles of Salmonella spp. isolated from livestock production systems in Sicily were determined. The antibiotic sensitivity of isolated Salmonella spp. and broad-spectrum beta-lactamase strains were assessed by detecting β-lactamases blaCTX-M IV, TEM, and OXA SHV, and β-lactamases blaCMY II, CTX-M I, CTX-M II, and DHA. In total, 93.3% of Salmonella spp. strains showed multi-drug resistance (MDR). A total of seven serotypes (i.e., Salmonella Infantis, S. Typhimurium (monophasic), S. Derby, S. Hadar, S. salamae, S. houtenae, S. Cardoner) showed high resistance values (R) (100–47%) to sulfonamides, tetracyclines, diaminopyrimidines, penicillins, and quinolones. The gene for β-lactamase blaTEM was found in S. Typhimurium (monophasic) and S. Derby, isolated from swine meat and feces samples; S. Hadar isolated from an insect sample; S. salamae isolated from an abrasive sponge on swine skin; S. houtenae isolated from chicken skin samples; and S. Cardoner isolated from a chicken meat sample. The gene blaCTX-M I was found in S. Infantis isolated from a chicken meat sample. The results gathered in the current study suggest that the resistance to antibiotics is continuously increasing. This represents a worrying perspective since they should be usually used as the last option for therapy against bacterial infections.

1. Introduction

Antibiotic resistance is the ability of some microorganisms to survive and multiply in the presence of various antimicrobials and represents a health problem that has afflicted the world population for years [1]. Various bacterial species are naturally resistant, while others acquire, through vertical and horizontal transfer, characteristics that make them resistant to the action of some antibiotics. Antimicrobial resistance is a serious global problem in the 21st century, strictly due to several factors linked with the growth and lifestyle of the population, the excretion of incompletely metabolized antibiotics by humans and animals, the disposal of unused drugs, and waste from pharmaceutical processes [2]. The livestock sector constitutes one of many focal points for the evolution and dissemination of antibiotic-resistant bacteria [3]. As a matter of fact, antibiotics are widely used in food-producing animals for therapeutic, prophylactic, and growth-promoting purposes [4,5,6]. In addition, the global sale of antimicrobials is continuously increasing: the sale of 93,309 tonnes of antimicrobials was estimated for 2017 and the global sale is expected to rise by 11.5% to 104,079 tonnes in 2023 [7]. Antimicrobial resistance represents a problem of worldwide interest, which includes animals and humans. In particular, a study found a resistance to two or more antimicrobials of 85% in food and animal strains and 77.4% in human strains [8]. Therefore, the tracking of this phenomenon is of fundamental importance to countering its spread, and the monitoring of antibiotic resistance in Salmonella is considered to be of high priority by various global health organizations [9,10]. Salmonella species are associated with acute or chronic gastrointestinal diseases resulting from the consumption of food or water contaminated with fecal matter [11]. The Salmonella genus belongs to the Enterobacteriaceae family and includes two species, S. bongori and S. enterica. According to the Kauffman–White scheme, more than 2500 serotypes have been characterized [12,13]. Salmonella enterica represents one of the principal zoonotic agents that threatens public health and animal production worldwide [9]. Although poultry meat and eggs represent one of the principal sources of S. enterica infection in the food supply chain, other animal species could represent a means of spreading this zoonosis [14,15]. The contribution of the poultry industry to the dissemination of antibiotic-resistant Salmonella clones, and the associated dangers for human health, is well documented in certain countries [3,16,17,18,19]. Since antibiotic resistance patterns exhibit temporal and geographical variation, a continual evaluation of the situation is necessary in order to take opportune measures to limit the potential impact on public health systems and the food industry. This takes on considerable importance in an insular territory such as Sicily, where livestock breeding is mainly of extensive/breeding type and the transmission of zoonotic pathogens can occur between farm animals, wild animals, pets, and humans. Screening bacterial pathogens for the presence of antibiotic-resistance genes and detection by molecular methods enable researchers to determine whether a drug will be effective in a certain area and can be monitored. In view of the above considerations, the current study aimed to determine the antimicrobial susceptibility profiles and to detect resistance determinants of Salmonella spp. isolated from livestock production systems in Sicily, Southern Italy.

2. Materials and Methods

2.1. Bacterial Strain Isolation and Identification

From January to December 2020, a total of 663 biological samples from livestock were received from the provinces of Palermo, Catania, and Ragusa at the Istituto Zooprofilattico Sperimentale of Sicily (Palermo, Italy) for routine diagnostic activity for Salmonella spp. culture research. A total of 43 Salmonella isolates were collected, and among these, 15 antibiotic-resistant strains were considered for this study. Salmonella strains originated from the following samples: meat, milk, skin, feces, and feathers. The isolation of Salmonella spp. was carried out by a conventional method [20]. The samples were pre-enriched with buffered peptone water and incubated at 38 °C for 24 h. The samples were then transferred to Modified Semisolid Rappaport Vassiliadis (MSRV) medium and incubated at 42 °C for 24–48 h. Finally, isolates were incubated on Xylose Lysine Deoxycholate agar (XLD) and Brilliant Green agar (BGA) at 37 °C for 24 h, and colonies were further identified biochemically and by means of a Vitek device (bioMerieux, Marcy l’Etoile, France). Serotyping was performed by means of agglutination with specific anti-sera for somatic O and flagellar H according to the Kauffmann–White scheme [21].
Strains were stored at −80 °C in Microbanks (Pro-Lab Diagnostics, Biolife Italiana Srl, Milan, Italy) until the analysis.

2.2. Antimicrobial Susceptibility Tests

The selected strains were sown in Hektoen enteric agar with the aim of obtaining pure colonies. Bacteria were collected from the gel surface and added to demineralized water to make a suspension equivalent to a 0.5 McFarland standard adjusted by using a nephelometer. A total of 10 µL of bacterial suspension was collected and mixed in tubes with 11 mL of Mueller Hinton Broth. The antimicrobial susceptibility profiles of Salmonella strains were determined by broth microdilution using the Sensititre EUVSEC kit (Thermo Fisher Scientific, Monza, Italy) according to the manufacturer’s instructions. Fourteen antimicrobials were tested (test range): sulfamethoxazole-SMX (8–1024 µg/mL), trimethoprim-TMP (0.25–32 µg/mL), ciprofloxacin-CIP (0.015–8 µg/mL), tetracyclines-TET (2–64 µg/mL), meropenem-MERO (0.03–16 µg/mL), azithromycin- AZI (2–64 µg/mL), nalidixic acid-NAL (4–128 µg/mL), cefotaxime-FOT (0.25–4 µg/mL), chloramphenicol-CHL (8–128 µg/mL), tigecycline-TGC (0.25–8 µg/mL), ceftazidime-TAZ (0.5–8 µg/mL), colistin-COL (1–16 µg/mL), ampicillin-AMP (1–64 µg/mL), and gentamicin-GEN (0.5–32 µg/mL). The minimum inhibitory concentration (MIC) for each antimicrobial was interpreted using the clinical breakpoints, established by the European Committee for Antimicrobial Susceptibility Tests (EUCAST) to categorize MIC results as susceptible or resistant.

2.3. Molecular Detection of Extended Spectrum β-Lactamase Genes

The DNA used for multiplex-PCR was extracted by the heat lysis method [22]. Molecular analyses were performed for the determination of extended-spectrum beta-lactamase (ESBL) strains by multiplex PCR [23]: two separate multiplexes were prepared, marked as Set 1, detecting β-lactamases blaCTX-M IV, TEM, and OXA SHV, and Set 2, detecting the β-lactamases blaCMY II, CTX-M I, CTX-M II, and DHA. Both PCR reactions were performed under identical conditions. Reactions were performed in a final volume of 25 μL containing 5 μL of template DNA, 1× reaction buffer, 0.2 mM of each deoxynucleoside triphosphate, 20 pM of each primer, and 3.5 units of Taq polymerase. Both assays used identical cycling conditions. Reactions were performed under the following conditions: denaturation at 94 °C for 5 min followed by 30 cycles of 94 °C for 1 min, 61 °C for 1 min, and 72 °C for 1 min, and a final extension of 72 °C for 5 min. The primers used for PCR reactions are listed in Table 1. To confirm the presence of antibiotic-resistance genes, one gene from each type was sequenced and used as a positive control [24]. The PCR products were analyzed by 2% agarose gel electrophoresis and the results were visualized on the trans-illuminator.

3. Results

The 15 isolates were assigned to the species Salmonella enterica and to the subspecies enterica (13 isolates), (one isolate), (one isolate). Antigenic profiles were identified for S. salamae (O:1,23,22;-) and S. houtenae (O:43:z4,z23). Different serovars belonged to the 13 Salmonellae of subspecies enterica: Typhimurium (two isolates), Corvallis (three isolates), Derby (two isolates), Hadar, Enteritidis, Infantis (two isolates), Cardoner, Veneziana. Table 2 shows the Salmonella serotypes, the host, and the source from which they were collected.
The antibiotic sensitivity test showed that the Salmonella strains isolated from the analyzed biological samples were all resistant to a variable degree. All 15 resistant strains showed resistance to at least two classes of antibiotics and 14 (93.3%) strains were multiresistant, i.e., resistant to more than three classes of antibiotics, particularly the serotypes S. Typhimurium, S. Infantis, S. Hadar, S. Derby, S. Enteritidis, S. houtenae, S. salamae, and S. Cardoner. Moreover, seven serotypes showed high resistance values (100–47%) to the following molecules: sulfonamides, tetracyclines, diaminopyrimidines, penicillins, macrolides, and quinolones (Table 2).
The overall incidence of ESBLs-producing isolates was 46.66% (7/15) (Table 3). All isolates that tested positive for ESBLs were also resistant to more than four antibiotics (multi-drug resistance). Molecular analyses showed that the gene for β lactamase, blaTEM, was present in six serotypes of Salmonella, in particular S. Typhimurium (monophasic) and S. Derby, isolated from swine meat and feces samples; S. Hadar isolated from insects; S. salamae isolated from an abrasive sponge on swine skin; S. houtenae isolated from chicken skin; and S. Cardoner isolated from chicken meat. Meanwhile, blaCTX-M I was found in S. Infantis isolated from chicken meat.

4. Discussion

Salmonella spp. are the main pathogens responsible for food zoonoses in both industrialized and developing countries [9,21,25,26]. About 95% of salmonellosis affecting humans is attributable to the food vehicle; the spread is favored by the wide variety of infection reservoirs and the complexity of the agri-food production chains, both of animal and vegetable origin [27,28]. Livestock has been implicated as a reservoir for antibiotic-resistant bacteria, and foods of animal origin can be vectors of transmission to humans [29]. The antibiotic resistance in Salmonella spp. isolated from animal sources and from their meat has been widely demonstrated, even beyond the serovariates on which the attention of microbiologists and clinicians is focused [29]. In Italy, Salmonella spp. strains showed higher resistance profiles than the European average, with sulfamethoxazole being ineffective in 44.9% of cases, followed by tetracycline (40.4%) and ampicillin (37.4%) [25]. Moreover, the latest EFSA report showed alarming values of resistance to the critically important antimicrobials, ciprofloxacin and cefotaxime and/or ceftazidime, of 18.9% and 23.5–31.6%, respectively [26].
The data gathered from the current survey showed that almost half of the serotypes of Salmonella spp. isolated from biological samples showed resistance towards at least three antibiotics and, among the isolated serotypes, S. Typhimurium, S. Infantis, S. Hadar, S. Derby, and S. Enteritidis showed the highest resistance. Noteworthy, 7 out of 10 Salmonella serotypes (i.e., S. Infantis, S. Typhimurium (monophasic), S. Derby, S. Hadar, S. salamae, S. houtenae, and S. Cardoner) were resistant to clinically important antibiotics such as sulfonamides, tetracyclines, diaminopyrimidines, penicillins, and quinolones, many of which are widely used in human and veterinary medicine. The decreased susceptibility to these conventional drugs suggests advising against their empirical use. Contrariwise, in agreement with previous studies [18,30,31], the third-generation cephalosporins herein tested (cefotaxime and ceftazidime) showed good effectiveness against Salmonella spp., with a sensitivity of 100% in most investigated serotypes. In addition, high resistance was found in a less common Salmonella serotype, namely the S. enterica subspecies salamae, from pig farms, which showed resistance to five antibiotic classes, including ciprofloxacin. Although the use of ciprofloxacin in animal husbandry is reduced, the continuous evidence of the antimicrobial resistance of Salmonella spp. towards this antibiotic are worrying. Worthy data gathered in the current study were the comparable antibiotic resistance profiles of some of the isolated Salmonella serotypes. This finding seems to confirm the ability of bacteria to communicate, and therefore, to share information such as the ability to develop mechanisms to avoid the antibacterial action of certain molecules. It should be pointed out that in livestock systems and, particularly, in intensive farming, the prophylactic use of certain antibiotics is common practice. The administration of small doses of antibiotics to healthy animals causes the microbiota in the guts of animals to become familiar with the drugs and gives them a chance to develop resistance to the given substances [5,32]. The bacteria then share the antibiotic resistance determinants via mobile genetic elements such as plasmids, transposons, integrons, and phages [33,34]. This renders healthy animals carriers of antibiotic-resistant bacteria [35]. Since antibiotic-resistant bacteria are found in the gut, fecal contamination is the main route for the transmission of these pathogens to humans. The environments in which the animals are reared and indirect contact with animals are possible sources of the transmission of resistant zoonotic pathogens to humans [36,37].
A previous epidemiological study from 1999 to 2002 carried out on Sicilian territory reported that Salmonella Enteritidis (39%) was the most prevalent serovar, followed by S. Typhimurium (16%), S. newport (6%), S. salamae (5%), and others. The highest rate of antibiotic resistance was observed in S. Typhimurium [38]. In the last decade, antimicrobial resistance to five antibiotic classes, including penicillins, tetracyclines, sulphonamides, ciprofloxacin, and third-generation cephalosporins, has increased from 20% to 80% in Abruzzo and in Molise (Italy) [39]. Among the numerous serotypes of Salmonella, S. Typhimurium has always represented the ubiquitous type most frequently isolated both in humans and in the animal sector, surpassed only in some periods by emerging serotypes. The interest in the S. Typhimurium serotype is linked not only to its widespread diffusion in nature and the high frequency of infection in humans but also to the appearance of poly-antibiotic-resistant characteristics, as already highlighted in the 1960s. The mechanisms encoded by antimicrobial resistance determinants include antimicrobial modification and inactivation, the alteration of the antimicrobial target site, efflux pumps, and membrane impermeability [40]. These protect the bacteria from being attacked by antibiotics [40].
In particular, Salmonella spp. uses the well-studied AcrAB-TolC efflux pump to extrude antibiotics such as tetracycline, chloramphenicol, and quinolones [41,42]. Bacteria resist antibiotic entry into the cell by reducing or modifying porin channels in the outer membrane, which are used by antibiotic molecules to enter the bacterial cell to reach their targets [43,44]. In addition to their high pathogenic potential, bacteria of the Salmonella genus are of particular interest for their contribution to the spread of antibiotic resistance, as they are able to accumulate and spread antibiotic-resistance genes [45]. Genes that encode antibiotic resistance are either located on the chromosome or plasmids within a bacterial cell and are mobilized by transposons and integrons during conjugation or phages through transduction [34,46]. The genetic plasticity of Salmonella bacteria allows them to accumulate and disseminate antibiotic-resistance genes that often are located in plasmids that also carry other virulence genes [47,48]. Thanks to this characteristic, the genus Salmonella spp. can easily transfer resistance genes horizontally to other bacteria [49]. The molecular analysis of data for the presence of resistance genes highlighted the prevalent presence of blaTEM, whereas blaCTX-M I was found only in a Salmonella Infantis isolated from a chicken meat sample. Bacteria that are resistant to the beta-lactam class of antibiotics produce the beta-lactamase enzyme, which destroys the beta-lactam ring, thus deactivating the antibiotic [50,51]. The blaTEM gene is the most frequently reported worldwide, especially in Gram-negative bacteria. This is assumed to be due to its broad dissemination via migratory waterfowl and the large number of β-lactamase enzymes synthesized by bacteria [52,53]. These findings are a cause for concern considering the associated virulence that these strains, isolated from different sources, are proven to possess, and bearing in mind that Salmonella spp. is capable of considerable persistence under certain conditions [54].

5. Conclusions

Awareness of the consequences of the indiscriminate and unnecessary use of antimicrobials is slowly growing, but numerous studies still report highly virulent and resistant bacteria in areas of human activity. This study reported the results on the antibiotic resistance profiles of 10 different serotypes of Salmonella spp. in circulation in livestock-related samples in Sicily. Moreover, the Salmonella serotypes analyzed here exhibited the presence of blaTEM and blaCTX-M I. The results gathered in the current study confirm the scientific evidence available in the literature, according to which the resistance towards antibiotics is continuously increasing. This represents a worrying perspective since they should be usually used as a last option for therapy against bacterial infections. As a matter of fact, the current study highlights the need for the consolidation of surveillance activities for public health, with two necessary conditions: (I) the integration of veterinary data with those of clinical origin; and (II) the definition of analysis protocols that provide precise selection criteria of the serotypes to be subjected to molecular typing tests, since it is neither possible nor reasonable to extend the execution of very large and expensive analysis panels to all isolates. This information advocates the implementation of surveillance systems and the dissemination of guidelines on the correct use of antibiotics in both human and veterinary medicine, also in view of the ever more current holistic approach of the One Health concept.

Author Contributions

Conceptualization, C.C.; methodology, C.C., V.A., G.S., F.M., S.D.B., A.L., F.A., M.P. and E.G.; software, V.A., G.S., F.M., S.D.B., A.L. and F.A.; validation, A.G.; formal analysis, investigation, V.A., G.S., F.M., S.D.B., A.L. and F.A.; data curation, V.A., G.S., F.M., S.D.B., A.L. and F.A.; writing—original draft preparation, C.C.; writing—review and editing, A.G.; visualization, A.G.; supervision, A.G. and C.C.; project administration, A.G. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the Ministero della Salute (Italy), Ricerca Corrente IZS SI 04/19 RC ‘Caratterizzazione di ceppi di Salmonella antibiotico-resistenti e loro biobanking finalizzato allo studio di nuove molecole antimicrobiche’ (protocol code n. DGSAF-0028890-P, approval date 19th November 2019).

Institutional Review Board Statement

All treatments, housing, and animal care were carried out in accordance with the standards recommended by the European Directive 2010/63/EU for animal experiments.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Cassini, A.; Högberget, L.D.; Plachouras, D.; Quattrocchi, A.; Hoxha, A.; Gunnar, S.S.; Colomb-Cotinat, M.; Kretzschmar, M.E.; Devleesschauwer, B.; Cecchini, M.; et al. Attributable deaths and disability-adjusted life-years caused by infections with antibiotic-resistant bacteria in the EU and the European Economic Area in 2015: A population-level modelling analysis. Lancet Inf. Dis. 2019, 19, 56–66. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Kumar, A.; Pal, D. Antibiotic resistance and wastewater: Correlation, impact and critical human health challenges. J. Environ. Chem. Eng. 2017, 6, 52–58. [Google Scholar] [CrossRef] [Scilit]
  3. Sánchez-Salazar, E.; Gudiño, M.E.; Sevillano, G.; Zurita, J.; Guerrero-López, R.; Jaramillo, K.; Calero-Cáceres, W. Antibiotic resistance of Salmonella strains from layer poultry farms in central Ecuador. J. Appl. Microbiol. 2020, 128, 1347–1354. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Chattopadhyay, M.K. Use of antibiotics as feed additives: A burning question. Front. Microbiol. 2014, 5, 334. [Google Scholar] [CrossRef] [Scilit]
  5. Eagar, H.; Swan, G.; Van Vuuren, M. A survey of antimicrobial usage in animals in South Africa with specific reference to food animals. J. S. Afr. Vet. Assoc. 2012, 83, 15–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. FAO/WHO. Codex Alimentarius. Commission Codex Texts on Foodborne Antimicrobial Resistance. 2015. Available online: http://www.fao.org/3/a-i4296t.pdf (accessed on 12 October 2021).
  7. Tiseo, K.; Huber, L.; Gilbert, M.; Robinson, T.P.; Van Boeckel, T.P. Global Trends in Antimicrobial Use in Food Animals from 2017 to 2030. Antibiotics 2020, 9, 918. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Alessiani, A.; Goffredo, E.; Mancini, M.; Occhiochiuso, G.; Faleo, S.; Didonna, A.; Fischetto, R.; Suglia, F.; De Vito, D.; Stallone, A.; et al. Evaluation of Antimicrobial Resistance in Salmonella Strains Isolated from Food, Animal and Human Samples between 2017 and 2021 in Southern Italy. Microorganisms 2022, 10, 812. [Google Scholar] [CrossRef] [Scilit]
  9. European Food Safety Authority (EFSA). The European Union Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents and Food-Borne Outbreaks in 2016. EFSA J. 2017, 15, e05077. [Google Scholar]
  10. WHO. Salmonella. 2017. Available online: http://www.who.int/foodsafety/areas_work/foodborne-diseases/salmonella/en/ (accessed on 12 October 2021).
  11. Schatten, H.; Eisenstark, A. Salmonella, Methods and Protocols; Humana Press: New York, NY, USA, 2015. [Google Scholar]
  12. Grimont, P.A.; Weill, F.X. Antigenic Formulae of the Salmonella Servovars, 9th ed.; Institut Pasteur: Paris, France, 2007; Volume 13. [Google Scholar]
  13. Emond-Rheault, J.G.; Hamel, J.; Jeukens, J.; Freschi, L.; Kukavica-Ibrulj, I.; Boyle, B.; Tamber, S.; Malo, D.; Franz, E.; Burnett, E.; et al. The Salmonella enterica plasmidome as a reservoir of antibiotic resistance. Microorganisms 2020, 8, 1016. [Google Scholar] [CrossRef] [Scilit]
  14. Foley, S.; Nayak, R.; Hanning, I.B.; Johnson, T.J.; Han, J.; Ricke, S.C. Population dynamics of Salmonella enterica serotypes in commercial egg and poultry production. Appl. Environ. Microbiol. 2011, 77, 4273–4279. [Google Scholar] [CrossRef] [Scilit]
  15. Cosby, D.E.; Cox, N.A.; Harrison, M.A.; Wilson, J.L.; Buhr, R.J.; Fedorka-Cray, P.J. Salmonella and antimicrobial resistance in broilers: A review: Table 1. J. Appl. Poult. Res. 2015, 24, 408–426. [Google Scholar] [CrossRef] [Scilit]
  16. Antunes, P.; Mour~ao, J.; Campos, J.; Peixe, L. Salmonellosis: The role of poultry meat. Clin. Microbiol. Infect. 2016, 22, 110–121. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Liljebjelke, K.A.; Hofacre, C.L.; White, D.G.; Ayers, S.; Lee, M.D.; Maurer, J.J. Diversity of antimicrobial resistance phenotypes in Salmonella isolated from commercial poultry farms. Front. Vet. Sci. 2017, 4, 96. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Khadka, P.; Thapaliya, J.; Thapa, S. Susceptibility pattern of Salmonella enterica against commonly prescribed antibiotics, to febrile-pediatric cases, in low-income countries. BMC Pediatr. 2021, 21, 38. [Google Scholar] [CrossRef] [Scilit]
  19. Mthembu, T.P.; Zishiri, O.T.; El Zowalaty, M.E. Molecular detection of multidrug-resistant Salmonella isolated from livestock production systems in South Africa. Infect. Drug Resist. 2019, 12, 3537–3548. [Google Scholar] [CrossRef] [Scilit]
  20. Jensen, A.N.; Sørensen, G.; Baggesen, D.L.; Bødker, R.; Hoorfar, J. Addition of Novobiocin in pre-enrichment step can improve Salmonella culture protocol of modified semisolid Rappaport-Vassiliadis. J. Microbiol. Methods 2003, 55, 249–255. [Google Scholar] [CrossRef] [Scilit]
  21. Popoff, M.Y.; Le Minor, L. Antigenic Formulas of the Salmonella Serovars; WHO Collaborating Centre for Reference and Research on Salmonella: Paris, France, 1997. [Google Scholar]
  22. Sugumar, M.; Kumar, K.M.; Manoharan, A.; Anbarasu, A.; Ramaiah, S. Detection of OXA-1 β-lactamase gene of Klebsiella pneumoniae from blood stream infections (BSI) by conventional PCR and in-silico analysis to understand the mechanism of OXA mediated resistance. PLoS ONE 2014, 9, e91800. [Google Scholar] [CrossRef] [Scilit]
  23. Kim, J.; Jeon, S.; Rhie, H.; Lee, B.; Park, M.; Lee, H.; Lee, J.; Kim, S. Rapid Detection of Extended Spectrum beta-Lactamase (ESBL) for Enterobacteriaceae by use of a Multiplex PCR-based Method. Infect Chemother. 2009, 41, 181–184. [Google Scholar] [CrossRef] [Scilit]
  24. Gargano, V.; Gambino, D.; Migliore, S.; Vitale, M.; Sciortino, S.; Costa, A.; Vicari, D. Can Human Handling Increase the Presence of Multidrug Resistance (MDR) in Salmonella spp. Isolated from Food Sources? Microorganisms 2021, 9, 2018. [Google Scholar] [CrossRef] [Scilit]
  25. European Food Safety Authority (EFSA); European Centre for Disease Prevention and Control (ECDC). The European Union Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents and Food-borne Outbreaks in 2017. EFSA J. 2018, 16, e05500. [Google Scholar]
  26. European Food Safety Authority (EFSA); European Centre for Disease Prevention and Control. The European Union One Health 2019 Zoonoses Report. EFSA J. 2021, 19, e06406. [Google Scholar]
  27. Murakami, K.; Horikawa, K.; Ito, T.; Otsuki, K. Environmental survey of Salmonella and comparison of genotypic character with human isolates in Western Japan. Epidemiol. Infect. 2001, 126, 159–171. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Rumyantsev, S. Toward molecular level of the “Salmonella-Victim” Ecology, Genetics, and Evolution. Sci. World J. 2004, 4, 193–199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Van den Bogaard, A.E.; Stobberingh, E.E. Epidemiology of resistance to antibiotics: Links between animals and humans. Intern. J. Antimicr. Agents 2000, 4, 327–335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Crump, J.A.; Sjölund-Karlsson, M.; Gordon, M.A.; Parry, C.M. Epidemiology, clinical presentation, laboratory diagnosis, antimicrobial resistance, and antimicrobial management of invasive Salmonella infections. Clin. Microbiol. Rev. 2015, 28, 901–937. [Google Scholar] [CrossRef] [Scilit]
  31. Kariuki, S.; Gordon, M.A.; Feasey, N.; Parry, C.M. Antimicrobial resistance and management of invasive Salmonella disease. Vaccine. 2015, 33, C21–C29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. van Vuuren, M. Bacterial resistance against antibiotics: Global and local trends. Stockfarm 2017, 7, 51. [Google Scholar]
  33. Gillings, M.R. Integrons: Past, present, and future. Microbiol. Mol. Biol. Rev. 2014, 78, 257–277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Hall, R.M. Integrons and gene cassettes: Hotspots of diversity in bacterial genomes. Ann. N. Y. Acad. Sci. 2012, 1267, 71–78. [Google Scholar] [CrossRef] [Scilit]
  35. Marshall, B.M.; Levy, S.B. Food animals and antimicrobials: Impacts on human health. Clin. Microbiol. Rev. 2011, 24, 718–733. [Google Scholar] [CrossRef] [Scilit]
  36. Tauxe, R.V. Emerging foodborne pathogens. Int. J. Food Microbiol. 2002, 78, 31–41. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Dhama, K.; Rajagunalan, S.; Chakraborty, S.; Verma, A.K.; Kumar, A.; Tiwari, R.; Kapoor, S. Food-borne pathogens of animal origin-diagnosis, prevention, control and their zoonotic significance: A review. Pak. J. Biol. Sci. 2013, 15, 1076–1085. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Bellissima, P.; Amato, R.; Aurnia, G.; Cannizzo, R.; Bonfante, S. Epidemiology of salmonellosis in Caltagirone area (Sicily). Infez. Med. 2004, 12, 60–64. [Google Scholar] [PubMed]
  39. Di Marcantonio, L.; Romantini, R.; Marotta, F.; Chiaverini, A.; Zilli, K.; Abass, A.; Di Giannatale, E.; Garofolo, G.; Janowicz, A. The Current Landscape of Antibiotic Resistance of Salmonella Infantis in Italy: The Expansion of Extended-Spectrum Beta-Lactamase Producers on a Local Scale. Front. Microbiol. 2022, 13, 812481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Frye, J.G.; Jackson, C.R. Genetic mechanisms of antimicrobial resistance identified in Salmonella enterica, Escherichia coli, and Enteroccocus spp. isolated from US food animals. Front. Microbiol. 2013, 4, 135. [Google Scholar] [CrossRef] [Scilit]
  41. Parry, C.M.; Threlfall, E. Antimicrobial resistance in typhoidal and nontyphoidal Salmonellae. Curr. Opin. Infect. Dis. 2008, 21, 531–538. [Google Scholar] [CrossRef] [Scilit]
  42. Sun, J.; Deng, Z.; Yan, A. Bacterial multidrug efflux pumps: Mechanisms, physiology and pharmacological exploitations. Biochem. Biophys. Res. Commun. 2014, 453, 254–267. [Google Scholar] [CrossRef] [Scilit]
  43. Delcour, A.H. Outer membrane permeability and antibiotic resistance. Biochim. Biophys. Acta 2009, 1794, 808–816. [Google Scholar] [CrossRef] [Scilit]
  44. van der Heijden, J.; Reynolds, L.A.; Deng, W.; Mills, A.; Scholz, R.; Imami, K.; Foster, L.J.; Duong, F.; Finlay, B.B. Salmonella rapidly regulates membrane permeability to survive oxidative stress. MBio 2016, 7, e01216–e01238. [Google Scholar] [CrossRef] [Scilit]
  45. McDermott, P.F.; Zhao, S.; Tate, H. Antimicrobial Resistance in Nontyphoidal Salmonella. Microbiol. Spectr. 2018, 6, ARBA-0014-2017. [Google Scholar] [CrossRef] [Scilit]
  46. Guerra, B.; Soto, S.; Helmuth, R.; Mendoza, M.C. Characterization of a self-transferable plasmid from Salmonella enterica serotype Typhimurium clinical isolates carrying two integron-borne gene cassettes together with virulence and drug resistance genes. Antimicrob. Agents Chemother. 2002, 46, 2977–2981. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Lian, X.; Wang, X.; Liu, X.; Xia, J.; Fang, L.; Sun, J.; Liao, X.; Liu, Y. OqxAB-Positive IncHI2 Plasmid PHXY0908 Increase Salmonella enterica serotype typhimurium strains tolerance to ciprofloxacin. Front. Cell. Infect. Microbiol. 2019, 9, 242. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Soares, F.B.; Camargo, C.H.; Cunha, M.P.V.; de Almeida, E.A.; de Jesus, A.M.B.; de Carvalho, E.; de Paiva, J.B.; Fernandes, S.A.; Tiba-Casas, M.R. Subtyping of plasmid-mediated quinolone resistance among Salmonella serotypes by whole genome sequencing. Diagn. Microbiol. Infect. Dis. 2019, 94, 403–406. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Munita, J.M.; Arias, C.A. Mechanisms of Antibiotic Resistance. Microbiol. Spectr. 2016, 4, 4.2.15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Aminov, R.I. The role of antibiotics and antibiotic resistance in nature. Environ. Microbiol. 2009, 11, 2970–2988. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  51. Bush, K.; Bradford, P.A. β-Lactams and β-lactamase inhibitors: An overview. Cold Spring Harb. Perspect. Med. 2016, 6, a025247. [Google Scholar] [CrossRef] [Scilit]
  52. Jang, J.; Suh, Y.S.; Di, D.Y.; Unno, T.; Sadowsky, M.J.; Hur, H.G. Pathogenic Escherichia coli strains producing extended-spectrum β-lactamases in the Yeongsan River Basin of South Korea. Environ. Sci. Technol. 2012, 47, 1128–1136. [Google Scholar] [CrossRef] [Scilit]
  53. Ouedraogo, S.A.; Sanou, M.; Kissou, A.; Sanou, S.; Solaré, H.; Kaboré, F.; Poda, A.; Aberkane, S.; Bouzinbi, N.; Sano, I.; et al. High prevalence of extended-spectrum β-lactamase producing enterobacteriaceae among clinical isolates in Burkina Faso. BMC Infect. Dis. 2016, 16, 326. [Google Scholar] [CrossRef] [Scilit]
  54. Wales, A.; Davies, R.H. Environmental aspects of Salmonella. In Salmonella in Domestic Animals; Barrow, P.A., Methner, U., Eds.; Centre for Agriculture and Bioscience International (CABI): Wallingford, UK, 2013. [Google Scholar]
Table 1. Target gene, sequence, and amplicon size of forward and reverse primers used for the two separate multiplex PCR reactions (Set 1 detecting β-lactamases blaCTX-M IV, TEM, OXA, and SHV; Set 2 detecting the β-lactamases blaCMY II, CTX-M I, CTX-M II, and DHA).
Table 1. Target gene, sequence, and amplicon size of forward and reverse primers used for the two separate multiplex PCR reactions (Set 1 detecting β-lactamases blaCTX-M IV, TEM, OXA, and SHV; Set 2 detecting the β-lactamases blaCMY II, CTX-M I, CTX-M II, and DHA).
Target GenePrimer Sequence (5′ → 3′)Amplicon Size (bp)Ref
Set 1CTX-M IV FGACAAAGAGAGTGCAACGGATG501[23]
CTX-M IV RTCAGTGCGATCCAGACGAAA
TEM FAGTGCTGCCATAACCATGAGTG431
TEM RCTGACTCCCC GTCGTGTAGATA
OXA FATTATCTACAGCAGCGCCAGTG296
OXA RTGCATCCACGTCTTTGGTG
SHV FATTATCTACAGCAGCGCCAGTG214
SHV RCGCTGTTATCGCTCATGGTAA
Set 2CMY II FAGCGATCCGGTCACGAAATA695[23]
CMY II RCCCGTTTTATG CACCCATGA
CTX M I FTCCAGAATAAGGAATCCCATGG621
CTX M I RTGCTTTACCCAGCGTCAGAT
CTX M II FACCGCCGATAATTCGCAGAT588
CTX M II RGATATCGTTGGTGGTGCCATAA
DHA FGTGGTGGACAGCACCATTAAA314
DHA RCCTGCGGTATAGGTAGCCAGAT
Table 2. Antibiotic susceptibility results for Salmonella serotypes from different hosts and sources, obtained by means of the minimum inhibitory concentration (MIC) method. The following antibiotic drugs were tested: sulfamethoxazole (SMX), azithromycin (AZI), tigecycline (TGC), tetracyclines (TET), nalidixic acid (NAL), trimethoprim (TMP), ampicillin (AMP), ciprofloxacin (CIP), chloramphenicol (CHL), meropenem (MERO), cefotaxime (FOT), ceftazidime (TAZ), colistin (COL), and gentamicin (GEN). Resistances are represented in bold. EUCAST breakpoints are reported in red.
Table 2. Antibiotic susceptibility results for Salmonella serotypes from different hosts and sources, obtained by means of the minimum inhibitory concentration (MIC) method. The following antibiotic drugs were tested: sulfamethoxazole (SMX), azithromycin (AZI), tigecycline (TGC), tetracyclines (TET), nalidixic acid (NAL), trimethoprim (TMP), ampicillin (AMP), ciprofloxacin (CIP), chloramphenicol (CHL), meropenem (MERO), cefotaxime (FOT), ceftazidime (TAZ), colistin (COL), and gentamicin (GEN). Resistances are represented in bold. EUCAST breakpoints are reported in red.
Salmonella serotypes Host
Species/Source
Antibiotic Drugs
Breakpoint EUCAST
SMXAZITGCTETNALTMPAMPCIPCHLMEROFOTTAZCOLGEN
S ≤ 2
R ≥ 4
---S ≤ 0.5
R ≥ 0.5
-------S ≤ 4
R ≥ 4
S ≤ 8
R ≥ 8
S ≤ 0.06
R ≥ 0.06
S ≤ 8
R ≥ 8
S ≤ 2
R ≥ 8
S ≤ 1
R ≥ 2
S ≤ 1
R ≥ 4
S ≤ 2
R ≥ 2
S ≤ 2
R ≥ 2
S. TyphimuriumCattle/feces≥1024≥16≥0.5≥64≥32≥2≥64≥0.25≥32≥16≤0.50≥10
S. CorvallisCattle/meat≥16≥4≥0.5000≤1≤0.0150≤0.1200≤1≤0.5
S. DerbyPig/feces≥1024≥4≥0.5≥16≥128≥32≥64≥0.12≥64≤1≥4≥100
S. HadarInsect≥512≥4≥0.5≥32≥128≥16≥64≥40≤0.120000
S. salamaePig/skin≥128≥64≥8≥16≥32≥32≥64≥0.12≥64≥1≥4≥2≤1≤2
S. houtenaeChicken/skin≥1024≥32≥2≥16≥128≥32≥64≥8≥64≤0.0300≥16≤0.5
S. EnteritidisChicken/feces≥32≥64≥0.5≥64≥80≤1≥20≥200≥2≤2
S. CorvallisChicken/feather≥8≥4≥0.5≥2000≤0.0150≤0.0300≤10
S. InfantisPig/feces≥16≥8≥2≥2≥1280≤1≥0.5≥16≤0.0300≤10
S. CorvallisGoat/milk≥8≥4≥1000≤2≤0.0150000≥20
S. DerbyCattle/feces≥8≥4≥8≥2≥64≤0.25≤1≤0.015≥16≤0.030≥4≤10
S. TyphimuriumPig/meat≥8≥2≥0.500≥8≤1≤0.03000000
S. CardonerChicken/meat≥64≥64≥8≥40≥4≥1600≥800≥16≥8
S. VenezianaChicken/meat≥8≥4≤0.2500≤0.25 ≤1≤0.015000000
S. InfantisChicken/meat≥1024≥4≥1≥32≥128≥32≥64≥0.1200≥1≥200
Table 3. ESBLs genotype of Salmonella strains.
Table 3. ESBLs genotype of Salmonella strains.
ESLB Genes
Salmonella serotypesTEMOXASHVDHACTXM-1CTXM-2CTXM-4CMY-2EHXA
S. Typhimurium+--------
S. Corvallis---------
S. Derby+--------
S. Hadar+--------
S. salamae+--------
S. houtenae+--------
S. Enteritidis---------
S. Corvallis---------
S. Infantis---------
S. Corvallis---------
S. Derby---------
S. Typhimurium---------
S. Cardoner+--------
S. Veneziana---------
S. Infantis----+----
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Castronovo, C.; Agozzino, V.; Schirò, G.; Mira, F.; Di Bella, S.; Lastra, A.; Antoci, F.; Pennisi, M.; Giudice, E.; Guercio, A. Evaluation of the Antimicrobial Resistance of Different Serotypes of Salmonella enterica from Livestock Farms in Southern Italy. Appl. Sci. 2023, 13, 442. https://doi.org/10.3390/app13010442

AMA Style

Castronovo C, Agozzino V, Schirò G, Mira F, Di Bella S, Lastra A, Antoci F, Pennisi M, Giudice E, Guercio A. Evaluation of the Antimicrobial Resistance of Different Serotypes of Salmonella enterica from Livestock Farms in Southern Italy. Applied Sciences. 2023; 13(1):442. https://doi.org/10.3390/app13010442

Chicago/Turabian Style

Castronovo, Calogero, Vincenzo Agozzino, Giorgia Schirò, Francesco Mira, Santina Di Bella, Antonio Lastra, Francesco Antoci, Melissa Pennisi, Elisabetta Giudice, and Annalisa Guercio. 2023. "Evaluation of the Antimicrobial Resistance of Different Serotypes of Salmonella enterica from Livestock Farms in Southern Italy" Applied Sciences 13, no. 1: 442. https://doi.org/10.3390/app13010442

APA Style

Castronovo, C., Agozzino, V., Schirò, G., Mira, F., Di Bella, S., Lastra, A., Antoci, F., Pennisi, M., Giudice, E., & Guercio, A. (2023). Evaluation of the Antimicrobial Resistance of Different Serotypes of Salmonella enterica from Livestock Farms in Southern Italy. Applied Sciences, 13(1), 442. https://doi.org/10.3390/app13010442

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop