Nanoencapsulated Boron Foliar Supply Increased Expression of NIPs Aquaporins and BOR Transporters of In Vitro Ipomoea batatas Plants
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Growth
2.2. Analysis of Mineral Nutrients
2.3. Pigment Analysis
2.4. Metabolomic Analysis
2.5. Aquaporin and BOR Primers Design and Expression
2.6. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Nguyen, H.; Chen, C.-C.; Lin, K.-H.; Chao, P.-Y.; Lin, H.-H.; Huang, M.-Y. Bioactive Compounds, Antioxidants, and Health Benefits of Sweet Potato Leaves. Molecules 2021, 26, 1820. [Google Scholar] [CrossRef]
- Bovell-Benjamin, A.C. Sweet Potato: A Review of its Past, Present, and Future Role in Human Nutrition. Adv. Food Nutr. Res. 2007, 52, 1–59. [Google Scholar]
- Echer, F.R.; Dominato, J.C.; Creste, J.E.; Santos, D.H. Fertilization with boron and potassium on sweet potato nutrition and yield. Hortic. Bras. 2009, 27, 171–175. [Google Scholar] [CrossRef] [Green Version]
- Smith, M.; Drew, R. Current Applications of Tissue Culture in Plant Propagation and Improvement. Funct. Plant Biol. 1990, 17, 267–289. [Google Scholar] [CrossRef]
- Ruta, C.; Lambardi, M.; Ozudogru, E.A. Biobanking of vegetable genetic resources by in vitro conservation and cryopreservation. Biodivers. Conserv. 2020, 29, 3495–3532. [Google Scholar] [CrossRef]
- Mycock, D.; Blakeway, F.; Watt, M.; Bornman, C. General applicability of in vitro storage technology to the conservation and maintenance of plant germplasm. S. Afr. J. Bot. 2004, 70, 31–36. [Google Scholar] [CrossRef] [Green Version]
- Lambardi, M.; National, I.; Jain, S.M. Protocols for Micropropagation of Selected Economically-Important Horticultural Plants; Humana Press: Totowa, NJ, USA, 2013; Volume 994, ISBN 978-1-62703-073-1. [Google Scholar]
- Kapilan, R.; Vaziri, M.; Zwiazek, J.J. Regulation of aquaporins in plants under stress. Biol. Res. 2018, 51, 4. [Google Scholar] [CrossRef]
- Murata, K.; Mitsuoka, K.; Hirai, T.; Walz, T.; Agre, P.; Heymann, B.; Engel, A.K.; Fujiyoshi, Y. Structural determinants of water permeation through aquaporin-1. Nature 2000, 407, 599–605. [Google Scholar] [CrossRef]
- Maurel, C.; Boursiac, Y.; Luu, D.T.; Santoni, V.; Shahzad, Z.; Verdoucq, L. Aquaporins in Plants. Physiol. Rev. 2015, 95, 1321–1358. [Google Scholar] [CrossRef]
- Sui, H.; Han, B.-G.; Lee, J.K.; Walian, P.J.; Jap, B.K. Structural basis of water-specific transport through the AQP1 water channel. Nature 2001, 414, 872–878. [Google Scholar] [CrossRef] [Green Version]
- Froger, A.; Thomas, D.; Delamarche, C.; Tallur, B. Prediction of functional residues in water channels and related proteins. Protein Sci. 1998, 7, 1458–1468. [Google Scholar] [CrossRef] [Green Version]
- Curticăpean, M.-C. Plant Aquaporins. Acta Biol. Marisiensis 2019, 2, 36–48. [Google Scholar] [CrossRef] [Green Version]
- del Carmen Martinez-Ballesta, M.; Carvajal, M. New challenges in plant aquaporin biotechnology. Plant Sci. 2014, 217–218, 71–77. [Google Scholar] [CrossRef]
- Lopez-Zaplana, A.; Nicolas-Espinosa, J.; Carvajal, M.; Bárzana, G. Genome-wide analysis of the aquaporin genes in melon (Cucumis melo L.). Sci. Rep. 2020, 10, 22240. [Google Scholar] [CrossRef]
- Tanaka, M.; Fujiwara, T. Physiological roles and transport mechanisms of boron: Perspectives from plants. Pflügers Arch.-Eur. J. Physiol. 2008, 456, 671–677. [Google Scholar] [CrossRef]
- Dannel, F.; Pfeffer, H.; Römheld, V. Characterization of root boron pools, boron uptake and boron translocation in sunflower using the stable isotopes 10 B and 11 B. Funct. Plant Biol. 2000, 27, 397–405. [Google Scholar] [CrossRef]
- Poschenrieder, C.; Busoms, S.; Barceló, J. How Plants Handle Trivalent (+3) Elements. Int. J. Mol. Sci. 2019, 20, 3984. [Google Scholar] [CrossRef] [Green Version]
- Kato, Y.; Miwa, K.; Takano, J.; Wada, M.; Fujiwara, T. Highly Boron Deficiency-Tolerant Plants Generated by Enhanced Expression of NIP5;1, a Boric Acid Channel. Plant Cell Physiol. 2009, 50, 58–66. [Google Scholar] [CrossRef] [Green Version]
- Schnurbusch, T.; Hayes, J.; Hrmova, M.; Baumann, U.; Ramesh, S.; Tyerman, S.; Langridge, P.; Sutton, T. Boron Toxicity Tolerance in Barley through Reduced Expression of the Multifunctional Aquaporin HvNIP2;1. Plant Physiol. 2010, 153, 1706–1715. [Google Scholar] [CrossRef] [Green Version]
- Hanaoka, H. Fujiwara Channel-mediated boron transport in rice. Plant Cell Physiol. 2007, 48, 844. [Google Scholar]
- Du, W.; Pan, Z.-Y.; Hussain, S.B.; Han, Z.-X.; Peng, S.-A.; Liu, Y.-Z. Foliar Supplied Boron Can Be Transported to Roots as a Boron-Sucrose Complex via Phloem in Citrus Trees. Front. Plant Sci. 2020, 11, 250. [Google Scholar] [CrossRef]
- Rios, J.J.; Yepes-Molina, L.; Martinez-Alonso, A.; Carvajal, M. Nanobiofertilization as a novel technology for highly efficient foliar application of Fe and B in almond trees. R. Soc. Open Sci. 2020, 7, 200905. [Google Scholar] [CrossRef]
- Rios, J.J.; Lopez-Zaplana, A.; Bárzana, G.; Martinez-Alonso, A.; Carvajal, M. Foliar Application of Boron Nanoencapsulated in Almond Trees Allows B Movement Within Tree and Implements Water Uptake and Transport Involving Aquaporins. Front. Plant Sci. 2021, 12, 2373. [Google Scholar] [CrossRef]
- Yepes-Molina, L.; Martínez-Ballesta, M.C.; Carvajal, M. Plant plasma membrane vesicles interaction with keratinocytes reveals their potential as carriers. J. Adv. Res. 2020, 23, 101–111. [Google Scholar] [CrossRef]
- Rios, J.J.; Ibáñez, P.G.; Carvajal, M. The use of biovesicles to improve the efficiency of Zn foliar fertilization. Colloids Surf. B Biointerfaces 2019, 173, 899–905. [Google Scholar] [CrossRef]
- Arnon, D.I. Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Beta vulgaris. Plant Physiol. 1949, 24, 1–15. [Google Scholar] [CrossRef] [Green Version]
- Choi, Y.H.; Kim, H.K.; Hazekamp, A.; Erkelens, C.; Lefeber, A.A.W.M.; Verpoorte, R. Metabolomic Differentiation of Cannabis sativa Cultivars Using 1H NMR Spectroscopy and Principal Component Analysis. J. Nat. Prod. 2004, 67, 953–957. [Google Scholar] [CrossRef]
- Choi, Y.H.; Kim, H.K.; Linthorst, H.J.M.; Hollander, J.G.; Lefeber, A.W.M.; Erkelens, C.; Nuzillard, A.J.-M.; Verpoorte, R. NMR Metabolomics to Revisit the Tobacco Mosaic Virus Infection in Nicotiana tabacum Leaves. J. Nat. Prod. 2006, 69, 742–748. [Google Scholar] [CrossRef]
- Wu, S.; Lau, K.H.; Cao, Q.; Hamilton, J.P.; Sun, H.; Zhou, C.; Eserman, L.; Gemenet, D.C.; Olukolu, B.A.; Wang, H.; et al. Genome sequences of two diploid wild relatives of cultivated sweetpotato reveal targets for genetic improvement. Nat. Commun. 2018, 9, 4580. [Google Scholar] [CrossRef] [Green Version]
- Isobe, S.; Shirasawa, K.; Hirakawa, H. Current status in whole genome sequencing and analysis of Ipomoea spp. Plant Cell Rep. 2019, 38, 1365–1371. [Google Scholar] [CrossRef] [Green Version]
- GuoLiang, L.; Guochun, X.; Zhaomiao, L.; Huawei, L.; Zhonghua, L.; Yongqing, X.; Hong, Z.; Rongchang, J.; Wenbin, L.; Yongxiang, Q.; et al. Selection of suitable reference genes for RT-qPCR normalisation in sweet potato (Ipomoea batatas L.) under different stresses. J. Hortic. Sci. Biotechnol. 2020, 96, 209–219. [Google Scholar] [CrossRef]
- Ramakers, C.; Ruijter, J.M.; Deprez, R.H.L.; Moorman, A.F.M. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci. Lett. 2003, 339, 62–66. [Google Scholar] [CrossRef]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, research0034. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Brown, P.H.; Bellaloui, N.; Wimmer, M.A.; Bassil, E.S.; Ruiz, J.; Hu, H.; Pfeffer, H.; Dannel, F.; Römheld, V. Boron in Plant Biology. Plant Biol. 2002, 4, 205–223. [Google Scholar] [CrossRef]
- Zahedi, S.M.; Karimi, M.; Da Silva, J.A.T. The use of nanotechnology to increase quality and yield of fruit crops. J. Sci. Food Agric. 2020, 100, 25–31. [Google Scholar] [CrossRef]
- Barrios, A.C.; Rico, C.; Trujillo-Reyes, J.; Medina-Velo, I.A.; Peralta-Videa, J.R.; Gardea-Torresdey, J.L. Effects of uncoated and citric acid coated cerium oxide nanoparticles, bulk cerium oxide, cerium acetate, and citric acid on tomato plants. Sci. Total Environ. 2016, 563–564, 956–964. [Google Scholar] [CrossRef] [Green Version]
- Cakmak, I.; Kutman, U.B. Agronomic biofortification of cereals with zinc: A review. Eur. J. Soil Sci. 2018, 69, 172–180. [Google Scholar] [CrossRef] [Green Version]
- Hao, B.; Ma, J.; Jiang, L.; Wang, X.; Bai, Y.; Zhou, C.; Ren, S.; Li, C.; Wang, Z. Effects of foliar application of micronutrients on concentration and bioavailability of zinc and iron in wheat landraces and cultivars. Sci. Rep. 2021, 11, 22782. [Google Scholar] [CrossRef]
- Connolly, E.L.; Fett, J.; Guerinot, M.L. Expression of the IRT1 Metal Transporter Is Controlled by Metals at the Levels of Transcript and Protein Accumulation. Plant Cell 2002, 14, 1347–1357. [Google Scholar] [CrossRef] [Green Version]
- Barberon, M.; Zelazny, E.; Robert, S.; Conéjéro, G.; Curie, C.; Friml, J.; Vert, G. Monoubiquitin-dependent endocytosis of the IRON-REGULATED TRANSPORTER 1 (IRT1) transporter controls iron uptake in plants. Proc. Natl. Acad. Sci. USA 2011, 108, E450–E458. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takano, J.; Wada, M.; Ludewig, U.; Schaaf, G.; von Wirén, N.; Fujiwara, T. The Arabidopsis Major Intrinsic Protein NIP5;1 Is Essential for Efficient Boron Uptake and Plant Development under Boron Limitation. Plant Cell 2006, 18, 1498–1509. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tanaka, M.; Takano, J.; Chiba, Y.; Lombardo, F.; Ogasawara, Y.; Onouchi, H.; Naito, S.; Fujiwara, T. Boron-Dependent Degradation ofNIP5;1mRNA for Acclimation to Excess Boron Conditions inArabidopsis. Plant Cell 2011, 23, 3547–3559. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sasaki, A.; Yamaji, N.; Yokosho, K.; Ma, J.F. Nramp5 Is a Major Transporter Responsible for Manganese and Cadmium Uptake in Rice. Plant Cell 2012, 24, 2155–2167. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yamaji, N.; Sasaki, A.; Xia, J.X.; Yokosho, K.; Ma, J.F. A node-based switch for preferential distribution of manganese in rice. Nat. Commun. 2013, 4, 2442. [Google Scholar] [CrossRef] [PubMed]
- Bariya, H.; Bagtharia, S.; Patel, A. Boron: A Promising Nutrient for Increasing Growth and Yield of Plants. Plant Ecophysiol. 2014, 10, 153–170. [Google Scholar] [CrossRef]
- Nasef, M.A.; Badran, N.M.; Abd El-Hamide, A.F. Response of peanut to foliar spray with boron and/or rhizobium inoculation. J. Appl. Sci. Res. 2006, 2, 1330–1337. [Google Scholar]
- Lanquar, V.; Ramos, M.S.; Lelièvre, F.; Barbier-Brygoo, H.; Krieger-Liszkay, A.; Kraemer, U.; Thomine, S. Export of Vacuolar Manganese by AtNRAMP3 and AtNRAMP4 Is Required for Optimal Photosynthesis and Growth under Manganese Deficiency. Plant Physiol. 2010, 152, 1986–1999. [Google Scholar] [CrossRef] [Green Version]
- Che, J.; Yamaji, N.; Ma, J.F. Efficient and flexible uptake system for mineral elements in plants. New Phytol. 2018, 219, 513–517. [Google Scholar] [CrossRef]
- Igamberdiev, A.; Rodionova, M. Effect of glycolate pathway intermediates on succinate metabolization in maize and wheat leaves incubated in the dark. Fiziol. Rastenij 1992, 39, 126–134. [Google Scholar]
- Zhang, Z.; Huang, J.; Gao, Y.; Liu, Y.; Li, J.; Zhou, X.; Yao, C.; Wang, Z.; Sun, Z.; Zhang, Y. Suppressed ABA signal transduction in the spike promotes sucrose use in the stem and reduces grain number in wheat under water stress. J. Exp. Bot. 2020, 71, 7241–7256. [Google Scholar] [CrossRef] [PubMed]
- Du, X.; Zhang, X.; Xi, M.; Kong, L. Split application enhances sweetpotato starch production by regulating the conversion of sucrose to starch under reduced nitrogen supply. Plant Physiol. Biochem. 2020, 151, 743–750. [Google Scholar] [CrossRef] [PubMed]
- Pommerrenig, B.; Diehn, T.A.; Bienert, G.P. Metalloido-porins: Essentiality of Nodulin 26-like intrinsic proteins in metalloid transport. Plant Sci. 2015, 238, 212–227. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Porquet, A.; Filella, M. Structural Evidence of the Similarity of Sb(OH)3 and As(OH)3 with Glycerol: Implications for Their Uptake. Chem. Res. Toxicol. 2007, 20, 1269–1276. [Google Scholar] [CrossRef]
- Tanaka, M.; Wallace, I.S.; Takano, J.; Roberts, D.M.; Fujiwara, T. NIP6;1 Is a Boric Acid Channel for Preferential Transport of Boron to Growing Shoot Tissues inArabidopsis. Plant Cell 2008, 20, 2860–2875. [Google Scholar] [CrossRef] [Green Version]
Gene Name | Forward (3′-5′) | Reverse (3′-5′) |
---|---|---|
IbNIP1;1 | CATGCTCTACACCGTCG | GGTCCCAGTTGCTAGAG |
IbNIP1;2 | GCAAGGAGTTTGGGTCC | CCTGAGGATGTTGTAGACC |
IbNIP1;3 | TGATGGCAGAGAGTAATGG | GGAGAGTGAAGATGAAATCG |
IbNIP2;1 | GGAGAATGAAGACGGAAAGG | TCACAAACACCAACAAATACG |
IbNIP4;1 | CTGGAGCGTCAATGAACC | TGTGAGTGAGTTTAAGCACG |
IbNIP4;2 | CATTCAAAAGATGATTGCTGAG | CATAACCATGATGACCAAACC |
IbNIP5;1 | AATACGAGGCTGCTAGAGC | CTGGATTCCGATCACACG |
IbNIP5;2 | GACTGGCAGTTATGATTGTG | ATGGGAAGTGACGAAACG |
IbNIP5;3 | CGTGTCTCACCGATTTTCC | GCATTCCCAATCAACGACT |
IbNIP6;1 | AGAAAGGTGGGAGCAGAG | GGTTGACAATGGCTGTGG |
IbNIP7;1 | TATGATGACAAGACCACTCC | TCCAACAACAAATCCTGC |
IbBOR1 | CGTGGCATCACAACTTGCTC | TGACACCATTTGATGGCGGA |
IbBOR1L | CTTGCATGGACTGGATGGGT | ATCCCAAACAGCTCTCCAGC |
IbBOR2 | TATCGGAGCATGCAAGAAGC | GCACCAATGTGCCCTGTACT |
IbBOR4 | ATGGGCTGCTAGGGGTCATA | CTGAACCAGCCTGTGCCATA |
IbBOR7;1 | CGTCTGCTCTTCCGGTCATT | TGCCGGCAAAAGTGTACAGA |
IbACT | TGCCTGATGGACAAGTGA | GGAGCGAGTGCTGTAATT |
Treatments | |||
---|---|---|---|
Metabolites [mM] | C | FB | EB |
Citric acid | 0.800 ± 0.286 | 0.440 ± 0.149 | 0.953 ± 0.334 |
Formic acid | 8.283 ± 0.707 a | 5.777 ± 0.656 a | 14.490 ± 1.643 b |
Malic acid | 2.380 ± 0.882 | 0.970 ± 0.216 | 2.680 ± 1.097 |
Alanine | 0.960 ± 0.182 | 0.620 ± 0.029 | 0.910 ± 0.208 |
Arginine | 8.533 ± 0.757 | 7.980 ± 0.723 | 8.220 ± 0.730 |
Asparagine | 19.850 ± 2.158 a | 36.583 ± 3.704 b | 43.107 ± 6.709 b |
Glutamine | 3.847 ± 1.178 | 6.020 ± 1.075 | 6.017 ± 1.021 |
Isoleucine | 0.167 ± 0.009 b | 0.107 ± 0.012 a | 0.187 ± 0.017 b |
Leucine | 0.180 ± 0.021 | 0.137 ± 0.012 | 0.197 ± 0.041 |
Phenylalanine | 0.203 ± 0.032 | 0.163 ± 0.026 | 0.257 ± 0.048 |
Threonine | 0.510 ± 0.021 b | 0.467 ± 0.033 a | 0.593 ± 0.064 b |
Tryptophan | 0.387 ± 0.044 | 0.323 ± 0.074 | 0.443 ± 0.050 |
Tyrosine | 0.133 ± 0.009 | 0.083 ± 0.019 | 0.133 ± 0.034 |
Valine | 0.220 ± 0.012 a | 0.197 ± 0.017 a | 0.313 ± 0.052 b |
Fructose | 2.783 ± 0.752 a | 2.993 ± 0.908 a | 8.000 ± 1.631 b |
Glucose | 2.040 ± 0.517 a | 3.040 ± 0.364 a | 5.687 ± 1.310 b |
Myo-inositol | 0.277 ± 0.078 | 0.410 ± 0.191 | 0.650 ± 0.120 |
Sucrose | 1.847 ± 0.247 b | 2.163 ± 0.353 b | 0.473 ± 0.046 a |
UDP glucose | 0.033 ± 0.003 | 0.037 ± 0.003 | 0.030 ± 0.006 |
Betaine | 0.680 ± 0.095 | 0.433 ± 0.071 | 0.540 ± 0.117 |
Choline | 0.670 ± 0.110 | 0.470 ± 0.062 | 0.697 ± 0.162 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nicolas-Espinosa, J.; Garcia-Gomez, P.; Rios, J.J.; Piqueras, A.; Bárzana, G.; Carvajal, M. Nanoencapsulated Boron Foliar Supply Increased Expression of NIPs Aquaporins and BOR Transporters of In Vitro Ipomoea batatas Plants. Appl. Sci. 2022, 12, 1788. https://doi.org/10.3390/app12041788
Nicolas-Espinosa J, Garcia-Gomez P, Rios JJ, Piqueras A, Bárzana G, Carvajal M. Nanoencapsulated Boron Foliar Supply Increased Expression of NIPs Aquaporins and BOR Transporters of In Vitro Ipomoea batatas Plants. Applied Sciences. 2022; 12(4):1788. https://doi.org/10.3390/app12041788
Chicago/Turabian StyleNicolas-Espinosa, Juan, Pablo Garcia-Gomez, Juan J. Rios, Abel Piqueras, Gloria Bárzana, and Micaela Carvajal. 2022. "Nanoencapsulated Boron Foliar Supply Increased Expression of NIPs Aquaporins and BOR Transporters of In Vitro Ipomoea batatas Plants" Applied Sciences 12, no. 4: 1788. https://doi.org/10.3390/app12041788
APA StyleNicolas-Espinosa, J., Garcia-Gomez, P., Rios, J. J., Piqueras, A., Bárzana, G., & Carvajal, M. (2022). Nanoencapsulated Boron Foliar Supply Increased Expression of NIPs Aquaporins and BOR Transporters of In Vitro Ipomoea batatas Plants. Applied Sciences, 12(4), 1788. https://doi.org/10.3390/app12041788