Operational Characteristics of Immobilized Ochrobactrum sp. CUST210-1 Biosystem and Immobilized Chromate Reductase Biosystem in Continuously Treating Actual Chromium-Containing Wastewater
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Distribution of Chromium (VI) Reduction Products
2.3. Separation and Purification of Chromate Reductase
2.4. Analysis of Genes Involved in the Cr(VI) Reduction
2.5. Toxicity Evaluation of Cr(VI) Reduction Products in Batch Treatment
2.6. Apparatus for Continuous Cr(VI) Removal
2.7. Effects of Operating Parameters on Continuous Cr(VI) Removal by Immobilized Ochrobactrum sp. CUST210-1 Biosystem
2.8. Effects of Operating Parameters on Continuous Cr(VI) Removal by Immobilized Enzyme Biosystem
2.9. Analysis
3. Results and Discussion
3.1. Distribution of Cr(VI) Reduction Products and Possible Cr(VI) Reduction Mechanism
3.2. Enzyme and Genes Involved in the Cr(VI) Reduction
3.3. Toxicity Evaluation of Cr(VI) Reduction Products in Batch Treatment
3.4. Effects of Operating Parameters on Continuous Cr(VI) Removal by Immobilized Ochrobactrum sp. CUST210-1 Biosystem
3.5. Effects of Operating Parameters on Continuous Cr(VI) Removal by Immobilized ChrR Biosystem
3.6. Continuous Treatment of Actual Cr(VI)-Containing Wastewater by Immobilized Ochrobactrum sp. CUST210-1 Biosystem and Immobilized ChrR Biosystem
3.7. Characteristics and Economic Analysis of the Biosystems
4. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Viti, C.; Marchi, E.; Decorosi, F.; Giovannetti, L. Molecular mechanisms of Cr(VI) resistance in bacteria and fungi. FEMS Microbiol. Rev. 2014, 38, 633–659. [Google Scholar] [CrossRef] [PubMed]
- Cervantes, C.; Campos-Garcia, J.; Devars, S.; Gutierrez-Corona, F.; Loza-Tavera, H.; Torres-Guzman, J.C.; Moreno-Sánchez, R. Interactions of chromium with microorganisms and plants. FEMS Microbiol. Rev. 2001, 25, 335–347. [Google Scholar] [CrossRef] [PubMed]
- Avudainayagam, S.; Megharaj, M.; Owens, G.; Kookana, R.S.; Chittleborough, D.; Naidu, R. Chemistry of chromium in soils with emphasis on tannery waste sites. Rev. Environ. Contam. Toxicol. 2003, 178, 53–91. [Google Scholar]
- Jin, R.; Liu, Y.; Liu, G.; Tian, T.; Qiao, S.; Zhou, J. Characterization of Product and potential mechanism of Cr(VI) reduction by anaerobic activated sludge in a sequencing batch reactor. Sci. Rep. 2017, 7, 1681. [Google Scholar] [CrossRef] [PubMed]
- Jobby, R.; Jha, P.; Yadav, A.K.; Desai, N. Biosorption and biotransformation of hexavalent chromium [Cr(VI)]: A comprehensive review. Chemosphere 2018, 207, 255–266. [Google Scholar] [CrossRef]
- Rahman, A.; Nahar, N.; Nawani, N.N.; Jass, J.; Hossain, K.; Saud, Z.A.; Saha, A.K.; Ghosh, S.; Olsson, B.; Mandal, A. Bioremediation of hexavalent chromium (VI) by a soil-borne bacterium, Enterobacter cloacae B2-DHA. J. Environ. Sci. Health A 2015, 50, 1136–1147. [Google Scholar] [CrossRef]
- Joutey, N.T.; Sayel, H.; Bahafid, W.; El Ghachtouli, N. Mechanisms of hexavalent chromium resistance and removal by microorganisms. Rev. Environ. Contam. Toxicol. 2015, 233, 45–69. [Google Scholar]
- Thatoi, H.; Das, S.; Mishra, J.; Rath, B.P.; Das, N. Bacterial chromate reductase, a potential enzyme for bioremediation of hexavalent chromium: A review. J. Environ. Manag. 2014, 146, 383–399. [Google Scholar] [CrossRef]
- Somasundaram, V.; Philip, L.; Bhallamudi, S.M. Experimental and mathematical modeling studies on Cr(VI) reduction by CRB, SRB and IRB, individually and in combination. J. Hazard. Mater. 2009, 172, 606–617. [Google Scholar] [CrossRef]
- Srivastava, N.; Dhal, B.; Abhilash; Pandey, B.D. Bioreduction of hexavalent chromium by Bacillus cereus isolated from chromite mine overburden soil. Adv. Mater. Res. 2013, 828, 81–91. [Google Scholar] [CrossRef]
- Chen, C.Y.; Cheng, C.Y.; Chen, C.K.; Hsieh, M.C.; Lin, S.T.; Ho, K.Y.; Li, J.W.; Lin, C.P.; Chung, Y.C. Hexavalent chromium removal and bioelectricity generation by Ochrobactrum sp. YC211 under different oxygen conditions. J. Environ. Sci. Health A 2016, 51, 502–508. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Guo, W.; Shi, M.; Cao, Y.; Wang, G. High-quality-draft genomic sequence of Paenibacillus ferrarius CY1 T with the potential to bioremediate Cd, Cr and Se contamination. Stand Genomic Sci. 2017, 12, 60. [Google Scholar] [CrossRef] [PubMed]
- Wu, L.C.; Wang, G.H.; Tsai, T.H.; Lo, S.Y.; Cheng, C.Y.; Chung, Y.C. Three-stage single-chambered microbial fuel cell biosensor inoculated with Exiguobacterium aestuarii YC211 for continuous chromium (VI) measurement. Sensors 2019, 19, 1418. [Google Scholar]
- Baldiris, R.; Acosta-Tapia, N.; Montes, A.; Hernández, J.; Vivas-Reyes, R. Reduction of hexavalent chromium and detection of chromate reductase (ChrR) in Stenotrophomonas maltophilia. Molecules 2018, 23, 406. [Google Scholar] [CrossRef]
- Murugavelh, S.; Mohanty, K. Bioreduction of chromate by immobilized cells of Halomonas sp. Int. J. Energy Environ. 2013, 4, 349–356. [Google Scholar]
- Robins, K.J.; Hooks, D.O.; Rehm, B.H.A.; Ackerley, D.F. Escherichia coli NemA is an efficient chromate reductase that can be biologically immobilized to provide a cell free system for remediation of hexavalent chromium. PLoS ONE 2013, 8, e59200. [Google Scholar] [CrossRef]
- American Public Health Association. Method 8050 Liquid-Phase Toxicity Test Using Luminescent Bacteria Vibrio Fischeri, Standard Methods for the Examination of Water and Wastewater, 21st ed.; Part 8050; American Public Health Association, American Water Works Association, Water Environment Federation: Washington, DC, USA, 2005. [Google Scholar]
- American Public Health Association. Standard Methods for the Examination of Water and Wastewater, 22nd ed.; Part 8000; American Public Health Association, American Water Works Association, Water Environment Federation: Washington, DC, USA, 2012. [Google Scholar]
- Lake, D.L.; Kirk, P.W.W.; Lester, J.N. The effects of anaerobic-digestion on heavy-metal distribution in sewage sludge. Water Pollut. Control 1985, 84, 549. [Google Scholar]
- Vyrides, I.; Stuckey, D.C. Chromium removal mechanisms and bacterial community in an integrated membrane bioreactor system. Environ. Eng. Sci. 2011, 28, 661–670. [Google Scholar] [CrossRef]
- Laemmli, U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227, 680–685. [Google Scholar] [CrossRef]
- Jin, H.; Zhang, Y.; Buchko, G.W.; Varnum, S.M.; Robinson, H.; Squier, T.C.; Long, P.E. Structure determination and functional analysis of a chromate reductase from Gluconacetobacter hansenii. PLoS ONE 2012, 7, e42432. [Google Scholar] [CrossRef] [PubMed]
- Ackerley, D.F.; Gonzalez, C.F.; Park, C.H.; Blake, R.; Keyhan, M.; Matin, A. Chromate-reducing properties of soluble flavoproteins from Pseudomonas putida and Escherichia coli. Appl. Environ. Microbiol. 2004, 70, 873–882. [Google Scholar] [CrossRef] [PubMed]
- Ackerley, D.F.; Gonzalez, C.F.; Keyhan, M.; Blake, R.; Matin, A. Mechanism of chromate reduction by the Escherichia coli protein, NfsA, and the role of different chromate reductases in minimizing oxidative stress during chromate reduction. Environ. Microbiol. 2004, 6, 851–860. [Google Scholar] [CrossRef] [PubMed]
- Kwak, Y.H.; Lee, D.S.; Kim, H.B. Vibrio harveyi nitroreductase is also a chromate reductase. Appl. Environ. Microbiol. 2003, 69, 4390–4395. [Google Scholar] [CrossRef] [PubMed]
- Mugerfeld, I.; Law, B.A.; Wickham, G.S.; Thompson, D.K. A putative azoreductase gene is involved in the Shewanella oneidensis response to heavy metal stress. Appl. Microbiol. Biotechnol. 2009, 82, 1131–1141. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Krumholz, L.R. Thioredoxin is involved in U(VI) and Cr(VI) reduction in Desulfovibrio desulfuricans G20. J. Bacteriol. 2009, 191, 4924–4933. [Google Scholar] [CrossRef] [PubMed]
- Michel, C.; Brugna, M.; Aubert, C.; Bernadac, A.; Bruschi, M. Enzymatic reduction of chromate: Comparative studies using sulfate-reducing bacteria. Key role of polyheme cytochromes c and hydrogenases. Appl. Microbiol. Biotechnol. 2001, 55, 95–100. [Google Scholar] [CrossRef]
- Magnuson, T.S.; Swenson, M.W.; Paszczynski, A.J.; Deobald, L.A.; Kerk, D.; Cummings, D.E. Proteogenomic and functional analysis of chromate reduction in Acidiphilium cryptum JF-5, an Fe(III)-respiring acidophile. BioMetals 2010, 23, 1129–1138. [Google Scholar] [CrossRef]
- Belchik, S.M.; Kennedy, D.W.; Dohnalkova, A.C.; Wang, Y.; Sevinc, P.C.; Wu, H.; Lin, Y.; Lu, H.P.; Fredrickson, J.K.; Shi, L. Extracellular reduction of hexavalent chromium by cytochromes MtrC and OmcA of Shewanella oneidensis MR-1. Appl. Environ. Microbiol. 2011, 77, 4035–4041. [Google Scholar] [CrossRef]
- De Silva, B.C.J.; Hossain, S.; Dahanayake, P.S.; Heo, G.J. Frozen white-Leg shrimp (Litopenaeus vannamei) in korean markets as a source of Aeromonas spp. harboring antibiotic and heavy metal resistance genes. Microb. Drug Resist. 2018, 24, 1587–1598. [Google Scholar] [CrossRef]
- Riaz, A.; Qader, S.A.; Anwar, A.; Iqbal, S. Immobilization of a thermostable α-amylase on calcium alginate beads from Bacillus subtilis KIBGE-HAR. Aus. J. Basic Appl. Sci. 2009, 3, 2883–2887. [Google Scholar]
- Das, S.; Mishra, J.; Das, S.K.; Pandey, S.; Rao, D.S.; Chakraborty, A.; Sudarshan, M.; Das, N.; Thatoi, H. Investigation on mechanism of Cr (VI) reduction and removal by Bacillus amyloliquefaciens, a novel chromate tolerant bacterium isolated from chromite mine soil. Chemosphere 2014, 96, 112–121. [Google Scholar] [CrossRef] [PubMed]
- Khattar, J.I.S.; Parveen, S.; Singh, Y.; Singh, D.P.; Gulati, A. Intracellular uptake and reduction of hexavalent chromium by the cyanobacterium Synechocystis sp. PUPCCC 62. J. Appl. Phycol. 2015, 27, 827–837. [Google Scholar] [CrossRef]
- Karthik, C.; Ramkumar, V.S.; Pugazhendhi, A.; Gopalakrishnan, K.; Arulselvi, P.I. Biosorption and biotransformation of Cr(VI) by novel Cellulosimicrobium funkei strain AR6. J. Taiwan Inst. Chem. Eng. 2016, 70, 282–290. [Google Scholar] [CrossRef]
- Kang, C.; Wu, P.; Li, L.; Yu, L.; Ruan, B.; Gong, B.; Zhu, N. Cr(VI) reduction and Cr(III) immobilization by resting cells of Pseudomonas aeruginosa CCTCC AB93066: Spectroscopic, microscopic, and mass balance analysis. Environ. Sci. Pollut. Res. Int. 2017, 24, 5949–5963. [Google Scholar] [CrossRef]
- Cheng, Y.; Yan, F.; Huang, F.; Chu, W.; Pan, D.; Chen, Z.; Zheng, J.; Yu, M.; Lin, Z.; Wu, Z. Bioremediation of Cr(VI) and immobilization as Cr(III) by Ochrobactrum anthropic. Environ. Sci. Technol. 2010, 44, 6357–6363. [Google Scholar] [CrossRef] [PubMed]
- Mishra, R.R.; Dhal, B.; Dutta, S.K.; Dangar, T.K.; Das, N.N.; Thatoi, H.N. Optimization and characterization of chromium(VI) reduction in saline condition by moderately halophilic Vigribacillus sp. isolated from mangrove soil of Bhitarkanika. India. J. Hazard. Mater. 2012, 227–228, 219–226. [Google Scholar] [CrossRef]
- Mohamed, A.; Yu, L.; Fang, Y.; Ashry, N.; Riahi, Y.; Uddin, I.; Dai, K.; Huang, Q. Iron mineral-humic acid complex enhanced Cr(VI) reduction by Shewanella oneidensis MR-1. Chemosphere 2020, 247. in press. [Google Scholar] [CrossRef]
- Xia, X.; Wu, S.; Li, N.; Wang, D.; Zheng, S.; Wang, G. Novel bacterial selenite reductase CsrF responsible for Se (IV) and Cr (VI) reduction that produces nanoparticles in Alishewanella sp. WH16-1. J. Hazard. Mater. 2018, 342, 499–509. [Google Scholar] [CrossRef]
- Dhal, B.; Thatoi, H.N.; Das, N.N.; Pandey, B.D. Reduction of hexavalent chromium by Bacillus sp. isolated from chromite mine soils and characterization of reduced product. J. Chem. Technol. Biotechnol. 2010, 85, 1471–1479. [Google Scholar] [CrossRef]
- Hirpara, P.; Nikhil, B.; Murty, D.S. Bacterial treatment for removal of chromium (VI) containing electroplating waste waters. Indian J. Appl. Res. 2014, 4, 436–438. [Google Scholar] [CrossRef]
- Mrudula, P.; Jamwal, S.; Samuel, J.; Chandrasekaran, N.; Mukherjee, A. Enhancing the hexavalent chromium bioremediation potential of Acinetobacter junii VITSUKMW2 using statistical design experiments. J. Microbiol. Biotechnol. 2012, 22, 1767–1775. [Google Scholar]
- Xu, F.; Ma, T.; Shi, L.; Zhang, J.W. Bioreduction of Cr(VI) by Bacillus sp. QH-1 isolated from soil under chromium-containing slag heap in high altitude area. Ann. Microbiol. 2013, 64, 1073–1080. [Google Scholar] [CrossRef]
- Rida, B.; Yrjälä, K.; Hasnain, S. Hexavalent chromium reduction by bacteria from tannery effluent. J. Microbiol. Biotechnol. 2012, 22, 547–554. [Google Scholar]
Targeted Gene | Sequence Primers (5′–3′) |
---|---|
apcA | F ATGAGTATCGTCACTAAATCCATCG R TACTGCATTGCACCGACAAC |
nfsA | F ATCGAATTCAGACTGAAGGCTCACTTTGC R ATCGCGGATCCACGTAACGCTTTGTCGGT |
nfsB | F GTAGGATCCGATATCATTTCTGTCGC R ACTGAATTCTTACACTTCGGTTAAGGTG |
yieF | F AGCTCATTTAATGGCATGG R ATCAAGGGAATGTCGGCAA |
azr | F AATACGGTAAGCGCAGCG R ATTATGTAAACCTATTTG |
crS | F CATATGGCCTTGCTCTTCACCCCCCTGGAACTC R GAATTCCTAAAACCCCCT TTGGTACTGGGGGGGTAC |
mreG | F ATCACTTCGGAACTGGGTGT R TACCCCGCAACACACTGTAA |
hydC | F CCTCTTTATCTTTAACAAAGGGTGCAGGGE R GGGTGCAGGGTTCAGCGAGCCTCTTTTTGGG |
mtrC | F AGATCTGTTGGCGCTAGAGCATAG R GCGGCCGCTAATAGGCTTCCCAATTTGT |
omcA | F AGCCGTATGATAGTGGGCTG R TCACTGAGACGAATACGGCG |
chrR | F ATGTCTGATACGTTGAAAGTTGTTA R CAGGCCTTCACCCGCTTA |
Cr Distribution | Cr(VI) by Surface Adsorption | Cr(III) by Surface Adsorption | Cr(III) in Solution | Cr(VI) in Solution | Cr(OH)3(s) Outside Cell | Cr(VI) Inside Cell | Cr(OH)3(s) Inside Cell |
---|---|---|---|---|---|---|---|
Relative amount (%) | 3.05% | 8.49% | 3.12% | 0% | 26.70% | 0% | 58.64% |
Cr(III) in Solution | Cr(III) Exchangeable Form | Cr(III) Adsorbed Form | Cr(III) Organically Bound | Cr(III) Carbonate Form | Cr(OH)3(s) Outside Cell | Cr(OH)3(s) Inside Cell | |
---|---|---|---|---|---|---|---|
Relative amount of Cr(III) species (%) | 3.22% | 0.21% | 2.90% | 5.53% | 0.13% | 27.53% | 60.48% |
Bacterial Culture (USD/y) | Enzyme Extraction & Immobilization (USD/y) | Reactor Installation (USD/y) | Operational Costs 1 (USD/y) | Application Scope | |
---|---|---|---|---|---|
CUST210-1 | 350 | - | 6000 2 | 400 | (1) BOD > 150 mg L−1 (2) Inlet Cr(VI) conc: 250–425 mg L−1 (3) Outlet Cr(VI) conc: <0.5 mg L−1 |
ChrR | 350 | 350 3 | 5000 | 350 | (1) BOD <50 mg L−1 (2) Inlet Cr(VI) conc: 50–150 mg L−1 (3) Outlet Cr(VI) conc: <0.05 mg L−1 |
Manpower Requirement & Ease of Operation | Frequency of Sludge Treatment (time y−1) | Characteristics | |
---|---|---|---|
CUST210-1 | Relatively low | 1 | (1) Suitable for treating high Cr(VI) conc. and complying with wastewater discharge standard (2) Suitable for low influent flow rate (3) Requires filter device and DO monitor |
ChrR | Relatively high | 10 | (1) Suitable for treating low Cr(VI) conc. and complying with stricter environmental standards (2) Allows high influent flow rate (3) Requires DO monitor and regular replacement of enzyme beads |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, G.-H.; Tsai, T.-H.; Chiu, C.-H.; Cheng, C.-Y.; Chung, Y.-C. Operational Characteristics of Immobilized Ochrobactrum sp. CUST210-1 Biosystem and Immobilized Chromate Reductase Biosystem in Continuously Treating Actual Chromium-Containing Wastewater. Appl. Sci. 2020, 10, 5934. https://doi.org/10.3390/app10175934
Wang G-H, Tsai T-H, Chiu C-H, Cheng C-Y, Chung Y-C. Operational Characteristics of Immobilized Ochrobactrum sp. CUST210-1 Biosystem and Immobilized Chromate Reductase Biosystem in Continuously Treating Actual Chromium-Containing Wastewater. Applied Sciences. 2020; 10(17):5934. https://doi.org/10.3390/app10175934
Chicago/Turabian StyleWang, Guey-Horng, Teh-Hua Tsai, Ching-Hung Chiu, Chiu-Yu Cheng, and Ying-Chien Chung. 2020. "Operational Characteristics of Immobilized Ochrobactrum sp. CUST210-1 Biosystem and Immobilized Chromate Reductase Biosystem in Continuously Treating Actual Chromium-Containing Wastewater" Applied Sciences 10, no. 17: 5934. https://doi.org/10.3390/app10175934
APA StyleWang, G.-H., Tsai, T.-H., Chiu, C.-H., Cheng, C.-Y., & Chung, Y.-C. (2020). Operational Characteristics of Immobilized Ochrobactrum sp. CUST210-1 Biosystem and Immobilized Chromate Reductase Biosystem in Continuously Treating Actual Chromium-Containing Wastewater. Applied Sciences, 10(17), 5934. https://doi.org/10.3390/app10175934