Effects of Sub-Chronic Exposure to Polystyrene Nanoplastics on Lipid and Antioxidant Metabolism in Sparus aurata
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Fish Maintenance
2.2. Fish Bioassay and Sampling
2.3. Fitness Indicators
2.4. Hematological Profile
2.5. Biochemical Analysis in Plasma
2.6. Histological Analysis
2.7. Gene Expression Profiling
2.7.1. RNA Extraction and Complementary DNA (cDNA)
2.7.2. Real-Time Quantitative PCR (RT-qPCR)
2.7.3. Normalization of Target Genes
2.8. Data Analysis
3. Results
3.1. Biometric Analysis
3.2. Hematological Responses
3.3. Biochemical Responses
3.4. Histological Changes
3.5. Molecular Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Murphy, E.L.; Polidoro, B.; Gerber, L.R. The Plastic-Scape: Applying Seascape Ecology to Marine Plastic Pollution. Front. Mar. Sci. 2022, 9, 980835. [Google Scholar] [CrossRef]
- Schernewski, G.; Escobar Sánchez, G.; Wandersee, P.; Lange, X.; Haseler, M.; Nassour, A. Marine Macro-Litter (Plastic) Pollution of German and North African Marina and City-Port Sea Floors. Appl. Sci. 2023, 13, 11424. [Google Scholar] [CrossRef]
- Zhou, J.; Luo, D. The Global Governance of Marine Plastic Pollution: Rethinking the Extended Producer Responsibility System. Front. Mar. 2024, 11, 1363269. [Google Scholar] [CrossRef]
- Richon, C.; Kvale, K.; Lebreton, L.; Egger, M. Legacy Oceanic Plastic Pollution Must Be Addressed to Mitigate Possible Long-Term Ecological Impacts. Microplast. Nanoplast. 2023, 3, 25. [Google Scholar] [CrossRef]
- Eriksen, M.; Cowger, W.; Erdle, L.M.; Coffin, S.; Villarrubia-Gómez, P.; Moore, C.J.; Carpenter, E.J.; Day, R.H.; Thiel, M.; Wilcox, C. A Growing Plastic Smog, Now Estimated to Be over 170 Trillion Plastic Particles Afloat in the World’s Oceans—Urgent Solutions Required. PLoS ONE 2023, 1, 0281596. [Google Scholar] [CrossRef]
- Cowger, W.; Willis, K.A.; Bullock, S.; Conlon, K.; Emmanuel, J.; Erdle, L.M.; Eriksen, M.; Farrelly, T.A.; Hardesty, B.D.; Kerge, K.; et al. Global Producer Responsibility for Plastic Pollution. Sci. Adv. 2024, 10, 8275. [Google Scholar] [CrossRef]
- Chen, H. Biodegradable Plastics in the Marine Environment: A Potential Source of Risk. Water Emerg. Contam. Nanoplast. 2022, 1, 16. [Google Scholar] [CrossRef]
- Hartmann, N.B.; Hüffer, T.; Thompson, R.C.; Hassellöv, M.; Verschoor, A.; Daugaard, A.E.; Rist, S.; Karlsson, T.; Brennholt, N.; Cole, M.; et al. Are We Speaking the Same Language? Recommendations for a Definition and Categorization Framework for Plastic Debris. Environ. Sci. Technol. 2019, 53, 1039–1047. [Google Scholar] [CrossRef]
- Sullivan, G.L.; Gallardo, J.D.; Jones, E.W.; Hollliman, P.J.; Watson, T.M.; Sarp, S. Detection of Trace Sub-Micron (Nano) Plastics in Water Samples Using Pyrolysis-Gas Chromatography Time of Flight Mass Spectrometry (PY-GCToF). Chemosphere 2020, 249, 126179. [Google Scholar] [CrossRef]
- Kazak, E.S.; Filimonova, E.A.; Preobrazhenskaya, A.E. Occurrence and Detection Problems of Micro-and Nanoplastics in the Water Environment of Russia. Mosc. Univ. Geol. Bull. 2023, 78, 110–123. [Google Scholar] [CrossRef]
- Ter Halle, A.; Jeanneau, L.; Martignac, M.; Jardé, E.; Pedrono, B.; Brach, L.; Gigault, J. Nanoplastic in the North Atlantic subtropical gyre. Environ. Sci. Technol. 2017, 51, 13689–13697. [Google Scholar] [CrossRef]
- Adamopoulou, A.; Zeri, C.; Garaventa, F.; Gambardella, C.; Ioakeimidis, C.; Pitta, E. Distribution patterns of floating microplastics in open and coastal waters of the eastern Mediterranean Sea (Ionian, Aegean, and Levantine seas). Front. Mar. Sci. 2021, 8, 699000. [Google Scholar] [CrossRef]
- Cózar, A.; Sanz-Martín, M.; Martí, E.; González-Gordillo, J.I.; Ubeda, B.; Gálvez, J.Á.; Duarte, C.M. Plastic accumulation in the Mediterranean Sea. PLoS ONE 2015, 10, 0121762. [Google Scholar] [CrossRef]
- Sharma, V.K.; Ma, X.; Guo, B.; Zhang, K. Environmental Factors-Mediated Behavior of Microplastics and Nanoplastics in Water: A Review. Chemosphere 2021, 271, 129597. [Google Scholar] [CrossRef]
- Mosconi, G.; Panseri, S.; Magni, S.; Malandra, R.; D’Amato, A.; Carini, M.; Della Torre, C. Plastic Contamination in Seabass and Seabream from Off-Shore Aquaculture Facilities from the Mediterranean Sea. J. Xenobiot. 2023, 13, 625–640. [Google Scholar] [CrossRef]
- Rossi, G.; Barnoud, J.; Monticelli, L. Polystyrene Nanoparticles Perturb Lipid Membranes. J. Phys. Chem. Lett. 2014, 5, 241–246. [Google Scholar] [CrossRef]
- Stapleton, P. Toxicological Considerations of Nano-Sized Plastics. AIMS Environ. Sci. 2019, 6, 367–378. [Google Scholar] [CrossRef]
- Ward, J.E.; Kach, D.J. Marine Aggregates Facilitate Ingestion of Nanoparticles by Suspension-Feeding Bivalves. Mar. Environ. Res. 2009, 68, 137–142. [Google Scholar] [CrossRef]
- Hodson, M.E.; Duffus-Hodson, C.A.; Clark, A.; Prendergast-Miller, M.T.; Thorpe, K.L. Plastic Bag Derived-Microplastics as a Vector for Metal Exposure in Terrestrial Invertebrates. Environ. Sci. Technol. 2017, 51, 4714–4721. [Google Scholar] [CrossRef]
- Brand, S.; Nunes, D.; Bastos, R.; Falla, J.; Diniz, M.S. Study of the Effects of Nanoplastics Ingestion in a Freshwater Fish (Danio rerio). Ann. Med. 2021, 53 (Suppl. S1), S93–S94. [Google Scholar] [CrossRef]
- Das, S. Impact of Nanoplastics on Marine Life: A Review. Nat. Environ. Pollut. Technol. 2023, 22, 1983–1993. [Google Scholar] [CrossRef]
- Brandts, I.; Cánovas, M.; Tvarijonaviciute, A.; Llorca, M.; Vega, A.; Farré, M.; Pastor, J.; Roher, N.; Teles, M. Nanoplastics Are Bioaccumulated in Fish Liver and Muscle and Cause DNA Damage after a Chronic Exposure. Environ. Res. 2022, 212, 113433. [Google Scholar] [CrossRef]
- Hayati, A.; Wilujeng, W.P.; Pramudya, M.; Dewi, F.R.; Muchtaromah, B.; Susilo, R.J. The Effect of Exposure to Polystyrene Nanoplastics on Cytokine Levels and Reproductive System of Male Tilapia. Trop. J. Nat. Prod. Res. 2024, 8, 6300–6303. [Google Scholar]
- Trevisan, R.; Ranasinghe, P.; Jayasundara, N.; Giulio, R.T. Nanoplastics in aquatic environments: Impacts on aquatic species and interactions with environmental factors and pollutants. Toxics 2022, 10, 326. [Google Scholar] [CrossRef]
- Chae, Y.; Kim, D.; Kim, S.W.; An, Y.J. Trophic Transfer and Individual Impact of Nano-Sized Polystyrene in a Four-Species Freshwater Food Chain. Sci. Rep. 2018, 8, 284. [Google Scholar] [CrossRef]
- Kelpsiene, E.; Ekvall, M.T.; Lundqvist, M.; Torstensson, O.; Hua, J.; Cedervall, T. Review of Ecotoxicological Studies of Widely Used Polystyrene Nanoparticles. Environ. Sci. Process. Impacts 2022, 24, 8–16. [Google Scholar] [CrossRef]
- Kim, L.; Cui, R.; Il Kwak, J.; An, Y.-J. Trophic Transfer of Nanoplastics through a Microalgae–Crustacean–Small Yellow Croaker Food Chain: Inhibition of Digestive Enzyme Activity in Fish. J. Hazard. Mater. 2022, 440, 129715. [Google Scholar] [CrossRef]
- Bergami, E.; Corsi, I. Nanoplastic in the Environment: Occurrence, Toxicity and Implications. Mar. Environ. Res. 2018, 142, 5–17. [Google Scholar]
- Jeyavani, J.; Sibiya, A.; Stalin, T.; Vigneshkumar, G.; Al-Ghanim, K.A.; Riaz, M.N.; Govindarajan, M.; Vaseeharan, B. Biochemical, genotoxic and histological implications of polypropylene microplastics on freshwater fish Oreochromis mossambicus: An aquatic eco-toxicological assessment. Toxics 2023, 11, 282. [Google Scholar] [CrossRef]
- Rizzo, E.; Bazzoli, N. Chapter 13—Reproduction and Embryogenesis. In Biology and Physiology of Freshwater Neotropical Fish; Baldisserotto, B., Urbinati, E.C., Cyrino, J.E.P., Eds.; Academic Press: Cambridge, MA, USA, 2020; pp. 287–313. [Google Scholar]
- Pfaffl, M.W. A New Mathematical Model for Relative Quantification in Real-Time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Lawrence, M.J.; Raby, G.D.; Teffer, A.K.; Jeffries, K.M.; Danylchuk, A.J.; Eliason, E.J.; Hasler, C.T.; Clark, T.D.; Cooke, S.J. Best Practices for Non-lethal Blood Sampling of Fish via the Caudal Vasculature. J. Fish Biol. 2020, 97, 4–15. [Google Scholar] [CrossRef]
- Hamed, M.; Soliman, H.A.; Osman, A.G.; Sayed, A.E. Assessment the Effect of Exposure to Microplastics in Nile Tilapia (Oreochromis niloticus) Early Juvenile: I. Blood Biomarkers. Chemosphere 2019, 228, 345–350. [Google Scholar] [CrossRef]
- Hodkovicova, N.; Hollerova, A.; Caloudova, H.; Blahova, J.; Franc, A.; Garajova, M.; Lenz, J.; Tichy, F.; Faldyna, M.; Kulich, P.; et al. Do Foodborne Polyethylene Microparticles Affect the Health of Rainbow Trout (Oncorhynchus mykiss)? Sci. Total Environ. 2021, 793, 148490. [Google Scholar] [CrossRef]
- Zitouni, N.; Bousserrhine, N.; Missawi, O.; Boughattas, I.; Chèvre, N.; Santos, R.; Belbekhouche, S.; Alphonse, V.; Tisserand, F.; Balmassiere, L.; et al. Uptake, Tissue Distribution and Toxicological Effects of Environmental Microplastics in Early Juvenile Fish Dicentrarchus Labrax. J. Hazard. Mater. 2021, 403, 124055. [Google Scholar] [CrossRef]
- Lee, Y.; Cho, S.; Park, K.; Kim, T.; Kim, J.; Ryu, D.-Y.; Hong, J. Potential Lifetime Effects Caused by Cellular Uptake of Nanoplastics: A Review. Environ. Pollut. 2023, 329, 121668. [Google Scholar] [CrossRef]
- Nair, H.T.; Perumal, S. Growth Performance, Hematological and Oxidative Stress Responses in Nile Tilapia (Oreochromis niloticus) Exposed to Polypropylene Microplastics. Environ. Qual. Manag. 2024, 34, e22179. [Google Scholar] [CrossRef]
- Gigault, J.; El Hadri, H.; Nguyen, B.; Grassl, B.; Rowenczyk, L.; Tufenkji, N.; Feng, S.; Wiesner, M. Nanoplastics are neither microplastics nor engineered nanoparticles. Nat. Nanotechnol. 2021, 16, 501–507. [Google Scholar] [CrossRef]
- Vineetha, V.P.; Suresh, K.; Pillai, D. Impact of Sub-Chronic Polystyrene Nanoplastics Exposure on Hematology, Histology, and Endoplasmic Reticulum Stress-Related Protein Expression in Nile Tilapia (Oreochromis niloticus). Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2024, 273, 110982. [Google Scholar] [CrossRef]
- Li, L.; Gu, H.; Chang, X.; Huang, W.; Sokolova, I.M.; Wei, S.; Sun, L.; Li, S.; Wang, X.; Hu, M.; et al. Oxidative Stress Induced by Nanoplastics in the Liver of Juvenile Large Yellow Croaker Larimichthys Crocea. Mar. Pollut. Bull. 2021, 170, 112661. [Google Scholar] [CrossRef]
- Ortega, V.A.; Boyle, D.; Hodgkinson, J.W.; Simmons, D.B.D.; Belosevic, M.; Stafford, J.L.; Goss, G.G. Polymer-Coated TiO2 Nanoparticles Bioaccumulate, Immunoactivate and Suppress Pathogenic Mycobacterium Chelonae Clearance When Intravenously Injected into Goldfish (Carassius auratus L.). Environ. Sci. Nano 2021, 8, 1910–1926. [Google Scholar] [CrossRef]
- Lee, J.H.; Kang, J.C.; Kim, J.H. Toxic Effects of Microplastic (Polyethylene) on Fish: Accumulation, Hematological Parameters and Antioxidant Responses in Korean Bullhead, Pseudobagrus Fulvidraco. Sci. Total Environ. 2023, 877, 162874. [Google Scholar] [CrossRef]
- Buchmann, K. Neutrophils and Aquatic Pathogens. Parasite Immunol. 2022, 44, e12915. [Google Scholar] [CrossRef]
- Brandts, I.; Barría, C.; Martins, M.A.; Franco-Martínez, L.; Barreto, A.; Tvarijonaviciute, A.; Tort, L.; Oliveira, M.; Teles, M. Waterborne Exposure of Gilthead Seabream (Sparus aurata) to Polymethylmethacrylate Nanoplastics Causes Effects at Cellular and Molecular Levels. J. Hazard. Mater. 2021, 403, 123590. [Google Scholar] [CrossRef]
- Chen, J.; Liang, Q.; Zheng, Y.; Lei, Y.; Gan, X.; Mei, H.; Bai, C.; Wang, H.; Ju, J.; Dong, Q.; et al. Polystyrene Nanoplastics Induced Size-Dependent Developmental and Neurobehavioral Toxicities in Embryonic and Juvenile Zebrafish. Aquat. Toxicol. 2024, 267, 106842. [Google Scholar] [CrossRef]
- Xu, H.; Wang, J.; Wang, Q.; Tu, W.; Jin, Y. Co-Exposure to Polystyrene Microplastics and Cypermethrin Enhanced the Effects on Hepatic Phospholipid Metabolism and Gut Microbes in Adult Zebrafish. J. Hazard. Mater. 2024, 465, 133051. [Google Scholar] [CrossRef]
- Banaei, M.; Forouzanfar, M.; Jafarinia, M. Toxic Effects of Polyethylene Microplastics on Transcriptional Changes, Biochemical Response, and Oxidative Stress in Common Carp (Cyprinus carpio). Comparative Biochemistry and Physiology. Toxicol. Pharmacol. 2022, 261, 109423. [Google Scholar] [CrossRef]
- Dawood, M.A.O. Nutritional Immunity of Fish Intestines: Important Insights for Sustainable Aquaculture. Rev. Aquac. 2021, 13, 642–663. [Google Scholar] [CrossRef]
- Labella, A.M.; Rosado, J.J.; Balado, M.; Lemos, M.L.; Borrego, J.J. Virulence Properties of Three New Photobacterium Species Affecting Cultured Fish. J. Appl. Microbiol. 2020, 129, 37–50. [Google Scholar] [CrossRef]
- Lallès, J.-P. Recent Advances in Intestinal Alkaline Phosphatase, Inflammation, and Nutrition. Nutr. Rev. 2019, 77, 710–724. [Google Scholar] [CrossRef]
- David, M.; Mushigeri, S.B.; Shivakumar, R.; Philip, G.H. Response of Cyprinus carpio (Linn) to Sublethal Concentration of Cypermethrin: Alterations in Protein Metabolic Profiles. Chemosphere 2004, 56, 347–352. [Google Scholar] [CrossRef]
- Hoseini, S.M.; Gharavi, B.; Taheri Mirghaed, A.; Hoseinifar, S.H.; Van Doan, H. Effects of Dietary Phytol Supplementation on Growth Performance, Immunological Parameters, Antioxidant and Stress Responses to Ammonia Exposure in Common carp, Cyprinus carpio (Linnaeus, 1758). Aquaculture 2021, 545, 737151. [Google Scholar] [CrossRef]
- Yu, Y.-B.; Lee, J.-W.; Jo, A.-H.; Choi, Y.J.; Choi, C.Y.; Kang, J.-C.; Kim, J.-H. Toxic Effects of Cadmium Exposure on Hematological and Plasma Biochemical Parameters in Fish: A Review. Toxics 2024, 12, 699. [Google Scholar] [CrossRef] [PubMed]
- Qiu, Y.-Y.; Zhang, J.; Zeng, F.-Y.; Zhu, Y.Z. Roles of the Peroxisome Proliferator-Activated Receptors (PPARs) in the Pathogenesis of Nonalcoholic Fatty Liver Disease (NAFLD). Pharmacol. Res. 2023, 192, 106786. [Google Scholar] [CrossRef] [PubMed]
- Titus, C.; Hoque, M.T.; Bendayan, R. PPAR Agonists for the Treatment of Neuroinflammatory Diseases. Trends Pharmacol. Sci. 2024, 45, 9–23. [Google Scholar] [CrossRef]
- Rakhshandehroo, M.; Knoch, B.; Müller, M.; Kersten, S. Peroxisome Proliferator-activated Receptor Alpha Target Genes. PPAR Res. 2010, 1, 612089. [Google Scholar] [CrossRef]
- Volkoff, H. The Role of Neuropeptide Y, Orexins, Cocaine and Amphetamine-Related Transcript, Cholecystokinin, Amylin and Leptin in the Regulation of Feeding in Fish. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2006, 144, 325–331. [Google Scholar] [CrossRef]
- Ndandala, C.B.; Dai, M.; Mustapha, U.F.; Li, X.; Liu, J.; Huang, H.; Li, G.; Chen, H. Current Research and Future Perspectives of GH and IGFs Family Genes in Somatic Growth and Reproduction of Teleost Fish. Aquac. Rep. 2022, 26, 101289. [Google Scholar] [CrossRef]
- Zhang, X.; Chen, X.; Gao, L.; Zhang, H.-T.; Li, J.; Ye, Y.; Zhu, Q.-L.; Zheng, J.-L.; Yan, X. Transgenerational Effects of Microplastics on Nrf2 Signaling, GH/IGF, and HPI Axis in Marine Medaka Oryzias Melastigma under Different Salinities. Sci. Total Environ. 2024, 906, 167170. [Google Scholar] [CrossRef]
- Zheng, Y.; Gan, X.; Lin, C.; Wang, D.; Chen, R.; Dai, Y.; Jiang, L.; Huang, C.; Zhu, Y.; Song, Y.; et al. Polystyrene Nanoplastics Cause Reproductive Toxicity in Zebrafish: PPAR Mediated Lipid Metabolism Disorder. Sci. Total Environ. 2024, 931, 172795. [Google Scholar] [CrossRef]
- Lai, W.; Xu, D.; Li, J.; Wang, Z.; Ding, Y.; Wang, X.; Li, X.; Xu, N.; Mai, K.; Ai, Q. Dietary Polystyrene Nanoplastics Exposure Alters Liver Lipid Metabolism and Muscle Nutritional Quality in Carnivorous Marine Fish Large Yellow Croaker (Larimichthys crocea). J. Hazard. Mater. 2021, 419, 126454. [Google Scholar] [CrossRef]
- Kantha, P.; Liu, S.T.; Horng, J.L.; Lin, L.Y. Acute Exposure to Polystyrene Nanoplastics Impairs Skin Cells and Ion Regulation in Zebrafish Embryos. Aquat. Toxicol. 2022, 248, 106203. [Google Scholar] [CrossRef] [PubMed]
- Umamaheswari, S.; Priyadarshinee, S.; Bhattacharjee, M.; Kadirvelu, K.; Ramesh, M. Exposure to Polystyrene Microplastics Induced Gene Modulated Biological Responses in Zebrafish (Danio rerio). Chemosphere 2021, 281, 128592. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Yue, X.; Lu, X.; Liu, B. The Role of Catalase in the Immune Response to Oxidative Stress and Pathogen Challenge in the Clam Meretrix Meretrix. Fish Shellfish Immunol. 2013, 34, 91–99. [Google Scholar] [CrossRef] [PubMed]
- Kim, C.H.; Kim, E.J.; Nam, Y.K. Superoxide Dismutase Multigene Family from a Primitive Chondrostean Sturgeon, Acipenser Baerii: Molecular Characterization, Evolution, and Antioxidant Defense during Development and Pathogen Infection. Antioxidants 2021, 10, 232. [Google Scholar] [CrossRef]
- Martínez-Álvarez, I.; Le Menach, K.; Cajaraville, M.P.; Budzinski, H.; Orbea, A. Effects of Polystyrene Nano-and Microplastics and of Microplastics with Sorbed Polycyclic Aromatic Hydrocarbons in Adult Zebrafish. Sci. Total Environ. 2024, 927, 172380. [Google Scholar] [CrossRef]
- Huang, J.-N.; Wen, B.; Xu, L.; Ma, H.-C.; Li, X.-X.; Gao, J.-Z.; Chen, Z.-Z. Micro/Nano-Plastics Cause Neurobehavioral Toxicity in Discus Fish (Symphysodon aequifasciatus): Insight from Brain-Gut-Microbiota Axis. J. Hazard. Mater. 2022, 421, 126830. [Google Scholar] [CrossRef]
- Geetha, N. Mitigatory Role of Butyrylcholinesterase in Freshwater Fish Labeo Rohita Exposed to Glyphosate Based Herbicide Roundup®. Mater. Today Proc. 2021, 47, 2030–2035. [Google Scholar] [CrossRef]
- Zhang, C.; Wang, F.; Wang, Q.; Zou, J.; Zhu, J. Species-Specific Effects of Microplastics on Juvenile Fishes. Front. Physiol. 2023, 14, 1256005. [Google Scholar] [CrossRef]
Gene Name | Acronym | Accession No. | Forward | Reverse | Efficiency (%) |
---|---|---|---|---|---|
Elongation factor-1 α | ef1 | AF184170 | CCCGCCTCTGTTGCCTTCG | CAGCAGTGTGGTTCCGTTAGC | 101.0 |
Beta-actin | bact | X89920 | TCCTGCGGAATCCATGAGA | GACGTCGCACTTCATGATGCT | 101.9 |
Glyceraldehyde-3-phosphate dehydrogenase | gadph | DQ641630 | TGCCCAGTACGTTGTTGAGTCCAC | CAGACCCTCAATGATGCCGAAGTT | 100.6 |
Peroxisome proliferator-activated receptor Alpha | pparα | AY590299 | GCAGCCTGTGAGTCTTGTGAGTGA | CTCCATCAGGTCTCCACACAGC | 98.2 |
Peroxisome proliferator-activated receptor Beta | pparβ | AY590301 | CGTGTTCGGGATTCGGGACT | CACCCTGTCGTGCTGCTCTGTA | 105.7 |
Leptin | lep | MG570179 | CAGCCTGATCTCAGACGACCTTGACAAC | TGATCCAGGAATCCAGACAGCGAAGA | 92.5 |
Insulin-like growth factor I | igf1 | AY996779 | GCCACACCCTCTCACTACTG | AAGCAGCACTCGTCCACA | 96.2 |
Transforming growth factor 1 beta | tgf1b | P01137 | GCATGTGGCAGAGATGAAGA | TTCAGCATGATACGGCAGAG | 93.2 |
Butyrylcholinesterase | bche | B013682 | CAGGTACTCCCAACACGGTG | ATCTCGTAGCCGTGCATGAC | 97.7 |
Glucocorticoid receptor | gr1 | AJ937873 | TGTTCAGCCACCCACCCATCGG | GCGTGATACATCGGAGTGAATGAAGTCTTG | 100.9 |
Superoxide dismutase | sod | JQ308833 | CCTGACCTGACCTACGACTATGG | AGTGCCTCCTGATATTTCTCCTCTG | 99.9 |
Catalase | cat | JQ308823 | TGGTCGAGAACTTGAAGGCTGTC | AGGACGCAGAAATGGCAGAGG | 102.7 |
Glutathione peroxidase 1 | gpx1 | DQ524992 | GAAGGTGGATGTGAATGGAAAAGATG | CTGACGGGACTCCAAATGATGG | 99.0 |
Glutathione-S-transferase3 | gst3 | JQ308828 | CCAGATGATCAGTACGTGAAGACCGTC | CTGCTGATGTGAGGAATGTACCGTAAC | 105.5 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Okon, E.; Brandts, I.; Djafar, H.; Tvarijonaviciute, A.; Balasch, J.C.; Teles, M. Effects of Sub-Chronic Exposure to Polystyrene Nanoplastics on Lipid and Antioxidant Metabolism in Sparus aurata. Animals 2025, 15, 562. https://doi.org/10.3390/ani15040562
Okon E, Brandts I, Djafar H, Tvarijonaviciute A, Balasch JC, Teles M. Effects of Sub-Chronic Exposure to Polystyrene Nanoplastics on Lipid and Antioxidant Metabolism in Sparus aurata. Animals. 2025; 15(4):562. https://doi.org/10.3390/ani15040562
Chicago/Turabian StyleOkon, Ekemini, Irene Brandts, Hayam Djafar, Asta Tvarijonaviciute, Joan Carles Balasch, and Mariana Teles. 2025. "Effects of Sub-Chronic Exposure to Polystyrene Nanoplastics on Lipid and Antioxidant Metabolism in Sparus aurata" Animals 15, no. 4: 562. https://doi.org/10.3390/ani15040562
APA StyleOkon, E., Brandts, I., Djafar, H., Tvarijonaviciute, A., Balasch, J. C., & Teles, M. (2025). Effects of Sub-Chronic Exposure to Polystyrene Nanoplastics on Lipid and Antioxidant Metabolism in Sparus aurata. Animals, 15(4), 562. https://doi.org/10.3390/ani15040562