Next Article in Journal
Effects of Sub-Chronic Exposure to Polystyrene Nanoplastics on Lipid and Antioxidant Metabolism in Sparus aurata
Previous Article in Journal
Brown Algae Polysaccharides Alleviate Diquat-Induced Oxidative Stress in Piglets and IPEC-J2 Cells via Nrf2/ARE Signaling Pathway
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 15
Issue 4
10.3390/ani15040560
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Application of Branched-Chain Amino Acids Mitigates Mitochondrial Damage to Spotted Seabass (Lateolabrax maculatus) Hepatocytes Cultured in High-Glucose and High-Fat Media

by
Huijuan Ren
1,
Yixiong Ke
1,
Xueshan Li
1,
Lin Wang
1,
Kai Song
1,
Francisco A. Guardiola
2,
Chunxiao Zhang
1,
Kangle Lu
1,* and
Samad Rahimnejad
3,4,*
1
State Key Laboratory of Mariculture Breeding, Fisheries College of Jimei University, Xiamen 361021, China
2
Immunobiology for Aquaculture Group, Department of Cell Biology and Histology, Faculty of Biology, Regional Campus of International Excellence “Campus Mare Nostrum”, University of Murcia, 30100 Murcia, Spain
3
Key Laboratory of Biochemistry and Molecular Biology in Universities of Shandong (Weifang University), Weifang Key Laboratory of Coho Salmon Culturing Facility Engineering, Institute of Modern Facility Fisheries, College of Biology and Oceanography, Weifang University, Weifang 261061, China
4
Weifang Key Laboratory of Salmon and Trout Health Culture, Conqueren Leading Fresh Science & Technology Inc., Ltd., Weifang 261205, China
*
Authors to whom correspondence should be addressed.
Animals 2025, 15(4), 560; https://doi.org/10.3390/ani15040560
Submission received: 1 December 2024 / Revised: 17 January 2025 / Accepted: 11 February 2025 / Published: 14 February 2025
(This article belongs to the Section Aquatic Animals)
Browse Figures
Versions Notes

Simple Summary

Mitochondria are central to cellular metabolism, energy production, and overall cell viability. In aquaculture, high-glucose or high-fat diets can induce oxidative stress, disrupt metabolic homeostasis, and impair mitochondrial function. Branched-chain amino acids (BCAAs), essential for animal growth, exhibit diverse biological benefits, including metabolic regulation and mitochondrial protection. This study demonstrated that BCAAs supplementation enhances mitochondrial function in hepatocytes of spotted seabass (Lateolabrax maculatus), effectively mitigating oxidative stress and cellular damage induced by excessive glucose or lipid exposure.

Abstract

This study explored the metabolic effects of branched-chain amino acids (BCAAs) on the hepatocytes of spotted seabass (Lateolabrax maculatus) under high-glucose (HG) or high-fat (HF) conditions. Hepatocytes were cultured under five different conditions: control, high glucose (HG), HG + BCAAs (Leu 0.8 mM, Ile 0.4 mM, Val 0.8 mM), high fat (HF), and HF + BCAAs (Leu 0.8 mM, Ile 0.8 mM, Val 0.8 mM). After 72 h of culture, cells and cell supernatants were collected to measure relevant indicators. The results revealed that BCAAs supplementation significantly reduced glycogen and lipid accumulation in hepatocytes exposed to HG or HF conditions (p < 0.05). Additionally, alanine aminotransferase and aspartate aminotransferase activities in the supernatant were significantly decreased, indicating that BCAAs supplementation alleviated hepatocyte damage induced by these conditions. Furthermore, BCAAs addition markedly enhanced antioxidant defense by increasing superoxide dismutase and catalase activities, improving total antioxidant capacity, and reducing malondialdehyde levels. Metabolic enzyme activity analysis revealed that BCAAs significantly increased the activities of citrate synthase (CS), alpha-ketoglutarate dehydrogenase complex (α-KGDHC), succinate dehydrogenase (SDH), phosphoenolpyruvate carboxykinase (PEPCK), and liver pyruvate kinase (LPS), while significantly decreasing fatty acid synthase (FAS) activity. Gene expression analysis further demonstrated that BCAAs supplementation downregulated the expression of lipogenic genes (fas and srebp-1c) and upregulated the expression of lipolytic genes (ppaα and atgl) and glucose metabolism-related genes (g6pd, hk, pfk, pk, fbp, and g6pase). Under HG or HF conditions, hepatocytes exhibited decreased adenosine triphosphate (ATP) content, increased reactive oxygen species (ROS) levels, and reduced mitochondrial membrane potential. These adverse effects were mitigated by BCAAs supplementation. In conclusion, BCAAs supplementation alleviated hepatocyte damage caused by HG or HF conditions, enhanced antioxidant defenses, and protected mitochondrial activity and function by promoting glucose and lipid metabolism.

1. Introduction

Branched-chain amino acids (BCAAs), comprising leucine (Leu), isoleucine (Ile), and valine (Val), are essential amino acids that must be obtained through dietary sources [1,2]. BCAAs are among the most abundant amino acids in proteins and play pivotal roles in protein synthesis, as well as serving as carbon and nitrogen sources in metabolic pathways [3]. Maintaining a precise balance between BCAAs intake and metabolism is critical for physiological health.
Aberrant metabolism or incomplete oxidation of BCAAs, particularly Ile and Val, has been associated with catabolic stress and impaired mitochondrial function [4]. Multiple studies on mammals, including humans, have shown that feeding high-fructose diets combined with elevated BCAAs levels increased cardiac myocyte apoptosis in mice [5]. Similarly, excessive BCAAs intake has been linked to adverse effects such as insulin resistance and mitochondrial dysfunction [4,6]. Conversely, several other studies have highlighted the beneficial effects of BCAAs supplementation, including reduced muscle damage biomarkers and alleviated muscle soreness [7,8,9,10,11,12,13,14]. Diets with optimal BCAAs levels have also been shown to promote metabolic health in rodents and humans by enhancing hepatic insulin sensitivity, suppressing hepatic lipid accumulation, reducing protein catabolism, and increasing energy expenditure [15,16,17,18].
Spotted seabass (Lateolabrax maculatus) is a commercially important carnivorous marine fish in China. However, high-carbohydrate diets in carnivorous fish have been shown to induce liver glycogen accumulation, lipid deposition, hepatic damage, and disruptions in glucose metabolism [19,20,21]. Similarly, prolonged high-fat diets impaired lipid transport, compromised liver function, and increased the risk of fatty liver disease, posing a significant threat to fish health [22,23,24].
Given these metabolic challenges, spotted seabass serves as an ideal model for studying amino acid metabolism in fish. To better understand the metabolic effects of BCAAs in aquaculture species, this study investigated the impacts of BCAAs on mitochondrial function in spotted seabass hepatocytes under high-glucose or high-fat conditions. By using isolated hepatocytes, the study aimed to elucidate the metabolic response of farmed fish to BCAAs, providing valuable insights into the regulatory mechanisms of BCAAs metabolism in marine fish.

2. Materials and Methods

2.1. Model Establishment

The hepatocyte cell line used in this study was derived from spotted seabass hepatocyte, and established through tissue block migration and multiple passages during early culture stages and the cells were maintained in our laboratory under controlled conditions. Prior to experimentation, they were cultured in DMEM/F12 medium supplemented with 20% fetal bovine serum and 1% penicillin–streptomycin at 28 °C under 5% CO2 until reaching 70–80% confluence.
The experiment consisted of six treatment groups: control, high glucose (HG), HG + BCAAs (Leu 0.8 mM, Ile 0.4 mM, Val 0.8 mM), high fat (HF), and HF + BCAAs (Leu 0.8 mM, Ile 0.8 mM, Val 0.8 mM) groups, each with three replicates. The control group was maintained in standard DMEM/F12 medium, while the HG group was cultured in DMEM/F12 medium supplemented with 40 mM glucose [25]. The HF group was cultured in DMEM/F12 medium containing 0.1 mM fatty acids (prepared by mixing oleic acid and palmitic acid at a ratio of 1:1 from a 10 mM stock solution) [26] for 72 h. Following treatment, the supernatant was collected, and the cells were washed twice with PBS, harvested via trypsin digestion, and washed again with PBS before further analysis.

2.2. Measurement of Indicators

2.2.1. Cellular Biochemical Analyses

Hepatocytes were seeded in 6-well cell culture plates and cultured until stable adhesion was achieved before initiating the experimental treatments. Following treatment, cells were collected for subsequent analyses. Glycogen content in each group was measured using Nanjing Jiancheng reagent kits (A043-1-1, Nanjing, China), following the manufacturer’s instructions.
Cell culture supernatants were collected and centrifuged at 4 °C at 1000 r/min for 10 min to separate the supernatant. Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were quantified using Nanjing Jiancheng reagent kits (Nanjing, China), following the provided protocols.
For lipid accumulation analyses, hepatocytes were seeded in 24-well cell culture plates and cultured until stable adhesion was achieved. After treatment, the culture medium was removed, and the cells were washed twice with PBS before fixation with Oil Red O fixative for 20–30 min. The fixative was then discarded, and cells were washed twice with distilled water. To prepare for staining, 60% isopropanol was added for 20–30 s and then discarded. Freshly prepared Oil Red O staining solution was applied for 10–20 min. After removing the staining solution, cells were washed with 60% isopropanol for 20–30 s until interstitial spaces were clear, followed by 2–5 washes with distilled water. For nuclear counterstaining, Mayer’s hematoxylin staining solution was applied for 1–2 min, then discarded, followed by 2–5 times washes with distilled water. Oil Red O buffer was applied for 1 min and then discarded. Finally, distilled water was added to cover the cells, and lipid accumulation was observed under an optical microscope (DM5000B, Leica, Wetzlar, Germany).

2.2.2. Oxidative Stress-Related Indicators

Measurement of Antioxidant and Oxidative Stress Markers

Superoxide dismutase (SOD, A001-3-2) and catalase (CAT, A007-1-1) activities, malondialdehyde (MDA, A03-1-2) concentration, and total antioxidant capacity (T-AOC, A015-2-1) in hepatocytes were assessed using Nanjing Jiancheng (Nanjing, China) reagent kits according to the manufacturer’s instructions.

Measurement of Reactive Oxygen Species (ROS) Concentration

After cell collection, samples were washed twice with PBS. A DCFH-DA probe, diluted 1:1000 in serum-free culture medium, was added to the cells and incubated at 37 °C for 20 min. After incubation, the cells were washed three times with serum-free culture medium to remove excess probe. Finally, the ROS levels were quantitatively analyzed using a flow cytometer (CytoFLEX, Beckman Coulter, Suzhou, China).

2.2.3. Key Enzymatic Activities in Hepatocyte Metabolism

The activities of citrate synthase (CS, BC1065), α-ketoglutarate dehydrogenase (α-KGDHC, BC0715), succinate dehydrogenase (SDH, BC0955), phosphoenolpyruvate carboxykinase (PEPCK, BC3315), and lipase (LPS, BC2345) in hepatocytes were measured using reagent kits from Beijing Solebao Technology Co., Ltd., (Beijing, China).
Fatty acid synthase (FAS, H231-1-1) activity and ATP (S0027) content in hepatocytes were assessed using reagent kits from Nanjing Jiancheng Co., Ltd., (Nanjing, China) and Biyun Tian Biotechnology Co., Ltd., (Shanghai, China), respectively.

2.2.4. Mitochondrial Status

Mitochondrial Membrane Potential Detection

Cells were cultured in 6-well plates and allowed to adhere stably before undergoing experimental treatments. At the end of the experiment, the cells were collected and resuspended in 0.5 mL of cell culture medium. An equal volume (0.5 mL) of JC-1 staining working solution was added, and the mixture was gently inverted multiple times to ensure thorough mixing. The cells were then incubated at 37 °C in a cell culture incubator for 20 min. Following incubation, the cells were centrifuged at 600× g for 3–4 min at 4 °C, and the pellet was collected. The cells were washed twice with JC-1 staining buffer and resuspended in 1 mL of the same buffer. This process was repeated twice, involving centrifuging at 600× g for 3–4 min at 4 °C, discarding the supernatant, and resuspending the cells in JC-1 staining buffer. Finally, the cells were resuspended in an appropriate volume of JC-1 staining buffer and analyzed using a flow cytometer (CytoFLEX, Beckman Coulter, Pasadena, California, USA).

Mitochondrial Activity Staining

Cells were cultured on glass coverslips (cell climbing slices) and subjected to experimental treatments. Following treatment, the culture medium was removed, and the cells were incubated with Mito-Tracker Red CMXRos working solution (C1035, Beyotime, Shanghai, China) at 37 °C for 15–30 min. Following incubation, the Mito-Tracker Red CMXRos working solution was removed, and the cells were stained with culture medium containing 1X Hoechst 33,342 (C1027, Beyotime, Shanghai, China) live-cell staining solution. The cells were incubated at room temperature for 10 min. The staining solution was aspirated, and the cells were washed 2–3 times with PBS. An appropriate amount of anti-fluorescence quenching mounting medium was then applied, and a coverslip was placed over the cells. Finally, the samples were observed under a laser confocal microscope (TCSSP8, Leica, Wetzlar, Germany).

DNA Damage Detection

Cells were cultured on glass coverslip and subjected to experimental treatments. Following treatment, the medium was removed, and the cells were washed once with PBS. Then, 1 mL of fixing solution was added, and the cells were fixed for 5–15 min. After fixation, the fixing solution was aspirated, and the cells were washed three times with washing solution, each wash lasting 3–5 min. To block nonspecific binding, 1 mL of immunostaining blocking solution was added, and the cells were incubated at room temperature for 10–20 min. The blocking solution was then aspirated, and 1 mL of γ-H2AX mouse monoclonal antibody was applied. The cells were incubated at room temperature for 1 h. After incubation, the antibody solution was carefully removed, and the cells were washed three times with washing solution, each wash lasting 5–10 min. Next, 1 mL of anti-mouse 488 was added, and the cells were incubated at room temperature for 1 h. Following incubation, the secondary antibody was aspirated, and the cells were washed twice with washing solution, each wash lasting 5–10 min. For nuclear staining, 1 mL of DAPI staining solution was added, and the cells were stained at room temperature for approximately 5 min. The staining solution was then aspirated, and the cells were washed three times with washing solution, each wash lasting 3–5 min. Finally, an appropriate amount of anti-fluorescence quenching mounting medium was applied, and a coverslip was placed over the cells. The stained cells were then observed under a laser confocal microscope (TCSSP8, Leica, Wetzlar, Germany).

2.2.5. Fluorescence Quantification

Total RNA was extracted using the Trizol method, following the manufacturer’s instructions. RNA concentration and purity were assessed using a microplate spectrophotometer (Thermo Scientific, Ayer Rajah, Singapore) at an absorbance ratio of 260/280 nm. RNA integrity was verified via 1% agarose gel electrophoresis. To eliminate genomic DNA contamination, RNA samples were treated with RQ1 RNase-Free DNase. cDNA synthesis was performed using the Novozyme kit (Tianjin, China), in accordance with the manufacturer’s protocol.
Real-time fluorescence quantitative PCR (qPCR) was conducted using the SYBR Green I fluorescence method on a QuantStudio Flex real-time PCR system (Thermo Scientific, Ayer Rajah, Singapore). The cycling conditions were set according to the kit instructions. Primer sequences were designed using Primer 5.0 software and synthesized by Shanghai Shenggong Biological Engineering Co., Ltd., (Shanghai, China). The relative expression levels of target genes were calculated using the 2−ΔΔCt method, with β-actin as the reference gene. Primer amplification efficiency was validated for both the target and the reference genes. Each reaction was performed in triplicate to ensure accuracy. The primer sequences used in this study are listed in Table 1.

2.3. Data Analysis

Variance analysis was performed using SPSS version 23.0. Statistical significance was assessed through one-way ANOVA or t-test. Differences among the experimental groups were evaluated using Dunnett’s test for multiple comparisons. Results are presented as mean ± standard deviation (SD), with statistical significance set at p < 0.05.

3. Results

3.1. Cellular Biochemistry

BCAAs supplementation during cell culture effectively alleviated lipid droplet formation and reduced glycogen accumulation in hepatocytes induced by HG or HF exposure. Furthermore, ALT and AST activities in the culture medium were significantly lower in the BCAAs-treated groups compared to the HG and HF groups (p < 0.05; Figure 1).

3.2. Cellular Antioxidant Defense

As shown in Figure 2, BCAAs supplementation under HG or HF conditions significantly enhanced SOD activity (p < 0.05), and T-AOC (p < 0.05) in hepatocytes. Additionally, it markedly reduced MDA levels (p < 0.05) and decreased ROS production.

3.3. Cellular Metabolism

The activity of key metabolic enzymes involved in the citric acid cycle is presented in Figure 3. Under HG or HF conditions, BCAAs supplementation significantly increased the activity of CS, α-KGDHC, SDH, PEPCK, and LPS (p < 0.05) while reducing FAS activity (p < 0.05). These metabolic changes were accompanied by a significant increase in ATP content (p < 0.05).
The expression of genes related to glucose and lipid metabolism in hepatocytes is shown in Figure 4. Compared to the control group, BCAAs supplementation significantly downregulated the expression of lipogenic genes fas and srebp-1c (p < 0.05), while significantly upregulating the expression of lipolytic genes ppaα and atgl (p < 0.05). Furthermore, genes involved in glucose metabolism, including g6pd, hk, pfk, pk, fbp, and g6pase, were significantly upregulated (p < 0.05).

3.4. Mitochondrial Function

The effects of BCAAs supplementation on the mitochondrial membrane potential of L. maculatus are shown in Figure 5. BCAAs incorporation alleviated the reduction in membrane potential induced by HG or HF conditions, enhanced mitochondrial activity, and reduced DNA damage in hepatocytes.
The expression of genes associated with hepatocyte mitochondrial fusion, fission, biogenesis, and autophagy is displayed in Figure 6. BCAAs supplementation significantly promoted the expression of mitochondrial fusion genes pgc1α and pgc1b, as well as biogenesis genes mfn1b and mfn2 (p < 0.05). Conversely, it suppressed the expression of fission-related genes fis1 and drp1, along with autophagy-related genes mul1 and atg5 (p < 0.05).

4. Discussion

4.1. BCAAs Supplementation Mitigated Metabolic Disorders in Hepatocytes Induced by HG or HF Load

The liver plays a central role in metabolism in fish and other animals, making it a primary focus of metabolic research. Previous studies have shown that HG or HF diets lead to excessive glycogen and lipid deposition, resulting in liver damage [27,28]. In the present study, hepatocytes exposed to HG or HF conditions exhibited significantly elevated ALT and AST activities in the supernatant, indicating hepatocyte damage. However, BCAAs supplementation effectively alleviated lipid accumulation and glycogen deposition while reducing ALT and AST activities. These findings align with previous research in mice fed high-fructose or high-fat diets, suggesting that isolated hepatocytes exhibit metabolic responses comparable to in-vivo conditions.
Liver enzymes serve as key catalysts in physiological metabolism in fish [29]. To better understand the metabolic effects of BCAAs we analyzed the activities of key enzymes involved in the citric acid cycle, gluconeogenesis, and lipid metabolism. BCAAs supplementation significantly increased the activities of CS, α-KGDHC, SDH, PEPCK, and LPS while reducing FAS activity. The increased activities of CS, α-KGDHC, and SDH indicate enhanced glucose and lipid utilization in the citric acid cycle, while upregulated PEPCK activity, a rate-limiting enzyme in gluconeogenesis [30,31], indicates an acceleration of gluconeogenesis and reduced glycogen accumulation.
HK, G6pd, PFK, and PK are pivotal glycolytic enzymes essential for energy production. Meanwhile, FBP and G6Pase, are key regulators of gluconeogenesis, governing glycogen breakdown and glucose homeostasis [32,33,34]. Our study demonstrated that BCAAs supplemented significantly upregulated the expression of glycolysis-related enzymes (g6pd, hk, pfk, pk) and gluconeogenesis-related enzymes (fbp, g6pase). These findings suggest that BCAAs enhance both glycolysis and gluconeogenesis in hepatocytes, strengthening energy metabolism while preventing excessive glycogen accumulation.
The sterol regulatory element-binding protein (SREBP) family is a key regulator of cholesterol, fatty acid, triglyceride, and glycerophospholipid synthesis, with SREBP-1c specifically controlling the transcription of lipogenic genes such as fas and acc. FAS and acetyl-CoA carboxylase (ACC) are major enzymes involved in fatty acid biosynthesis [35,36,37]. Conversely, ATGL is crucial for lipolysis, as it catalyzes the initial break down of triglycerides. Impaired ATGL expression can lead to excessive triglyceride accumulation, contributing to obesity and metabolic disorders [38,39,40,41]. Our study revealed that BCAAs supplementation significantly downregulated the expression of lipogenic genes fas and srebp-1c, while upregulating lipolytic genes ppaα and atgl. This suggests that BCAAs promote lipid breakdown and inhibit lipid synthesis, thereby reducing fat deposition in the liver of L. maculatus. BCAAs likely modulate the expression of SREBP precursors, thereby reducing srebp-1c expression and its downstream targets fas and acc, while simultaneously enhancing the expression of lipolysis-related genes such as atgl, thereby improving lipid homeostasis by reducing triglyceride accumulation.
Antioxidant markers provide valuable insights into organismal health. AOC reflects the cumulative antioxidant potential from substances and enzymes, with SOD and CAT serving as key enzymes for neutralizing free radicals [42,43]. MDA, a product of lipid peroxidation, serves as a marker of oxidative stress [44,45]. In this study, HG and HF conditions caused a significant decline in T-AOC, and activities of SOD, and CAT, along with increased MDA levels, indicating oxidative stress in L. maculatus hepatocytes. However, BCAAs supplementation effectively alleviated oxidative stress, restoring antioxidant enzyme activity and enhancing overall cellular antioxidant capacity.

4.2. BCAAs Supplementation Alleviated Mitochondrial Damage Caused by HG or HF Loads

Mitochondria play a fundamental role in liver metabolism, and their structural integrity is essential for cellular function [46]. The mitochondrial membrane acts as a critical barrier, protecting the organelle from damage. However, its permeability increases significantly when mitochondria are compromised [47,48]. In this study, HG or HF exposure caused a decrease in mitochondrial membrane potential and a decline in mitochondrial activity in hepatocytes. Conversely, BCAAs supplementation preserved mitochondrial membrane potential and activity, suggesting their protective role in maintaining mitochondrial stability.
The mitochondrial respiratory chain is a primary site of ROS production. Disruption of this chain can lead to electron leakage, which combines with oxygen and other molecules to generate ROS. This study found that HG or HF conditions inhibited ATP production and increased ROS levels. However, BCAAs supplementation significantly alleviated these adverse effects.
Mitochondrial DNA (mt DNA), a circular DNA located within mitochondria, encodes proteins essential for energy metabolism. Unlike nuclear DNA, mt DNA is highly susceptible to oxidative damage caused by ROS, which can impair mitochondrial function and overall cellular health. This study demonstrated that BCAAs supplementation significantly mitigated mt DNA damage induced by high-glucose or high-fat conditions, reducing oxidative stress and preserving mitochondrial integrity in hepatocytes.
Mitochondria are highly dynamic organelles that undergo constant renewal under normal physiological conditions. Two key processes—mitochondrial biogenesis (the generation of new mitochondria) and mitochondrial autophagy (the clearance of damaged or aged mitochondria)—work together to maintain mitochondrial homeostasis [49,50]. PGC-1α and PGC-1β, are crucial transcriptional regulators of mitochondrial biogenesis. They coordinate the activation of downstream transcription factors, enhancing mt DNA transcription and the synthesis of key mitochondrial enzymes, thereby promoting mitochondrial generation [51]. Notably, PGC-1β has been found to be more effective than PGC-1α in driving mitochondrial biogenesis in fish. This study demonstrated that HG or HF exposure significantly downregulated the expression of pgc-1α and pgc-1β, while BCAAs supplementation restored their expression levels. These findings indicate that BCAAs can reverse the inhibition of mitochondrial biogenesis caused by HG or HF conditions in the liver of L. maculatus, thereby promoting mitochondrial generation.
Mitochondrial autophagy, regulated by the PINK1/parkin pathway, is another critical process for maintaining mitochondrial health, with genes such as mul1 and atg5 playing essential roles in this pathway [52]. This study revealed that HG or HF exposure significantly suppressed the expression of mul1 and atg5. However, BCAAs supplementation upregulated these genes, thereby activating mitochondrial autophagy in the liver of L. maculatus. A balanced relationship between mitochondrial autophagy and biogenesis is vital for maintaining mitochondrial function. Disruption of this balance can impair mitochondrial homeostasis and biogenesis. The findings of this study underscore the protective effects of BCAAs in maintaining this balance, reducing mitochondrial damage, and promoting overall mitochondrial health in hepatocytes under HG or HF stress.

5. Conclusions

In summary, the isolated hepatocytes of L. maculatus exhibited physiological responses comparable to in vivo conditions under HG or HF conditions, establishing them as a reliable model for studying fish metabolism. BCAAs supplementation effectively alleviated mitochondrial damage, promoted mitochondrial biogenesis, and preserved oxidative phosphorylation processes in hepatocytes subjected to HG or HF conditions. These effects mitigated oxidative stress-induced damage to both hepatocytes and mitochondria, thereby supporting cellular metabolic homeostasis. In the future, aquaculture production can benefit from optimizing feed formulations by incorporating appropriate amounts of BCAAs. This strategy has the potential to improve feed utilization, reduce the incidence of metabolic disorders, and promote healthy growth and production efficiency in fish.

Author Contributions

Draft manuscript, H.R. and Y.K.; methodology, H.R. and X.L.; laboratory analysis, H.R., K.S. and L.W.; statistical analysis, H.R.; supervision, K.L. and C.Z.; writing—reviews and editing, H.R., K.L., F.A.G. and S.R. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Natural Science Foundation of Fujian Province of China (2023J06035) and Special Fund Project for Promoting High-quality Development of Marine and Fishery Industry of Fujian Province (FJHYF-L-2023-6).

Institutional Review Board Statement

Ethical approval is not necessary, as this study only uses the liver cell line of the spotted sea bass.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets generated and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Conflicts of Interest

Author Samad Rahimnejad was employed by the company Conqueren Leading Fresh Science & Technology Inc., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Tamanna, N.; Mahmood, N. Emerging Roles of Branched-Chain Amino Acid Supplementation in Human Diseases. Int. Math. Res. Not. 2014, 2014, 235619. [Google Scholar] [CrossRef] [PubMed]
  2. De Bandt, J.P.; Coumoul, X.; Barouki, R. Branched-Chain Amino Acids and Insulin Resistance, from Protein Supply to Diet-Induced Obesity. Nutrients 2022, 15, 68. [Google Scholar] [CrossRef] [PubMed]
  3. Bonvini, A.; Rogero, M.M.; Coqueiro, A.Y.; Raizel, R.; Bella, L.M.; Fock, R.A.; Borelli, P.; Tirapegui, J. Effects of different branched-chain amino acids supplementation protocols on the inflammatory response of LPS-stimulated RAW 264.7 macrophages. Amino Acids 2021, 53, 597–607. [Google Scholar] [CrossRef] [PubMed]
  4. Valerio, A.D.; Antona, G.; Nisoli, E. Branched-chain amino acids, mitochon-drial biogenesis, and healthspan: An evolutionary perspective. Aging 2011, 3, 464–478. [Google Scholar] [CrossRef]
  5. Blair, M.C.; Neinast, M.D.; Arany, Z. Whole-body metabolic fate of branched-chain amino acids. Biochemical. J. 2021, 478, 765–776. [Google Scholar] [CrossRef]
  6. Ra, S.G.; Miyazaki, T.; Ishikura, K.; Nagayama, H.; Komine, S.; Nakata, Y.; Maeda, S.; Matsuzaki, Y.; Ohmori, H. Combined effect of branched-chain amino acids and taurine supple-mentation on delayed onset muscle soreness and muscle damage inhigh-intensity eccentric exercise. J. Int. Soc. Sports Nutr. 2013, 10, 51. [Google Scholar] [CrossRef]
  7. Fouré, A.; Bendahan, D. Is branched-chain amino acids supplementation an efficient nutritional strategy to alleviate skeletal muscle damage? A systematic review. Nutrients 2017, 9, 1047. [Google Scholar] [CrossRef]
  8. Holeček, M. Branched-chain amino acid supplementation in treatment of liver cirrhosis: Updated views on how to attenuate their harmful effects on cataplerosis and ammonia formation. Nutrition 2017, 41, 80–85. [Google Scholar] [CrossRef]
  9. Weber, M.G.; Dias, S.S.; de Angelis, T.R.; Fernandes, E.V.; Bernardes, A.G.; Milanez, V.F.; Jussiani, E.I.; Ramos, S.d.P. The use of BCAA to decrease delayed-onset muscle soreness after a single bout of exercise:a systematic review and meta-analysis. Amino Acids. 2021, 53, 1663–1678. [Google Scholar] [CrossRef]
  10. Doma, K.; Singh, U.; Boullosa, D.; Connor, J.D. The effect of branched-chain amino acid on muscle damage markers and performance following strenuous exercise: A systematic review and meta-analysis. Nutr. Metab. 2021, 46, 1303–1313. [Google Scholar] [CrossRef]
  11. Hormoznejad, R.; Zare Javid, A.; Mansoori, A. Effect of BCAA supplemen-tation on central fatigue, energy metabolism substrate and muscle damage to the exercise: A systematic review with meta-analysis. Sport. Sci. Health 2019, 15, 265–279. [Google Scholar] [CrossRef]
  12. Khemtong, C.; Kuo, C.H.; Chen, C.Y.; Jaime, S.J.; Condello, G. Does branched-chain amino acids (BCAAs) supplementation attenuate muscle damage markers and soreness after resistance exercise in trained males? A meta-analysis of randomized controlled trials. Nutrients 2021, 13, 1880. [Google Scholar] [CrossRef] [PubMed]
  13. Rahimi, M.H.; Shab-Bidar, S.; Mollahosseini, M.; Djafarian, K. Branched-chain amino acid supplementation and exercise-induced muscle damage in exercise recovery: A meta-analysis of randomized clinical trials. Nutrition 2017, 42, 30–36. [Google Scholar] [CrossRef] [PubMed]
  14. Rahimlou, M.; Ramezani, A.; Mahdipour, M.; Palimi, E.; Moradipoodeh, B. Reduction of muscle injuries and improved post-exercise recovery by branched-chain amino acid supplementation: A systematic review and meta-analysis. J. Nutr. Health Aging. 2020, 8, 1–16. [Google Scholar]
  15. McGarrah, R.W.; White, P.J. Branched-chain amino acids in cardiovascular disease. Nat. Rev. Cardiol. 2023, 20, 77–89. [Google Scholar] [CrossRef]
  16. Lauer, S.M.; Omar, M.H.; Golkowski, M.G.; Kenerson, H.L.; Lee, K.-S.; Pascual, B.C.; Lim, H.C.; Forbush, K.; Smith, F.D.; Gordan, J.D.; et al. Recruitment of BAG2 to DNAJ-PKAc scaffolds promotes cell survival and resistance to drug-induced apoptosis in fibrolamellar carcinoma. Cell Rep. 2024, 43, 113678. [Google Scholar] [CrossRef]
  17. Lo, E.K.K.; Felicianna; Xu, J.-H.; Zhan, Q.; Zeng, Z.; El-Nezami, H. The Emerging Role of Branched-Chain Amino Acids in Liver Diseases. Biomedicines 2022, 10, 1444. [Google Scholar] [CrossRef]
  18. Ananieva, E.A.; Van Horn, C.G.; Jones, M.R.; Hutson, S.M. Liver BCATm transgenic mouse model reveals the important role of the liver in maintaining BCAA homeostasis. J. Nutr. Biochem. 2017, 40, 132–140. [Google Scholar] [CrossRef]
  19. Kamalam, B.S.; Medale, F.; Panserat, S. Utilisation of dietary carbohydrates in farmed fishes: New insights on influencing factors, biological limitations and future strategies. Aquaculture 2017, 467, 3–27. [Google Scholar] [CrossRef]
  20. Sari, D.N.; Ekasari, J.; Nasrullah, H.; Suprayudi, M.A.; Alimuddin, A. High carbohydrate increases amylase, plasma glucose, and gene expression related to glycolysis in giant gourami Osphronemus goramy. Fish. Physiol. Biochem. 2022, 48, 1495–1505. [Google Scholar] [CrossRef]
  21. Lin, S.-M.; Shi, C.-M.; Mu, M.-M.; Chen, Y.-J.; Luo, L. Effect of high dietary starch levels on growth, hepatic glucose metabolism, oxidative status and immune response of juvenile largemouth bass, Micropterus salmoides. Fish. Shellfish. Immunol. 2018, 78, 121–126. [Google Scholar] [CrossRef] [PubMed]
  22. Lu, K.-L.; Wang, L.-N.; Zhang, D.-D.; Liu, W.-B.; Xu, W.-N. Berberine Attenuates Oxidative Stress and Hepatocytes Apoptosis Via Protecting Mitochondria in Blunt Snout Bream Megalobrama amblycephala Fed High- Fat Diets. Fish. Physiol. Biochem. 2017, 43, 65–76. [Google Scholar] [CrossRef] [PubMed]
  23. Xia, T.; Mao, X.; Zhang, J.; Rahimnejad, S.; Lu, K. Effects of quercetin and hydroxytyrosol supplementation in a high-fat diet on growth, lipid metabolism, and mitochondrial function in spotted seabass (Lateolabrax maculatus). Aquaculture 2024, 582, 740538. [Google Scholar] [CrossRef]
  24. Dong, Y.; Yu, M.; Wu, Y.; Xia, T.; Wang, L.; Song, K.; Zhang, C.; Lu, K.; Rahimnejad, S. Hydroxytyrosol Promotes the Mitochondrial Function through Activating Mitophagy. Antioxidants 2022, 11, 893. [Google Scholar] [CrossRef]
  25. Ren, H.J.; Ke, Y.X.; Lu, K.L.; Li, X.S.; Wang, L.; Song, K.; Zhang, C.X. Effects of high-glucose load on energy metabolism and mitochondrial function of hepatocytes from spotted seabass (Lateolabrax maculatus). J. Fish. Sci. China 2024, 31, 513–523. [Google Scholar]
  26. Mao, X.J. Alleviation Effect and Mechanism of Coenzyme Q10 on Excessive Fat Deposition in Liver of Lateolabrax maculatus Induced by High-Fat Diet. Master’s Thesis, Jimei University, China, Xiamen, 2024. [Google Scholar]
  27. Jung, S.M.; Doxsey, W.G.; Le, J.; Haley, J.A.; Mazuecos, L.; Luciano, A.K.; Li, H.; Jang, C.; Guertin, D.A. In vivo isotope tracing reveals the versatility of glucose as a brown adipose tissue substrate. Cell Rep. 2021, 36, 109459. [Google Scholar] [CrossRef]
  28. Zhu, J.; Pan, J.; Wang, X.; Huang, Y.; Qin, C.; Qiao, F.; Qin, J.; Chen, L. Alleviation of the adverse effect of dietary carbohydrate by supplementation of myo-inositol to the diet of Nile tilapia (Oreochromis niloticus). Animals 2020, 10, 2190. [Google Scholar] [CrossRef]
  29. Li, S.; Li, Z.; Zhang, J.; Sang, C.; Chen, N. The impacts of dietary carbohydrate levels on growth performance, feed utilization, glycogen accumulation and hepatic glucose metabolism in hybrid grouper (Epinephelus fuscoguttatus ♀ × E. lanceolatus♂). Aquaculture 2019, 512, 734351. [Google Scholar] [CrossRef]
  30. Bornstein, M.R.; Neinast, M.D.; Zeng, X.; Chu, Q.; Axsom, J.; Thorsheim, C.; Li, K.; Blair, M.C.; Rabinowitz, J.D.; Arany, Z. Comprehensive quantification of metabolic flux during acute cold stress in mice. Cell Metab. 2023, 35, 2077–2092. [Google Scholar] [CrossRef]
  31. Qian, L.; Li, N.; Lu, X.C.; Xu, M.; Liu, Y.; Li, K.; Zhang, Y.; Hu, K.; Qi, Y.T.; Yao, J.; et al. Enhanced BCAT1 activity and BCAA metabolism promotes RhoC activity in cancer progression. Nat. Metab. 2023, 5, 1159–1173. [Google Scholar] [CrossRef]
  32. Wang, J.; Liu, Y.; Lian, K.; Shentu, X.; Fang, J.; Shao, J.; Chen, M.; Wang, Y.; Zhou, M.; Sun, H. BCAA catabolic defect alters glucose metabolism in lean mice. Front. Physiol. 2019, 10, 1140. [Google Scholar] [CrossRef] [PubMed]
  33. Hui, S.; Cowan, A.J.; Zeng, X.; Yang, L.; TeSlaa, T.; Li, X.; Bartman, C.; Zhang, Z.; Jang, C.; Wang, L.; et al. Quantitative Fluxomics of Circulating Metabolites. Cell Metab. 2020, 32, 676–688. [Google Scholar] [CrossRef] [PubMed]
  34. Yoneshiro, T.; Kataoka, N.; Walejko, J.M.; Ikeda, K.; Brown, Z.; Yoneshiro, M.; Crown, S.B.; Osawa, T.; Sakai, J.; McGarrah, R.W.; et al. Meta-bolic flexibility via mitochondrial BCAA carrier SLC25A44 is required for optimal fever. eLife 2021, 10, 66865. [Google Scholar] [CrossRef] [PubMed]
  35. Espenshade, P.J. SREBPs:Sterol-Regulated Transcription Factors. J. Cell Sci. 2006, 119, 973–976. [Google Scholar] [CrossRef]
  36. Brown, M.S.; Goldstein, J.L. Cholesterol Feedback: From Schoenheimer’s Bottle to Scap’s MELADL. Lipid Res. 2009, 50, S15–S27. [Google Scholar] [CrossRef]
  37. Dong, Y.Z.; Wei, Y.; Wang, L.; Song, K.; Zhang, C.X.; Lu, K.L.; Rahimnejad, S. Dietary n-3/n-6 PUFA ratio modulates growth performance in spotted seabass (Lateolabrax maculatus) through regulating lipid metabolism, hepatic antioxidant capacity and intestinal health. Anim. Nutr. 2023, 14, 20–31. [Google Scholar] [CrossRef]
  38. Athanikar, J.N.; Sanchez, H.B.; Osborne, T.F. Promoter Selective Transcriptional Synergy Mediated by Sterol Regulatory Element Binding Protein and Sp1: A Critical Role for the Btd Domain of Sp1. Mol. Cell Biol. 1997, 17, 5193–5200. [Google Scholar] [CrossRef]
  39. Wilentz, R.E.; Witters, L.A.; Pizer, E.S. Lipogenic Enzymes Fatty Acid Synthase and Acetyl-Coenzyme a Carboxylase are Coexpressed with Sterol Regulatory Element Binding Protein and Ki-67 in Fetal Tissues. Pediatr. Dev. Pathol. 2000, 3, 525–531. [Google Scholar] [CrossRef]
  40. Zimmermann, R.; Strauss, J.G.; Haemmerle, G.; Schoiswohl, G.; Birner-Gruenberger, R.; Riederer, M.; Lass, A.; Neuberger, G.; Eisenhaber, F.; Hermetter, A.; et al. Fat Mobilization in Adipose Tissue is Promoted by Adipose Triglyceride Lipase. Science 2004, 306, 1383–1386. [Google Scholar] [CrossRef]
  41. Schreiber, R.; Xie, H.; Schweiger, M. Of Mice and Men: The Physiological Role of Adipose Triglyceride Lipase (ATGL). Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2019, 1864, 880–899. [Google Scholar] [CrossRef]
  42. Calabrese, G.; Morgan, B.; Riemer, J. Mitochondrial Glutathione: Regulation and Functions. Antioxid. Redox Signal. 2017, 27, 1162–1177. [Google Scholar] [CrossRef] [PubMed]
  43. Zhan, Q.; Han, T.; Li, X.; Wang, J.; Yang, Y.; Yu, X.; Zheng, P.; Liu, T.; Xu, H.; Wang, C. Effects of dietary carbohydrate levels on growth, body composition, and gene expression of key enzymes involved in hepatopancreas metabolism in mud crab Scylla paramamosain. Aquaculture 2020, 529, 735638. [Google Scholar] [CrossRef]
  44. Forman, H.J.; Zhang, H.; Rinna, A. Glutathione: Overview of its protective roles, measurement, and biosynthesis. Mol. Asp. Med. 2009, 30, 1–12. [Google Scholar] [CrossRef]
  45. Pfanner, N.; Warscheid, B.; Wiedemann, N. Mitochondrial proteins: From biogenesis to functional networks. Nat. Rev. Mol. Cell Biol. 2019, 20, 26. [Google Scholar] [CrossRef]
  46. Palikaras, K.; Lionaki, E. Taverarakis. Balancing Mitochondrial Biogenesis and Mitophagy to Maintain Energy Metabolism Homeostasis. Cell Death Differ. 2015, 22, 1399–1401. [Google Scholar] [CrossRef]
  47. Yu, E.P.K.; Bennett, M.R. The Role of Mitochondrial DNA Damage in the Development of Atherosclerosis. Free Radic. Biol. Med. 2016, 100, 223–230. [Google Scholar]
  48. Mao, S.; Medeiros, D.M.; Leone, T.C.; Kelly, D.P. Mitochondrial Transcription Factor A is Increased but Expression of ATP Synthase Beta Subunit and Medium-Chain Acyl-CoA Dehydrogenase Genes are Decreased in Hearts of Copper-Deficient Rats. J. Nutr. 2000, 130, 2143–2150. [Google Scholar] [CrossRef]
  49. Bremer, K.; Kocha, K.; Snider, T.; Moyes, C. Sensing and Responding to Energetic Stress:The Role of the AMPK-PGC1alpha-NRF1 Axis in Control of Mitochondrial Biogenesis in Fish. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2016, 199, 4–12. [Google Scholar] [CrossRef]
  50. Lazarou, M.; Sliter, D.A.; Kane, L.A.; Sarraf, S.A.; Wang, C.; Burman, J.L.; Sideris, D.P.; Fogel, A.I.; Youle, R.J. The Ubiquitin Kinase PINK1 Recruits Autophagy Receptors to Induce Mitophagy. Nature 2015, 524, 309–314. [Google Scholar] [CrossRef]
  51. Palikaras, K.; Taverarakis, N. Mitochondrial Homeostasis: The Interplay between Mitophagy and Mitochondrial Biogenesis. Exp. Gerontol. 2014, 56, 182–188. [Google Scholar] [CrossRef]
  52. Beaulant, A.; Dia, M.; Pillot, B.; Chauvin, M.-A.; Ji-Cao, J.; Durand, C.; Bendridi, N.; Chanon, S.; Vieille-Marchiset, A.; Da Silva, C.C.; et al. Endoplasmic Reticulum-Mitochondria Miscommunication is an Early and Causal Trigger of Hepatic Insulin Resistance and Steatosis. J. Hepatol. 2022, 77, 710–722. [Google Scholar] [CrossRef]
Animals 15 00560 g001aAnimals 15 00560 g001b
Figure 1. Effects of BCAAs supplementation on hepatocyte biochemistry in spotted seabass (Lateolabrax maculatus): (a) lipid deposition; (b) glycogen content; (c) ALT activity; (d) AST activity. ** indicates extremely significant differences between groups (p < 0.01).
Figure 1. Effects of BCAAs supplementation on hepatocyte biochemistry in spotted seabass (Lateolabrax maculatus): (a) lipid deposition; (b) glycogen content; (c) ALT activity; (d) AST activity. ** indicates extremely significant differences between groups (p < 0.01).
Animals 15 00560 g001aAnimals 15 00560 g001b
Animals 15 00560 g002
Figure 2. Effects of BCAAs supplementation on antioxidant capacity in hepatocytes of spotted seabass (Lateolabrax maculatus): (a) SOD activity; (b) CAT activity; (c) MDA content; (d) T-AOC; (e) ROS concentration. * indicates significant differences between groups (p < 0.05); ** indicates extremely significant differences between groups (p < 0.01).
Figure 2. Effects of BCAAs supplementation on antioxidant capacity in hepatocytes of spotted seabass (Lateolabrax maculatus): (a) SOD activity; (b) CAT activity; (c) MDA content; (d) T-AOC; (e) ROS concentration. * indicates significant differences between groups (p < 0.05); ** indicates extremely significant differences between groups (p < 0.01).
Animals 15 00560 g002
Animals 15 00560 g003
Figure 3. Effects of BCAAs supplementation on hepatocyte metabolism in spotted seabass (Lateolabrax maculatus): (a) CS activity; (b) CAT activity; (c) SDH content; (d) PEPCK activity; (e) LPS activity; (f) FAS activity; (g) ATP content. ** indicates extremely significant differences between groups (p < 0.01).
Figure 3. Effects of BCAAs supplementation on hepatocyte metabolism in spotted seabass (Lateolabrax maculatus): (a) CS activity; (b) CAT activity; (c) SDH content; (d) PEPCK activity; (e) LPS activity; (f) FAS activity; (g) ATP content. ** indicates extremely significant differences between groups (p < 0.01).
Animals 15 00560 g003
Animals 15 00560 g004
Figure 4. Effects of BCAAs supplementation on the expression of genes related to glucose and lipid metabolism in hepatocytes of spotted seabass (Lateolabrax maculatus) under high-glucose or high-fat load. * indicates significant differences between groups (p < 0.05); ** indicates extremely significant differences between groups (p < 0.01).
Figure 4. Effects of BCAAs supplementation on the expression of genes related to glucose and lipid metabolism in hepatocytes of spotted seabass (Lateolabrax maculatus) under high-glucose or high-fat load. * indicates significant differences between groups (p < 0.05); ** indicates extremely significant differences between groups (p < 0.01).
Animals 15 00560 g004
Animals 15 00560 g005
Figure 5. Effects of BCAAs supplementation on mitigating hepatocyte mitochondrial damage induced by high-glucose or high-fat conditions: (a) cell membrane potential; (b) mitochondrial activity; (c) mitochondrial DNA damage.
Figure 5. Effects of BCAAs supplementation on mitigating hepatocyte mitochondrial damage induced by high-glucose or high-fat conditions: (a) cell membrane potential; (b) mitochondrial activity; (c) mitochondrial DNA damage.
Animals 15 00560 g005
Animals 15 00560 g006
Figure 6. Effects of BCAAs supplementation on the expression of genes related to mitochondrial fusion and fission under high-glucose or high-fat conditions. * Indicates significant differences between groups (p < 0.05); ** indicates extremely significant differences between groups (p < 0.01).
Figure 6. Effects of BCAAs supplementation on the expression of genes related to mitochondrial fusion and fission under high-glucose or high-fat conditions. * Indicates significant differences between groups (p < 0.05); ** indicates extremely significant differences between groups (p < 0.01).
Animals 15 00560 g006
Table 1. Sequences of the primers used for real-time PCR.
Table 1. Sequences of the primers used for real-time PCR.
Target GeneForward Sequence (5′−3′)Reversed Sequence (5′−3′)Annealing Temperature
g6pdATGCTCTGTTTGGTCGCCATACATCCGACAGAGCAACAGG60
hkCTGGCTTGTGGGGACAGATTGAGGCTGGCCCTCTTTATCC60
pfk-1CGAGGGGCTAAATGTCAGGGAAGGGGCATTCCGGTGATTT60
pkGTGGCCCAATCCAAATGTCCGCAAGAGTGAGAGTTGGGGT60
fbpAACTGAGAAAGTCCCCCGACCCGGCCAAAACCTCGTATCT60
g6paseCAGGTCATGGGGTACTGCTCTTCCCGCTTTGGTTTCACCT60
fasAAACTGAAGCCCTGTGTGCCCACCCTGCCTATTACATTGCTC60
srebp-1cCCTCACTCTGCAGCCAATCACGTAGTCCCACCCTCAAACC60
ppaαCCGTGCGTGTTTTCACCATTAGACCAAATACATCGCCCCC60
cpt-1αCCTCAATGATACATCGGAACCCCTGCGGCTCATCATCTAACG60
hslCGAAACACAGAGACGGTCCATCATGACATCTACCAGCCGC60
atglCTTCCTCTCCGCAACAAGTCTGGTGCTGTCTGGAGTGTTC60
drp1CTCGCCAACAGAAACGGAACTGGCACTTTGGTCTTCGACA60
mfn1bGTCAACGCTATGCTGAGGGATCATCAGAGCCCTCCGTCTT60
mfn2TTCCAACGACCCAACACCAAGTAGGCCCCCAACTGTTCAA60
mul1GCTGCCGTGATACGAGTCATACGTTGGACAAGGACTGGAC60
atg5TCAGTCGCTGCCATTAGAGCTCTCGTCACCTGCGAAAACT60
pgc-1αAACCCGACTCTTATCCCTCCCGTATCAACGCCACAGCAC60
pgc-1βGTTCCTCCGAACTCCCAGTGGCAACACCCCTCCAACTACA60
fis1GTCCCGGGAGTCATCCTTTGACAATGAGCTGGTGAAGGGAG60
β-actinCAACTGGGATGACATGGAGAAGTTGGCTTTGGGGTTCAGG60
Note: g6pd, glucose-6-phosphate dehydrogenase; hk, hexokinase; pfk-1, phosphofructokinase-1; pk, pyruvate kinase; fbp, fructose 1, 6-bisphosptase; g6pase, glucose-6-phosphatase G-6-pase; fas, fatty acid synthase; srebp-1c, sterol regulatory element-binding protein 1c; ppaα, peroxisome proliferators-activated receptors; cpt-1α, carnitine palmitoyl transferase 1A; hsl, hormone-sensitive triglyceride lipase; atgl, adipose triglyceride; drp1, dynamin-related protein 1; mfn1b, mitofusin1b; mfn2, mitofusin2; mull, mitochondrial E3 ubiquitin protein ligase 1; atg5, autophagy related 5; pgc-1α, proliferator-activated receptor gamma co-activator 1α; pgc-1β, proliferator-activated receptor gamma co-activator 1β; fis1, mitochondrial fission protein 1; β-actin, beta-actin.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ren, H.; Ke, Y.; Li, X.; Wang, L.; Song, K.; Guardiola, F.A.; Zhang, C.; Lu, K.; Rahimnejad, S. Application of Branched-Chain Amino Acids Mitigates Mitochondrial Damage to Spotted Seabass (Lateolabrax maculatus) Hepatocytes Cultured in High-Glucose and High-Fat Media. Animals 2025, 15, 560. https://doi.org/10.3390/ani15040560

AMA Style

Ren H, Ke Y, Li X, Wang L, Song K, Guardiola FA, Zhang C, Lu K, Rahimnejad S. Application of Branched-Chain Amino Acids Mitigates Mitochondrial Damage to Spotted Seabass (Lateolabrax maculatus) Hepatocytes Cultured in High-Glucose and High-Fat Media. Animals. 2025; 15(4):560. https://doi.org/10.3390/ani15040560

Chicago/Turabian Style

Ren, Huijuan, Yixiong Ke, Xueshan Li, Lin Wang, Kai Song, Francisco A. Guardiola, Chunxiao Zhang, Kangle Lu, and Samad Rahimnejad. 2025. "Application of Branched-Chain Amino Acids Mitigates Mitochondrial Damage to Spotted Seabass (Lateolabrax maculatus) Hepatocytes Cultured in High-Glucose and High-Fat Media" Animals 15, no. 4: 560. https://doi.org/10.3390/ani15040560

APA Style

Ren, H., Ke, Y., Li, X., Wang, L., Song, K., Guardiola, F. A., Zhang, C., Lu, K., & Rahimnejad, S. (2025). Application of Branched-Chain Amino Acids Mitigates Mitochondrial Damage to Spotted Seabass (Lateolabrax maculatus) Hepatocytes Cultured in High-Glucose and High-Fat Media. Animals, 15(4), 560. https://doi.org/10.3390/ani15040560

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop