Phylogenetic and Genetic Variation Analysis of Porcine Epidemic Diarrhea Virus in East Central China during 2020–2023
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Clinical Sample Information
2.2. Primer Design
2.3. Real-Time PCR Detection and S Gene Sequencing
2.4. Phylogenetic Analyses
2.5. Recombinant Analyses
3. Results
3.1. Identity and Homology Analysis of S Gene Sequence
3.2. Phylogenetic Analysis of PEDV Based on Nucleotide Sequences of the S Gene
3.3. Recombination Analysis of PEDV Based on Nucleotide Sequences of the S Gene
3.4. Comparative Analysis of Amino Acid Sequences of S Protein
3.5. Different Antigenic Index of PEDV S Protein
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lin, F.; Zhang, H.; Li, L.; Yang, Y.; Zou, X.; Chen, J.; Tang, X. PEDV: Insights and Advances into Types, Function, Structure, and Receptor Recognition. Viruses 2022, 14, 1744. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jung, K.; Saif, L.J.; Wang, Q. Porcine epidemic diarrhea virus (PEDV): An update on etiology, transmission, pathogenesis, and prevention and control. Virus Res. 2020, 286, 198045. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, C.M.; Saif, L.J.; Marthaler, D.; Wang, Q. Evolution, antigenicity and pathogenicity of global porcine epidemic diarrhea virus strains. Virus Res. 2016, 226, 20–39. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, W.T.; Bollen, N.; Xu, Y.; Zhao, J.; Dellicour, S.; Yan, Z.; Gong, W.; Zhang, C.; Zhang, L.; Lu, M.; et al. Phylogeography Reveals Association between Swine Trade and the Spread of Porcine Epidemic Diarrhea Virus in China and across the World. Mol. Biol. Evol. 2022, 39, msab364. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Q.; Vlasova, A.N.; Kenney, S.P.; Saif, L.J. Emerging and re-emerging coronaviruses in pigs. Curr. Opin. Virol. 2019, 34, 39–49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, C. Porcine epidemic diarrhea virus: An emerging and re-emerging epizootic swine virus. Virol. J. 2015, 12, 193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, B.; Dong, S.; Yu, L.; Si, F.; Li, C.; Xie, C.; Yu, R.; Li, Z. Three Amino Acid Substitutions in the Spike Protein Enable the Coronavirus Porcine Epidemic Diarrhea Virus To Infect Vero Cells. Microbiol. Spectr. 2023, 11, e0387222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhuang, H.; Sun, L.; Wang, X.; Xiao, M.; Zeng, L.; Wang, H.; Yang, H.; Lin, F.; Wang, C.; Qin, L.; et al. Molecular characterization and phylogenetic analysis of porcine epidemic diarrhea virus strains circulating in China from 2020 to 2021. BMC Vet. Res. 2022, 18, 392. [Google Scholar] [CrossRef] [Scilit]
- Huan, C.; Pan, H.; Fu, S.; Xu, W.; Gao, Q.; Wang, X.; Gao, S.; Chen, C.; Liu, X. Characterization and evolution of the coronavirus porcine epidemic diarrhoea virus HLJBY isolated in China. Transbound. Emerg. Dis. 2020, 67, 65–79. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, M.; Ma, J.; Wang, Y.; Wang, M.; Song, W.; Zhang, W.; Lu, C.; Yao, H. Genomic and epidemiological characteristics provide new insights into the phylogeographical and spatiotemporal spread of porcine epidemic diarrhea virus in Asia. J. Clin. Microbiol. 2015, 53, 1484–1492. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, D.; Fang, L.; Xiao, S. Porcine epidemic diarrhea in China. Virus Res. 2016, 226, 7–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Choudhury, B.; Dastjerdi, A.; Doyle, N.; Frossard, J.P.; Steinbach, F. From the field to the lab—An European view on the global spread of PEDV. Virus Res. 2016, 226, 40–49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Diep, N.; Sueyoshi, M.; Norimine, J.; Hirai, T.; Myint, O.; Teh, A.P.P.; Izzati, U.Z.; Fuke, N.; Yamaguchi, R. Molecular characterization of US-like and Asian non-S INDEL strains of porcine epidemic diarrhea virus (PEDV) that circulated in Japan during 2013–2016 and PEDVs collected from recurrent outbreaks. BMC Vet. Res. 2018, 14, 96. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, M.; Pan, Y.; Xi, Y.; Wang, M.; Zeng, Q. Insights and progress on epidemic characteristics, genotyping, and preventive measures of PEDV in China: A review. Microb. Pathog. 2023, 181, 106185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, J.; Fang, L.; Ye, X.; Chen, J.; Xu, S.; Zhu, X.; Miao, Y.; Wang, D.; Xiao, S. Evolutionary and genotypic analyses of global porcine epidemic diarrhea virus strains. Transbound. Emerg. Dis. 2019, 66, 111–118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.M.; Niu, B.B.; Yan, H.; Gao, D.S.; Yang, X.; Chen, L.; Chang, H.T.; Zhao, J.; Wang, C.Q. Genetic properties of endemic Chinese porcine epidemic diarrhea virus strains isolated since 2010. Arch. Virol. 2013, 158, 2487–2494. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, B.; Jiao, D.; Zhao, X.; Pang, F.; Xiao, Q.; Yu, Z.; Mao, A.; Guo, R.; Yuan, W.; Zhao, P.; et al. Characterization of Chinese Porcine Epidemic Diarrhea Virus with Novel Insertions and Deletions in Genome. Sci. Rep. 2017, 7, 44209. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, X.; Li, Z.; Zeng, X.; Zhang, G.; Niu, J.; Sun, B.; Ma, J. Sequence analysis of the spike gene of Porcine epidemic diarrhea virus isolated from South China during 2011–2015. J. Vet. Sci. 2017, 18, 237–243. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, D.; Feng, H.; Liu, Y.; Chen, Y.; Wei, Q.; Wang, J.; Liu, D.; Huang, H.; Su, Y.; Wang, D.; et al. Molecular evolution of porcine epidemic diarrhea virus and porcine deltacoronavirus strains in Central China. Res. Vet. Sci. 2018, 120, 63–69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nguyen Thi, T.H.; Chen, C.C.; Chung, W.B.; Chaung, H.C.; Huang, Y.L.; Cheng, L.T.; Ke, G.M. Antibody Evaluation and Mutations of Antigenic Epitopes in the Spike Protein of the Porcine Epidemic Diarrhea Virus from Pig Farms with Repeated Intentional Exposure (Feedback). Viruses 2022, 14, 551. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, J.; Tian, L.; Liu, Y.; Sun, Y.; Li, Z.; Cai, X.; Meng, Q.; Qiao, J. Molecular characterization and phylogenetic analysis of porcine epidemic diarrhea virus in Xinjiang, China, from 2020 to 2022. Arch. Virol. 2024, 169, 96. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, Y.W.; Dickerman, A.W.; Piñeyro, P.; Li, L.; Fang, L.; Kiehne, R.; Opriessnig, T.; Meng, X.J. Origin, evolution, and genotyping of emergent porcine epidemic diarrhea virus strains in the United States. mBio 2013, 4, e00737-13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tian, Y.; Yang, X.; Li, H.; Ma, B.; Guan, R.; Yang, J.; Chen, D.; Han, X.; Zhou, L.; Song, Z.; et al. Molecular characterization of porcine epidemic diarrhea virus associated with outbreaks in southwest China during 2014–2018. Transbound. Emerg. Dis. 2021, 68, 3482–3497. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, X.; Liu, Y.; Wang, Y.; Wang, T.; Li, N.; Hao, F.; Yao, L.; Guo, K. Isolation and characterization of porcine epidemic diarrhea virus with a novel continuous mutation in the S1(0) domain. Front. Microbiol. 2023, 14, 1203893. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lole, K.S.; Bollinger, R.C.; Paranjape, R.S.; Gadkari, D.; Kulkarni, S.S.; Novak, N.G.; Ingersoll, R.; Sheppard, H.W.; Ray, S.C. Full-length human immunodeficiency virus type 1 genomes from subtype C-infected seroconverters in India, with evidence of intersubtype recombination. J. Virol. 1999, 73, 152–160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, N.; Liu, Q.; Qiao, M.; Deng, X.; Chen, X.; Sun, M. Whole genome characterization of a novel porcine reproductive and respiratory syndrome virus 1 isolate: Genetic evidence for recombination between Amervac vaccine and circulating strains in mainland China. Infect. Genet. Evol. J. Mol. Epidemiol. Evol. Genet. Infect. Dis. 2017, 54, 308–313. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thavorasak, T.; Chulanetra, M.; Glab-Ampai, K.; Teeranitayatarn, K.; Songserm, T.; Yodsheewan, R.; Sae-Lim, N.; Lekcharoensuk, P.; Sookrung, N.; Chaicumpa, W. Novel Neutralizing Epitope of PEDV S1 Protein Identified by IgM Monoclonal Antibody. Viruses 2022, 14, 125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, W.; Wang, C.; Song, X.; Xu, H.; Zhao, S.; Gu, J.; Zou, Z.; Li, J.; Qian, J.; Zhang, X.; et al. Immunogenicity and protective efficacy of a trimeric full-length S protein subunit vaccine for porcine epidemic diarrhea virus. Vaccine 2024, 42, 828–839. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, X.; Zhou, Q.; Zhang, J.; Chen, T.; Deng, G.; Yue, H.; Tang, C.; Wu, X.; Yu, J.; Zhang, B. Immunogenicity and protective efficacy of recombinant adenovirus expressing a novel genotype G2b PEDV spike protein in protecting newborn piglets against PEDV. Microbiol. Spectr. 2024, 12, e0240323. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.; Zou, C.; Peng, O.; Ashraf, U.; Xu, Q.; Gong, L.; Fan, B.; Zhang, Y.; Xu, Z.; Xue, C.; et al. Global Dynamics of Porcine Enteric Coronavirus PEDV Epidemiology, Evolution, and Transmission. Mol. Biol. Evol. 2023, 40, msad052. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pensaert, M.B.; de Bouck, P. A new coronavirus-like particle associated with diarrhea in swine. Arch. Virol. 1978, 58, 243–247. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, X.; Huo, J.Y.; Chen, L.; Zheng, F.M.; Chang, H.T.; Zhao, J.; Wang, X.W.; Wang, C.Q. Genetic variation analysis of reemerging porcine epidemic diarrhea virus prevailing in central China from 2010 to 2011. Virus Genes 2013, 46, 337–344. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tian, Y.; Yu, Z.; Cheng, K.; Liu, Y.; Huang, J.; Xin, Y.; Li, Y.; Fan, S.; Wang, T.; Huang, G.; et al. Molecular characterization and phylogenetic analysis of new variants of the porcine epidemic diarrhea virus in Gansu, China in 2012. Viruses 2013, 5, 1991–2004. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wen, Z.; Li, J.; Zhang, Y.; Zhou, Q.; Gong, L.; Xue, C.; Cao, Y. Genetic epidemiology of porcine epidemic diarrhoea virus circulating in China in 2012–2017 based on spike gene. Transbound. Emerg. Dis. 2018, 65, 883–889. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, B.; Jiao, D.; Zhang, R.; Zhou, J.; Guo, R.; Yu, Z.; Shi, D.; Zhao, Y.; Gu, J.; Niu, B.; et al. Origin and epidemic status of porcine epidemic diarrhea virus variants in China. Transbound. Emerg. Dis. 2020, 67, 1364–1370. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martin, D.P.; Murrell, B.; Golden, M.; Khoosal, A.; Muhire, B. RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evol. 2015, 1, vev003. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martin, D.P.; Murrell, B.; Khoosal, A.; Muhire, B. Detecting and Analyzing Genetic Recombination Using RDP4. Methods Mol. Biol. 2017, 1525, 433–460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.J.; Huang, J.C.; Yang, C.P.; Hsu, K.F.; Liu, H.F. A Comprehensive Phylogenetic Analysis of SARS-CoV-2: Utilizing a Novel and Convenient In-House RT-PCR Method for Characterization without Virus Culture and BSL-3 Facilities. Viruses 2023, 15, 1562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Z.; Ma, Z.; Li, Y.; Gao, S.; Xiao, S. Porcine epidemic diarrhea virus: Molecular mechanisms of attenuation and vaccines. Microb. Pathog. 2020, 149, 104553. [Google Scholar] [CrossRef] [Scilit]
- Peng, Q.; Fan, B.; Song, X.; He, W.; Wang, C.; Zhao, Y.; Guo, W.; Zhang, X.; Liu, S.; Gao, J.; et al. Genetic signatures associated with the virulence of porcine epidemic diarrhea virus AH2012/12. J. Virol. 2023, 97, e0106323. [Google Scholar] [CrossRef] [Scilit]
- Wang, D.; Ge, X.; Chen, D.; Li, J.; Cai, Y.; Deng, J.; Zhou, L.; Guo, X.; Han, J.; Yang, H. The S Gene Is Necessary but Not Sufficient for the Virulence of Porcine Epidemic Diarrhea Virus Novel Variant Strain BJ2011C. J. Virol. 2018, 92, e00603-18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, P.; Zhao, X.; Zhou, S.; Zhou, T.; Tan, X.; Wu, X.; Tong, W.; Gao, F.; Yu, L.; Jiang, Y.; et al. A Virulent PEDV Strain FJzz1 with Genomic Mutations and Deletions at the High Passage Level Was Attenuated in Piglets via Serial Passage In Vitro. Virol. Sin. 2021, 36, 1052–1065. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burland, T.G. DNASTAR’s Lasergene sequence analysis software. Methods Mol. Biol. 2000, 132, 71–91. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Name | Sequence (5′-3′) | Product Length/bp |
|---|---|---|
| PEDV-SF | CATACAGTACTTGTACCGGGTGA | 384 |
| PEDV-SR | AGACTTGGACCATTTCTA | |
| PEDV-S1F | GAAGAATGGTAAGTTGCTAGTG | 1100 |
| PEDV-S1R | GAAGTACAATTGAGCCTTCAGC | |
| PEDV-S2F | GGCCATTCCTAAGATTTATGG | 1400 |
| PEDV-S2R | CACCTATGTTACTATACACC | |
| PEDV-S3F | GATGATGATATAGTGGGTG | 1200 |
| PEDV-S3R | CTGTACCAGAGAGAAAATG | |
| PEDV-S4F | ACTAAGTATACTGAGGTTC | 1000 |
| PEDV-S4R | TGGAACTACATTGAGCTC |
| Name of Strain | Access. No. | Location | Date | |
|---|---|---|---|---|
| 1 | SM98 | GU937797 | South Korea | 2010 |
| 2 | CHM2013 | KM887144 | China | 2013 |
| 3 | CV777 | AF353511 | Switzerland | 2001 |
| 4 | Virulent-DR13 | JQ023161 | South Korea | 2011 |
| 5 | Attenuated-DR13 | JQ023162 | South Korea | 2011 |
| 6 | SD-M | JX560761 | China | 2012 |
| 7 | Vaccine-CV777 | KT323979 | China | 2015 |
| 8 | AH-M | KJ158152 | China | 2011 |
| 9 | ZL29 | KU847996 | China | 2016 |
| 10 | GER/L00719/2014 | LM645058 | Germany | 2014 |
| 11 | USA/Iowa106/2013 | KJ645695 | USA | 2013 |
| 12 | MYZ-1/JPN/2013 | LC063846 | Japan | 2013 |
| 13 | CH/SCCZ/2018 | MH593148 | China | 2018 |
| 14 | CH/HNBR/01/2021 | MZ161067 | China | 2021 |
| 15 | K13JA12-1 | KJ539151 | South Korea | 2013 |
| 16 | IA2 | KF468754 | USA | 2014 |
| 17 | BJ-2011-1 | JN825712 | China | 2011 |
| 18 | AH2012 | KC210145 | China | 2012 |
| 19 | YN90 | KTO21231 | China | 2014 |
| 20 | AJ1102 | JX188454 | China | 2012 |
| 21 | GD-A | JX112709 | China | 2012 |
| 22 | CHSD2014 | KX791060 | China | 2014 |
| 23 | CHN-SC2021 | OM505025 | China | 2021 |
| 24 | CH/HNWMB/2021 | ON960077 | China | 2021 |
| 25 | CH/HNLH/2015 | KT199103 | China | 2015 |
| 26 | CH/HNAY/2015 | KR809885 | China | 2015 |
| 27 | JSnt2020 | OR808012 | China (Jiangsu) | 2020 |
| 28 | JSyc2021 | OR808013 | China (Jiangsu) | 2021 |
| 29 | JSxz2021 | OR808014 | China (Jiangsu) | 2021 |
| 30 | JSsq2021 | OR808015 | China (Jiangsu) | 2021 |
| 31 | AHbz2022 | OR808016 | China (Anhui) | 2022 |
| 32 | JSxz2023 | OR808017 | China (Jiangsu) | 2023 |
| 33 | AHfy2023 | OR808018 | China (Anhui) | 2023 |
| 34 | AHbz2023-1 | OR808019 | China (Anhui) | 2023 |
| 35 | AHbz2023-2 | OR808020 | China (Anhui) | 2023 |
| 36 | GDS21 | MH726371 | China (Anhui) | 2014 |
| 37 | GD22 | MH726368 | China (Jiangsu) | 2012 |
| 38 | GDS23 | MH107322 | China (Jiangsu) | 2012 |
| 39 | GDS25 | MH726365 | China (Jiangsu) | 2013 |
| 40 | GDS27 | MH726380 | China (Anhui) | 2014 |
| 41 | GDS31 | MH726394 | China (Jiangsu) | 2015 |
| 42 | JSS01 | KU646831 | China (Anhui) | 2012 |
| 43 | JSS12 | KY070587 | China (Jiangsu) | 2016 |
| 44 | FR0012014 | KR011756.1 | France | 2014 |
| 45 | NLGD0022014 | KR011122.1 | The Netherlands | 2014 |
| PEDV Strains (Subgroup) | Percentage of Nucleotide (Amino Acid) Identity (%) | |||||
|---|---|---|---|---|---|---|
| CV777 | Vaccine-CV777 | CH/HNBR/01/2021 | AH2012 | AJ1102 | CHN-SC2021 | |
| JSyc2021 | 94.0 | 93.7 | 95.7 | 98.1 | 97.7 | 98.5 |
| (G2c) | (93.3) | (92.7) | (95.1) | (97.9) | (98.2) | (98.1) |
| JSxz2021 | 93.9 | 93.6 | 95.8 | 98.1 | 97.3 | 98.5 |
| (G2c) | (93.6) | (93.0) | (95.7) | (98.4) | (98.1) | (98.6) |
| JSsq2021 | 94.1 | 93.8 | 96.5 | 98.3 | 97.5 | 98.9 |
| (G2c) | (93.6) | (92.9) | (95.7) | (98.3) | (98.1) | (98.6) |
| AHbz2022 | 94.1 | 93.8 | 96.3 | 98.2 | 97.4 | 98.8 |
| (G2c) | (93.8) | (93.0) | (95.7) | (98.1) | (98.0) | (98.3) |
| AHfy2023 | 94.0 | 93.8 | 96.1 | 98.3 | 97.4 | 98.7 |
| (G2c) | (93.2) | (92.6) | (95.4) | (98.1) | (97.8) | (98.2) |
| JSxz2023 | 94.1 | 93.7 | 96.4 | 98.3 | 97.4 | 98.7 |
| (G2c) | (93.7) | (92.9) | (95.9) | (98.4) | (98.2) | (98.7) |
| JSnt2020 | 94.9 | 94.9 | 99.3 | 95.9 | 95.1 | 96.3 |
| (G1c) | (94.9) | (94.4) | (99.1) | (95.6) | (95.4) | (95.7) |
| AHbz2023-1 | 95.0 | 95.2 | 99.0 | 96.2 | 95.2 | 96.5 |
| (G1c) | (95.0) | (94.5) | (98.9) | (95.8) | (95.3) | (95.9) |
| AHbz2023-2 | 94.7 | 94.9 | 98.7 | 96.1 | 95.1 | 96.3 |
| (G1c) | (94.6) | (94.1) | (98.4) | (95.4) | (94.9) | (95.5) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, L.; Li, D.; Yan, C.; Wu, C.; Han, F.; Bo, Z.; Shen, M.; Sun, Y.; Wang, L.; Zheng, H.; et al. Phylogenetic and Genetic Variation Analysis of Porcine Epidemic Diarrhea Virus in East Central China during 2020–2023. Animals 2024, 14, 2185. https://doi.org/10.3390/ani14152185
Sun L, Li D, Yan C, Wu C, Han F, Bo Z, Shen M, Sun Y, Wang L, Zheng H, et al. Phylogenetic and Genetic Variation Analysis of Porcine Epidemic Diarrhea Virus in East Central China during 2020–2023. Animals. 2024; 14(15):2185. https://doi.org/10.3390/ani14152185
Chicago/Turabian StyleSun, Liumei, Duo Li, Caijie Yan, Chengyue Wu, Feng Han, Zongyi Bo, Manman Shen, Yiwei Sun, Liyan Wang, Haoqin Zheng, and et al. 2024. "Phylogenetic and Genetic Variation Analysis of Porcine Epidemic Diarrhea Virus in East Central China during 2020–2023" Animals 14, no. 15: 2185. https://doi.org/10.3390/ani14152185
APA StyleSun, L., Li, D., Yan, C., Wu, C., Han, F., Bo, Z., Shen, M., Sun, Y., Wang, L., Zheng, H., Wang, M., & Zhang, Z. (2024). Phylogenetic and Genetic Variation Analysis of Porcine Epidemic Diarrhea Virus in East Central China during 2020–2023. Animals, 14(15), 2185. https://doi.org/10.3390/ani14152185

