A Potential Role of the Translation Elongation Factor eef1a1 in Gonadal High-Temperature Perception in Chinese Tongue Sole (Cynoglossus semilaevis)
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Fish Culture, High-Temperature Induction, and Sampling
2.3. RNA/DNA Extraction and Sex Determination
2.4. First-Strand cDNA Synthesis and RACR-PCR
2.5. Sequence Analysis and Phylogeny of eef1a1
2.6. Analysis of mRNA Expression Using Quantitative RT-PCR (qRT-PCR)
2.7. Promoter Cloning and Plasmid Construction
2.8. Cell Transfection, Heat Treatment, and Luciferase Assay
2.9. Data Presentation and Statistical Analysis
3. Results
3.1. Identification of eef1a1 from C. semilaevis Gonad
3.2. Putative Amino Acid Sequence Comparison and Phylogenetic Analysis
3.3. Spatial Distribution of eef1a1 in Adult C. semilaevis
3.4. Temporal Expression of eef1a1 during Development of Gonad
3.5. Expression Pattern of C. semilaevis eef1a1 under High-Temperature Induction
3.6. eef1a1 Can Response to High Temperature Rapidly
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Marshall Graves, J.A. Weird animal genomes and the evolution of vertebrate sex and sex chromosomes. Annu. Rev. Genet. 2008, 42, 565–586. [Google Scholar] [CrossRef] [PubMed]
- Budd, A.M.; Banh, Q.Q.; Domingos, J.A.; Jerry, D.R. Sex control in fish: Approaches, challenges and opportunities for aquaculture. J. Mar. Sci. Eng. 2015, 3, 329–355. [Google Scholar] [CrossRef] [Green Version]
- Matsumoto, Y.; Crews, D. Molecular mechanisms of temperature-dependent sex determination in the context of ecological developmental biology. Mol. Cell. Endocrinol. 2012, 354, 103–110. [Google Scholar] [CrossRef] [PubMed]
- Sarre, S.D.; Ezaz, T.; Georges, A. Transitions between sex-determining systems in reptiles and amphibians. Annu. Rev. Genom. Hum. Genet. 2011, 12, 391–406. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Holleley, C.E.; O’Meally, D.; Sarre, S.D.; Marshall Graves, J.A.; Ezaz, T.; Matsubara, K.; Azad, B.; Zhang, X.; Georges, A. Sex reversal triggers the rapid transition from genetic to temperature-dependent sex. Nature 2015, 523, 79. [Google Scholar] [CrossRef]
- Shen, Z.G.; Eissa, N.; Yao, H.; Xie, Z.G.; Wang, H.P. Effects of temperature on the expression of two ovarian differentiation-related genes foxl2 and cyp19a1a. Front. Physiol. 2018, 9, 1208. [Google Scholar] [CrossRef]
- Hattori, R.S.; Gould, R.J.; Fujioka, T.; Saito, T.; Kurita, J.; Strussmann, C.A.; Yokota, M.; Watanabe, S. Temperature-dependent sex determination in Hd-rR medaka Oryzias latipes: Gender sensitivity, thermal threshold, critical period, and DMRT1 expression profile. Sex. Dev. 2007, 1, 138–146. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Guan, G.; Li, M.; Zhu, F.; Liu, Q.; Naruse, K.; Herpin, A.; Nagahama, Y.; Li, J.; Hong, Y. Autosomal gsdf acts as a male sex initiator in the fish medaka. Sci. Rep. 2016, 6, 19738. [Google Scholar] [CrossRef] [Green Version]
- Kitano, T.; Hayashi, Y.; Shiraishi, E.; Kamei, Y. Estrogen rescues masculinization of genetically female medaka by exposure to cortisol or high temperature. Mol. Reprod. Dev. 2012, 79, 719–726. [Google Scholar] [CrossRef] [PubMed]
- Mateyak, M.K.; Kinzy, T.G. eEF1A: Thinking outside the ribosome. J. Biol. Chem. 2010, 285, 21209–21213. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Newbery, H.J.; Loh, D.H.; O’Donoghue, J.E.; Tomlinson, V.A.L.; Chau, Y.Y.; Boyd, J.A.; Bergmann, J.H.; Brownstein, D.; Abbott, C.M. Translation elongation factor eEF1A2 is essential for post-weaning survival in mice. J. Biol. Chem. 2007, 282, 28951–28959. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Soares, D.C.; Barlow, P.N.; Newbery, H.J.; Porteous, D.J.; Abbott, C.M. Structural models of human eEF1A1 and eEF1A2 reveal two distinct surface clusters of sequence variation and potential differences in phosphorylation. PLoS ONE 2009, 4, e6315. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vera, M.; Pani, B.; Griffiths, L.A.; Muchardt, C.; Abbott, C.M.; Singer, R.H.; Nudler, E. The translation elongation factor eEF1A1 couples transcription to translation during heat shock response. eLife 2014, 3, e03164. [Google Scholar] [CrossRef] [PubMed]
- Chang, J.S.; Seok, H.; Kwon, T.K.; Min, D.S.; Ahn, B.H.; Lee, Y.H.; Suh, J.W.; Kim, J.W.; Iwashita, S.; Omori, A.; et al. Interaction of elongation factor-1 alpha and pleckstrin homology domain of phospholipase C-gamma 1 with activating its activity. J. Biol. Chem. 2002, 277, 19697–19702. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Breton, T.S.; Berlinsky, D.L. Characterizing ovarian gene expression during oocyte growth in Atlantic cod (Gadus morhua). Comp. Biochem. Physiol. D Genom. Proteom. 2014, 9, 1–10. [Google Scholar] [CrossRef]
- Zhang, X.; Chang, Y.; Zhai, W.; Qian, F.; Zhang, Y.; Xu, S.; Guo, H.; Wang, S.; Hu, R.; Zhong, X.; et al. A potential role for the Gsdf-eEF1alpha complex in inhibiting germ cell proliferation: A protein-interaction analysis in medaka (Oryzias latipes) from a proteomics perspective. Mol. Cell Proteom. 2021, 20, 100023. [Google Scholar] [CrossRef]
- Shao, C.; Li, Q.; Chen, S.; Zhang, P.; Lian, J.; Hu, Q.; Sun, B.; Jin, L.; Liu, S.; Wang, Z.; et al. Epigenetic modification and inheritance in sexual reversal of fish. Genome Res. 2014, 24, 604–615. [Google Scholar] [CrossRef] [Green Version]
- Chen, S.; Zhang, G.; Shao, C.; Huang, Q.; Liu, G.; Zhang, P.; Song, W.; An, N.; Chalopin, D.; Volff, J.N.; et al. Whole-genome sequence of a flatfish provides insights into ZW sex chromosome evolution and adaptation to a benthic lifestyle. Nat. Genet. 2014, 46, 253–260. [Google Scholar] [CrossRef]
- Liu, Y.; Chen, S.L.; Gao, F.T.; Meng, L.; Qiao-Mu, H.U.; Song, W.T.; Shao, C.W.; Wei-Qun, L.V. SCAR-transformation of sex-specific SSR marker and its application in half-smooth tongue sole (Cynoglossus semiliaevis). J. Agric. Biotechnol. 2014, 65, S22. [Google Scholar]
- Infante, C.; Asensio, E.; Canavate, J.P.; Manchado, M. Molecular characterization and expression analysis of five different elongation factor 1 alpha genes in the flatfish Senegalese sole (Solea senegalensis Kaup): Differential gene expression and thyroid hormones dependence during metamorphosis. BMC Mol. Biol. 2008, 9, 19. [Google Scholar] [CrossRef] [Green Version]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Khalyfa, A.; Bourbeau, D.; Chen, E.; Petroulakis, E.; Pan, J.; Xu, S.Y.; Wang, E. Characterization of elongation factor-1A (eEF1A-1) and eEF1A-2/S1 protein expression in normal and wasted mice. J. Biol. Chem. 2001, 276, 22915–22922. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kahns, S.; Lund, A.; Kristensen, P.; Knudsen, C.R.; Clark, B.F.; Cavallius, J.; Merrick, W.C. The elongation factor 1 A-2 isoform from rabbit: Cloning of the cDNA and characterization of the protein. Nucleic Acids Res. 1998, 26, 1884–1890. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.F.; Liu, Q.; Liu, K.Q.; Wang, H.Y.; Li, C.H.; Wang, Q.; Shao, C.W. Identification of global alternative splicing and sex-specific splicing via comparative transcriptome analysis of gonads of Chinese tongue sole (Cynoglossus semilaevis). Zool. Res. 2022, 43, 319–330. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Xu, W.; Zhang, N.; Shao, C.; Zhu, Y.; Dong, Z.; Wang, N.; Jia, X.; Xu, H.; Chen, S. Two Figla homologues have disparate functions during sex differentiation in half-smooth tongue sole (Cynoglossus semilaevis). Sci. Rep. 2016, 6, 28219. [Google Scholar] [CrossRef] [Green Version]
- Wang, Q.; Liu, K.; Feng, B.; Zhang, Z.; Wang, R.; Tang, L.; Li, W.; Li, Q.; Piferrer, F.; Shao, C. Transcriptome of gonads from high temperature induced sex reversal during sex determination and differentiation in Chinese tongue sole, Cynoglossus semilaevis. Front. Genet. 2019, 10, 1128. [Google Scholar] [CrossRef] [Green Version]
Primer Name | Sequences (5′–3′) | Purpose |
---|---|---|
eef1a1-cds-F | ATGGGAAAGGAAAAGATCCACATCA | Partial fragment amplification |
eef1a1-cds-R | TCATTTCTTCTTTGAGGCCTTCTCT | |
eef1a1-5′GSP | AAGTGACCGGTGGAGGTGGACTTGC | 5′RACE |
eef1a1-5′NGSP | TTTTGGTTTACGGTGTCTGAGGT | |
eef1a1-3′GSP | TTGTCAAGTCTGGAGACGCCGCCAT | 3′RACE |
eef1a1-3′NGSP | CTGTGGCCGTCGGCGTCATCAA | |
eef1a1-P-F | ggggtaccTCACAGCACAGT | Promoter amplification 1 |
eef1a1-P-R | cccaagcttTTTGGTTTACTGAATAAAAAGAAAAGAA | |
eef1a1-qF | ACTTCAATGCCCAGGTCATC | qRT-PCR |
eef1a1-qR | AACTTGCAGGCAATGTGAGC | |
β-actin-qF | GCTGTGCTGTCCCTGTA | qRT-PCR |
β-actin-qR | GAGTAGCCACGCTCTGTC | |
sex-F | CCTAAATGATGGATGTAGATTCTGTC | Genetic sex identification |
sex-R | GATCCAGAGAAAATAAACCCAGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Q.; Liu, Q.; Ma, W.; Wang, R.; Li, S.; Dong, Z.; Shao, C. A Potential Role of the Translation Elongation Factor eef1a1 in Gonadal High-Temperature Perception in Chinese Tongue Sole (Cynoglossus semilaevis). Animals 2022, 12, 1603. https://doi.org/10.3390/ani12131603
Wang Q, Liu Q, Ma W, Wang R, Li S, Dong Z, Shao C. A Potential Role of the Translation Elongation Factor eef1a1 in Gonadal High-Temperature Perception in Chinese Tongue Sole (Cynoglossus semilaevis). Animals. 2022; 12(13):1603. https://doi.org/10.3390/ani12131603
Chicago/Turabian StyleWang, Qian, Qian Liu, Wenxiu Ma, Rui Wang, Shuo Li, Zhongdian Dong, and Changwei Shao. 2022. "A Potential Role of the Translation Elongation Factor eef1a1 in Gonadal High-Temperature Perception in Chinese Tongue Sole (Cynoglossus semilaevis)" Animals 12, no. 13: 1603. https://doi.org/10.3390/ani12131603