Effects of Obesity on Adiponectin System Skin Expression in Dogs: A Comparative Study
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Recruitment of the Animals
2.2. Complete Blood Count (CBC), Serum Biochemistry and Adiponectin Assay
2.3. Sample Collection: Skin Biopsies
2.4. Immunohistochemistry
2.5. RNA Extraction and Real-Time PCR
2.6. Statistical Analysis
3. Results
3.1. Animal Body Weight and Body Condition Score
3.2. Serum Biochemical Profile
3.3. Histology and Immunohistochemistry
3.4. ADIPOQ, ADIPOR1, and ADIPOR2 Gene Expression by Real-Time PCR
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Courcier, E.; Thomson, R.M.; Mellor, D.J.; Yam, P.S. An epidemiological study of environmental factors associated with canine obesity. J. Small Anim. Pr. 2010, 51, 362–367. [Google Scholar] [CrossRef]
- Laflamme, D.P. Challenges with weight-reduction studies. Compend. Contin. Educ. Pract. Vet. 2001, 23, 45–50. [Google Scholar]
- Holmes, K.L.; Morris, P.J.; Abdulla, Z.; Hackett, R.; Rawlings, J.M. Risk factors associated with excess body weight in dogs in the UK. J. Anim. Physiol. Anim. Nutr. 2007, 91, 166–167. [Google Scholar] [CrossRef]
- Raffan, E. The big problem: Battling companion animal obesity. Vet. Rec. 2013, 173, 287–291. [Google Scholar] [CrossRef]
- Raffan, E.; Dennis, R.J.; O’Donovan, C.J.; Becker, J.M.; Scott, R.A.; Smith, S.; Withers, D.J.; Wood, C.J.; Conci, E.; Clements, D.; et al. A Deletion in the Canine POMC Gene Is Associated with Weight and Appetite in Obesity-Prone Labrador Retriever Dogs. Cell Metab. 2016, 23, 893–900. [Google Scholar] [CrossRef] [PubMed]
- Chandler, M.; Cunningham, S.; Lund, E.; Khanna, C.; Naramore, R.; Patel, A.; Day, M. Obesity and Associated Comorbidities in People and Companion Animals: A One Health Perspective. J. Comp. Pathol. 2017, 156, 296–309. [Google Scholar] [CrossRef]
- Kealy, R.D.; Lawler, D.F.; Ballam, J.M.; Mantz, S.L.; Biery, D.N.; Greeley, E.H.; Lust, G.; Segre, M.; Smith, G.; Stowe, H.D. Effects of diet restriction on life span and age-related changes in dogs. J. Am. Vet. Med. Assoc. 2002, 220, 1315–1320. [Google Scholar] [CrossRef] [PubMed]
- Akazawa, Y.; Sayo, T.; Sugiyama, Y.; Sato, T.; Akimoto, N.; Ito, A.; Inoue, S. Adiponectin resides in mouse skin and upregulates hyaluronan synthesis in dermal fibroblasts. Connect. Tissue Res. 2010, 52, 322–328. [Google Scholar] [CrossRef] [PubMed]
- Mercati, F.; Maranesi, M.; Dall’Aglio, C.; Petrucci, L.; Pasquariello, R.; Tardella, F.M.; De Felice, E.; Scocco, P. Apelin System in Mammary Gland of Sheep Reared in Semi-Natural Pastures of the Central Apennines. Animals 2018, 8, 223. [Google Scholar] [CrossRef] [PubMed]
- Brément, T.; Cossec, C.; Roux, C.; Knol, A.; Dréno, B.; Khammari, A.; Bourdeau, P.; Bruet, V. Expression of Three Adipokines (Adiponectin, Leptin and Resistin) in Normal Canine Skin: A Pilot Study. J. Comp. Pathol. 2019, 167, 82–90. [Google Scholar] [CrossRef]
- Dall’Aglio, C.; Scocco, P.; Maranesi, M.; Petrucci, L.; Acuti, G.; De Felice, E.; Mercati, F. Immunohistochemical identification of resistin in the uterus of ewes subjected to different diets: Preliminary results. Eur. J. Histochem. 2019, 63, 3020. [Google Scholar] [CrossRef]
- Mercati, F.; Dall’Aglio, C.; Timperi, L.; Scocco, P.; De Felice, E.; Maranesi, M. Epithelial expression of the hormone leptin by bovine skin. Eur. J. Histochem. 2019, 63, 2993. [Google Scholar] [CrossRef]
- Mercati, F.; Scocco, P.; Maranesi, M.; Acuti, G.; Petrucci, L.; Cocci, P.; Renzi, A.; De Felice, E.; Dall’Aglio, C. Apelin system detection in the reproductive apparatus of ewes grazing on semi-natural pasture. Theriogenology 2019, 139, 156–166. [Google Scholar] [CrossRef] [PubMed]
- Maranesi, M.; Di Loria, A.; Dall’Aglio, C.; Piantedosi, D.; Lepri, E.; Ciaramella, P.; Mercati, F. Leptin System in Obese Dog Skin: A Pilot Study. Animals 2020, 10, 2338. [Google Scholar] [CrossRef] [PubMed]
- Arita, Y.; Kihara, S.; Ouchi, N.; Takahashi, M.; Maeda, K.; Miyagawa, J.; Hotta, K.; Shimomura, I.; Nakamura, T.; Miyaoka, K.; et al. Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity. Biochem. Biophys. Res. Commun. 1999, 257, 79–83. [Google Scholar] [CrossRef]
- Hu, E.; Liang, P.; Spiegelman, B.M. AdipoQ Is a Novel Adipose-specific Gene Dysregulated in Obesity. J. Biol. Chem. 1996, 271, 10697–10703. [Google Scholar] [CrossRef] [PubMed]
- Scherer, P.E.; Williams, S.; Fogliano, M.; Baldini, G.; Lodish, H.F. A Novel Serum Protein Similar to C1q, Produced Exclusively in Adipocytes. J. Biol. Chem. 1995, 270, 26746–26749. [Google Scholar] [CrossRef]
- Lihn, A.S.; Pedersen, S.B.; Richelsen, B. Adiponectin: Action, regulation and association to insulin sensitivity. Obes. Rev. 2005, 6, 13–21. [Google Scholar] [CrossRef] [PubMed]
- Ohashi, K.; Shibata, R.; Murohara, T.; Ouchi, N. Role of anti-inflammatory adipokines in obesity-related diseases. Trends Endocrinol. Metab. 2014, 25, 348–355. [Google Scholar] [CrossRef] [PubMed]
- Ohashi, K.; Parker, J.L.; Ouchi, N.; Higuchi, A.; Vita, J.; Gokce, N.; Pedersen, A.A.; Kalthoff, C.; Tullin, S.; Sams, A.; et al. Adiponectin Promotes Macrophage Polarization toward an Anti-inflammatory Phenotype. J. Biol. Chem. 2010, 285, 6153–6160. [Google Scholar] [CrossRef] [PubMed]
- Yamauchi, T.; Kamon, J.; Ito, Y.; Tsuchida, A.; Yokomizo, T.; Kita, S.; Sugiyama, T.; Miyagishi, M.; Hara, K.; Tsunoda, M.; et al. Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature 2003, 423, 762–769. [Google Scholar] [CrossRef] [PubMed]
- Shibata, S.; Tada, Y.; Asano, Y.; Hau, C.S.; Kato, T.; Saeki, H.; Yamauchi, T.; Kubota, N.; Kadowaki, T.; Sato, S. Adiponectin Regulates Cutaneous Wound Healing by Promoting Keratinocyte Proliferation and Migration via the ERK Signaling Pathway. J. Immunol. 2012, 189, 3231–3241. [Google Scholar] [CrossRef] [PubMed]
- Jung, Y.R.; Lee, J.H.; Sohn, K.C.; Lee, Y.; Seo, Y.J.; Kim, C.D.; Lee, J.H.; Hong, S.P.; Seo, S.J.; Kim, S.J.; et al. Adiponectin Signaling Regulates Lipid Production in Human Sebocytes. PLoS ONE 2017, 12, e0169824. [Google Scholar] [CrossRef]
- Won, C.H.; Yoo, H.G.; Park, K.Y.; Shin, S.H.; Park, W.S.; Park, P.J.; Chung, J.H.; Kwon, O.S.; Kim, K.H. Hair Growth–Promoting Effects of Adiponectin In Vitro. J. Investig. Dermatol. 2012, 132, 2849–2851. [Google Scholar] [CrossRef] [PubMed]
- Nakamura, N.; Naruse, K.; Matsuki, T.; Hamada, Y.; Nakashima, E.; Kamiya, H.; Matsubara, T.; Enomoto, A.; Takahashi, M.; Oiso, Y.; et al. Adiponectin promotes migration activities of endothelial progenitor cells via Cdc42/Rac1. FEBS Lett. 2009, 583, 2457–2463. [Google Scholar] [CrossRef]
- Takahashi, H.; Tsuji, H.; Hashimoto, Y.; Ishida-Yamamoto, A.; Iizuka, H.; Takahashi, I. Plasma adiponectin and leptin levels in Japanese patients with psoriasis. Br. J. Dermatol. 2008, 159, 1207–1208. [Google Scholar] [CrossRef]
- Karadag, A.S.; Ertugrul, D.T.; Takcı, Z.; Bilgili, S.G.; Namuslu, M.; Ata, N.; Şekeroǧlu, R. The Effect of Isotretinoin on Retinol-Binding Protein 4, Leptin, Adiponectin and Insulin Resistance in Acne Vulgaris Patients. Dermatology 2015, 230, 70–74. [Google Scholar] [CrossRef]
- Çerman, A.A.; Aktaş, E.; Altunay, I.K.; Arıcı, J.E.; Tulunay, A.; Ozturk, F.Y. Dietary glycemic factors, insulin resistance, and adiponectin levels in acne vulgaris. J. Am. Acad. Dermatol. 2016, 75, 155–162. [Google Scholar] [CrossRef] [PubMed]
- Ezure, T.; Amano, S. Adiponectin and leptin up-regulate extracellular matrix production by dermal fibroblasts. BioFactors 2007, 31, 229–236. [Google Scholar] [CrossRef]
- Yamane, T.; Kobayashi-Hattori, K.; Oishi, Y. Adiponectin promotes hyaluronan synthesis along with increases in hyaluronan synthase 2 transcripts through an AMP-activated protein kinase/peroxisome proliferator-activated receptor-α-dependent pathway in human dermal fibroblasts. Biochem. Biophys. Res. Commun. 2011, 415, 235–238. [Google Scholar] [CrossRef] [PubMed]
- Laflamme, D.P. Development and validation of a body condition score system for dogs. Canine Pract. 1997, 22, 10–15. [Google Scholar]
- Porcellato, I.; Menchetti, L.; Brachelente, C.; Sforna, M.; Reginato, A.; Lepri, E.; Mechelli, L. Feline Injection-Site Sarcoma. Vet. Pathol. 2016, 54, 204–211. [Google Scholar] [CrossRef]
- Dall’Aglio, C.; Mercati, F.; De Felice, E.; Tardella, F.M.; Kamphues, J.; Cappai, M.G.; Scocco, P. Influence of Different Feed Physical Forms on Mandibular Gland in Growing Pigs. Animals 2020, 10, 910. [Google Scholar] [CrossRef]
- Tsukada, T.; Fushida, S.; Harada, S.; Terai, S.; Yagi, Y.; Kinoshita, J.; Oyama, K.; Tajima, H.; Fujita, H.; Ninomiya, I.; et al. Adiponectin receptor-1 expression is associated with good prognosis in gastric cancer. J. Exp. Clin. Cancer Res. 2011, 30, 107. [Google Scholar] [CrossRef]
- Lord, E.; LeDoux, S.; Murphy, B.D.; Beaudry, D.; Palin, M.F. Expression of adiponectin and its receptors in swine. J. Anim. Sci. 2005, 83, 565–578. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Guelfi, G.; Zerani, M.; Brecchia, G.; Parillo, F.; Dall’Aglio, C.; Maranesi, M.; Boiti, C. Direct actions of ACTH on ovarian function of pseudopregnant rabbits. Mol. Cell. Endocrinol. 2011, 339, 63–71. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Kaneko, J.J.; Harvey, J.W.; Bruss, M.L. Textbook of Clinical Biochemistry of Domestic Animals, 6th ed.; Elsevier: St. Louis, MO, USA, 2008; pp. 889–895. [Google Scholar]
- Mercati, F.; Maranesi, M.; Dall’Aglio, C.; Scocco, P.; Pascucci, L.; Boiti, C.; Ceccarelli, P. Leptin receptor is expressed by epidermis and skin appendages in dog. Acta Histochem. 2014, 116, 1270–1275. [Google Scholar] [CrossRef] [PubMed]
- Maury, E.; Brichard, S. Adipokine dysregulation, adipose tissue inflammation and metabolic syndrome. Mol. Cell. Endocrinol. 2010, 314, 1–16. [Google Scholar] [CrossRef]
- Yamka, R.M.; Friesen, K.G.; Frantz, N.Z. Identification of canine markers related to obesity and the effects of weight loss onthe markers of interest. Int. J. Appl. Res. Vet. M 2006, 4, 282–292. [Google Scholar]
- Tribuddharatana, T.; Kongpiromchean, Y.; Sribhen, K.; Sribhen, C. Biochemical alterations and their relationships with the metabolic syndrome components in canine obesity. Kasetsart J. 2011, 45, 622–628. [Google Scholar]
- Center, S.A. Interpretation of liver enzymes. Vet. Clin. N. Am. Small Anim. Pract. 2007, 37, 297–333. [Google Scholar] [CrossRef]
- Clifton, P.M.; Keogh, J. Metabolic effects of high-protein diets. Curr. Atheroscler. Rep. 2007, 9, 472–478. [Google Scholar] [CrossRef]
- Park, H.-J.; Lee, S.-E.; Oh, J.-H.; Seo, K.-W.; Song, K.-H. Leptin, adiponectin and serotonin levels in lean and obese dogs. BMC Vet. Res. 2014, 10, 113. [Google Scholar] [CrossRef]
- Piantedosi, D.; Di Loria, A.; Guccione, J.; De Rosa, A.; Fabbri, S.; Cortese, L.; Carta, S.; Ciaramella, P. Serum biochemistry profile, inflammatory cytokines, adipokines and cardiovascular findings in obese dogs. Vet. J. 2016, 216, 72–78. [Google Scholar] [CrossRef]
- Booth, A.; Magnuson, A.; Fouts, J.; Foster, M. Adipose tissue, obesity and adipokines: Role in cancer promotion. Horm. Mol. Biol. Clin. Investig. 2015, 21, 57–74. [Google Scholar] [CrossRef] [PubMed]
- Reneau, J.; Goldblatt, M.; Gould, J.; Kindel, T.; Kastenmeier, A.; Higgins, R.; Rengel, L.R.; Schoyer, K.; James, R.; Obi, B.; et al. Effect of adiposity on tissue-specific adiponectin secretion. PLoS ONE 2018, 13, e0198889. [Google Scholar] [CrossRef] [PubMed]
- Ouchi, N.; Kobayashi, H.; Kihara, S.; Kumada, M.; Sato, K.; Inoue, T.; Funahashi, T.; Walsh, K. Adiponectin Stimulates Angiogenesis by Promoting Cross-talk between AMP-activated Protein Kinase and Akt Signaling in Endothelial Cells. J. Biol. Chem. 2004, 279, 1304–1309. [Google Scholar] [CrossRef] [PubMed]
- Oshima, H.; Rochat, A.; Kedzia, C.; Kobayashi, K.; Barrandon, Y. Morphogenesis and Renewal of Hair Follicles from Adult Multipotent Stem Cells. Cell 2001, 104, 233–245. [Google Scholar] [CrossRef]
- Pascucci, L.; Mercati, F.; Gargiulo, A.M.; Pedini, V.; Sorbolini, S.; Ceccarelli, P. CD34 glycoprotein identifies putative stem cells located in the isthmic region of canine hair follicles. Vet. Dermatol. 2006, 17, 244–251. [Google Scholar] [CrossRef] [PubMed]
- Mercati, F.; Pascucci, L.; Gargiulo, A.M.; Dall’Aglio, C.; Ceccarelli, P. Immunoistochemical evaluation of intermediate filament nestin in dog hair follicles. Histol. Histopathol. 2008, 23, 1035–1041. [Google Scholar] [CrossRef]
- Akiyama, M.; Dale, B.A.; Sun, T.-T.; Holbrook, K.A. Characterization of Hair Follicle Bulge in Human Fetal Skin: The Human Fetal Bulge Is a Pool of Undifferentiated Keratinocytes. J. Investig. Dermatol. 1995, 105, 844–850. [Google Scholar] [CrossRef] [PubMed]
- Scott, D.W.; Muller, W.H.; Griffin, C.E. Muller and Kirk’s Small Animal Dermatology, 6th ed.; Saunders: Philadelphia, PA, USA, 2000. [Google Scholar]
- Samuelson, D.A. Textbook of Veterinary Histology; Saunders-Elsevier: St. Louis, MO, USA, 2007. [Google Scholar]
- Mercati, F.; Dall’Aglio, C.; Pascucci, L.; Boiti, C.; Ceccarelli, P. Identification of cannabinoid type 1 receptor in dog hair follicles. Acta Histochem. 2012, 114, 68–71. [Google Scholar] [CrossRef] [PubMed]
- Salathia, N.S.; Shi, J.; Zhang, J.; Glynne, R.J. An In Vivo Screen of Secreted Proteins Identifies Adiponectin as a Regulator of Murine Cutaneous Wound Healing. J. Investig. Dermatol. 2013, 133, 812–821. [Google Scholar] [CrossRef] [PubMed]
- Luo, Y.; Liu, M. Adiponectin: A versatile player of innate immunity. J. Mol. Cell Biol. 2016, 8, 120–128. [Google Scholar] [CrossRef] [PubMed]
- Firooz, A.; Gorouhi, F.; Davari, P.; Atarod, M.; Hekmat, S.; Solhpour, A.; Rashighi-Firoozabadi, M. Comparison of hydration, sebum and pH values in clinically normal skin of patients with atopic dermatitis and healthy controls. Clin. Exp. Dermatol. 2007, 32, 321–322. [Google Scholar] [CrossRef] [PubMed]
- Jeong, K.-Y.; Lee, J.; Li, C.; Han, T.; Lee, S.-B.; Lee, H.; Back, S.K.; Na, H.S. Juvenile Obesity Aggravates Disease Severity in a Rat Model of Atopic Dermatitis. Allergy Asthma Immunol. Res. 2015, 7, 69–75. [Google Scholar] [CrossRef]
- Bjursell, M.; Ahnmark, A.; Bohlooly-Y, M.; William-Olsson, L.; Rhedin, M.; Peng, X.-R.; Ploj, K.; Gerdin, A.-K.; Arnerup, G.; Elmgren, A.; et al. Opposing Effects of Adiponectin Receptors 1 and 2 on Energy Metabolism. Diabetes 2007, 56, 583–593. [Google Scholar] [CrossRef]
- Blüher, M.; Fasshauer, M.; Kralisch, S.; Schön, M.R.; Krohn, K.; Paschke, R. Regulation of adiponectin receptor R1 and R2 gene expression in adipocytes of C57BL/6 mice. Biochem. Biophys. Res. Commun. 2005, 329, 1127–1132. [Google Scholar] [CrossRef]
- Morínigo, R.; Musri, M.; Vidal, J.; Casamitjana, R.; Delgado, S.; Lacy, A.M.; Ayuso, C.; Gomis, R.; Corominola, H. Intra-abdominal Fat Adiponectin Receptors Expression and Cardiovascular Metabolic Risk Factors in Obesity and Diabetes. Obes. Surg. 2006, 16, 745–751. [Google Scholar] [CrossRef]
- Blüher, M.; Williams, C.J.; Klöting, N.; Hsi, A.; Ruschke, K.; Oberbach, A.; Fasshauer, M.; Berndt, J.; Schön, M.R.; Wolk, A.; et al. Gene Expression of Adiponectin Receptors in Human Visceral and Subcutaneous Adipose Tissue Is Related to Insulin Resistance and Metabolic Parameters and Is Altered in Response to Physical Training. Diabetes Care 2007, 30, 3110–3115. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Kirkpatrick, C.S.; White, E.; Lee, J. Case–control study of malignant melanoma in Washington State II. Diet, alcohol, and obesity. Am. J. Epidemiol. 1994, 139, 869–880. [Google Scholar] [CrossRef] [PubMed]
- Shipman, A.R.; Millington, G.W.M. Obesity and the skin. Br. J. Dermatol. 2011, 165, 743–750. [Google Scholar] [CrossRef] [PubMed]



| Gene | NCBI Seq. Ref. | Primers | bp | |
|---|---|---|---|---|
| ADIPOQ | NM_001003070.1 | F | TTCATCTGGAAGTGGGCGAC | 107 |
| R | AAGGAAGCCCGTAAAGGTGG | |||
| ADIPOR1 | XM_843263.5 | F | GCAGACAAGAGCAGGAGTGT | 130 |
| R | AGCCATGAGGAAGAACCAGC | |||
| ADIPOR2 | NM_001024634.1 | F | GGTCTCCCGGCTCTTCTCTA | 145 |
| R | AATGCCCAGCACACAGATGA | |||
| ACTB [14] | NM_001195845.2 | F | CTTCCAGCCTTCCTTCCTGG | 141 |
| R | CCAGGGTACATGGTGGTTCC |
| Parameter | Unit | Reference Ranges | Normal Weight Group | Obese Group | p |
|---|---|---|---|---|---|
| Glucose | mg/dL | 65–118 | 77.3 ± 10.14 | 82.6 ± 8.41 | 0.110 |
| Urea | mg/dL | 21–59 | 37.7 ± 7.56 | 41.5 ± 11.15 | 0.192 |
| Creatinine | mg/dL | 0.5–1.5 | 1.3 ± 0.14 | 1.4 ± 0.2 | 0.067 |
| T-Chol | mg/dL | 135–270 | 154.5 ± 30 | 151.2 ± 34.84 | 0.411 |
| TG | mg/dL | 20–112 | 38.9 ± 4.79 | 48.4 ± 15.99 | 0.052 |
| ALT | UI/L | 21–102 | 37.2 ± 10.72 | 39.3 ± 24.34 | 0.403 |
| GGT | UI/L | 1.2–6.4 | 3 ± 1.05 | 5.1 ± 2.85 | 0.025 * |
| ALP | UI/L | 20–156 | 66.7 ± 35.1 | 70.6 ± 49.15 | 0.420 |
| T-Bil | mg/dL | 0.1–0.5 | 0.1 ± 0.02 | 0.3 ± 0.19 | 0.016 * |
| TP | g/dL | 5.4–7.1 | 6.8 ± 0.42 | 7.1 ± 0.62 | 0.144 |
| Alb | g/dL | 2.6–3.3 | 3.4 ± 0.40 | 3.5 ± 0.27 | 0.163 |
| α1-glob | g/dL | 0.2–0.5 | 0.2 ± 0.02 | 0.2 ± 0.05 | 0.004 ** |
| α2-glob | g/dL | 0.3–1.1 | 0.9 ± 0.15 | 1.0 ± 0.13 | 0.087 |
| β1-glob | g/dL | 0.7–1.3 | 0.9 ± 0.35 | 0.8 ± 0.23 | 0.135 |
| β2-glob | g/dL | 0.6–1.4 | 0.8 ± 0.23 | 0.8 ± 0.15 | 0.323 |
| γ-glob | g/dL | 0.5–1.3 | 0.6 ± 0.14 | 0.7 ± 0.25 | 0.054 |
| ADIPOQ | pg/mL | - | 607.15 ± 220.2 | 183.05 ± 83.2 | 0.000 ** |
| Group | Nw | Ob | p * Nw vs. Ob | |
|---|---|---|---|---|
| ADIPOQ | Mean | 1.13 | 0.21 | 0.005 |
| SD | 0.45 | 0.08 | ||
| ADIPOR1 | Mean | 4.83 | 42.16 | 0.068 |
| SD | 3.71 | 31.40 | ||
| ADIPOR2 | Mean | 1.04 | 0.46 | 0.03 |
| SD | 0.22 | 0.26 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dall’Aglio, C.; Maranesi, M.; Di Loria, A.; Piantedosi, D.; Ciaramella, P.; Alterisio, M.C.; Lepri, E.; Mercati, F. Effects of Obesity on Adiponectin System Skin Expression in Dogs: A Comparative Study. Animals 2021, 11, 2308. https://doi.org/10.3390/ani11082308
Dall’Aglio C, Maranesi M, Di Loria A, Piantedosi D, Ciaramella P, Alterisio MC, Lepri E, Mercati F. Effects of Obesity on Adiponectin System Skin Expression in Dogs: A Comparative Study. Animals. 2021; 11(8):2308. https://doi.org/10.3390/ani11082308
Chicago/Turabian StyleDall’Aglio, Cecilia, Margherita Maranesi, Antonio Di Loria, Diego Piantedosi, Paolo Ciaramella, Maria Chiara Alterisio, Elvio Lepri, and Francesca Mercati. 2021. "Effects of Obesity on Adiponectin System Skin Expression in Dogs: A Comparative Study" Animals 11, no. 8: 2308. https://doi.org/10.3390/ani11082308
APA StyleDall’Aglio, C., Maranesi, M., Di Loria, A., Piantedosi, D., Ciaramella, P., Alterisio, M. C., Lepri, E., & Mercati, F. (2021). Effects of Obesity on Adiponectin System Skin Expression in Dogs: A Comparative Study. Animals, 11(8), 2308. https://doi.org/10.3390/ani11082308

