Microbial Contamination and Antibiotic Resistance in Fresh Produce and Agro-Ecosystems in South Asia—A Systematic Review
Abstract
1. Introduction
2. Materials and Methods
2.1. Information Sources
2.2. Search Strategy
2.3. Study Selection Procedure
2.4. Synthesis
3. Results
3.1. Search and Study Selection
3.2. Study Characteristics
3.3. Sample Characteristics
3.3.1. Setting of Reported Samples
3.3.2. Category of Samples
3.4. Microbial Contamination
3.4.1. Microorganism Investigated
3.4.2. Microbial Contamination of Vegetable and Food Samples
3.4.3. Microbial Contamination of Agro-Ecosystem Samples
3.5. Antimicrobial Susceptibility Testing
3.5.1. Antimicrobial Susceptibility Pattern
3.5.2. Extended Spectrum Beta-Lactamase (ESBL)
3.5.3. Other Specific Resistance Bacteria
3.6. ARG in the Fresh Produce and Agro-Ecosystem
4. Discussion
4.1. Relevant Vegetables and Fruits Within Reviewed Studies
4.2. Relevant Bacteria of Fresh Produce Within the Reviewed Studies
4.3. Relevant Bacteria of Agro-Ecosystem Within the Reviewed Studies
Relevant Antibiotics, Resistance Levels, and Resistance Patterns Within the Reviewed Studies
5. Limitations
6. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Hutchings, M.; Truman, A.; Wilkinson, B. Antibiotics: Past, Present and Future. Curr. Opin. Microbiol. 2019, 51, 72–80. [Google Scholar] [CrossRef] [PubMed]
- Bennani, H.; Mateus, A.; Mays, N.; Eastmure, E.; Stärk, K.D.C.; Häsler, B. Overview of Evidence of Antimicrobial Use and Antimicrobial Resistance in the Food Chain. Antibiotics 2020, 9, 49. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S. Antimicrobial Resistance: A Top Ten Global Public Health Threat. eClinicalMedicine 2021, 41, 101221. [Google Scholar] [CrossRef]
- World Bank. Drug-Resistant Infections. A Threat to Our Economic Future; World Bank: Washington, DC, USA, 2017; Available online: https://www.worldbank.org/en/topic/health/publication/drug-resistant-infections-a-threat-to-our-economic-future (accessed on 8 November 2023).
- Murray, C.J.; Shunji Ikuta, K.; Sharara, F.; Swetschinski, L.; Robles Aguilar, G.; Gray, A.; Han, C.; Bisignano, C.; Rao, P.; Wool, E.; et al. Global Burden of Bacterial Antimicrobial Resistance in 2019: A Systematic Analysis. Lancet 2022, 399, 629–655. [Google Scholar] [CrossRef]
- Murray, C.J.L.; Afshin, A.; Alam, T.; Ashbaugh, C.; Barthelemy, C.; Biehl, M.; Brauer, M.; Compton, K.; Cromwell, E.; Dandona, L.; et al. Global Burden of 369 Diseases and Injuries in 204 Countries and Territories, 1990–2019: A Systematic Analysis for the Global Burden of Disease Study 2019. Lancet 2020, 396, 1204–1222. [Google Scholar] [CrossRef]
- Holmes, A.H.; Moore, L.S.P.; Sundsfjord, A.; Steinbakk, M.; Regmi, S.; Karkey, A.; Guerin, P.J.; Piddock, L.J.V. Understanding the Mechanisms and Drivers of Antimicrobial Resistance. Lancet 2016, 387, 176–187. [Google Scholar] [CrossRef]
- McEwen, S.A.; Collignon, P.J. Antimicrobial Resistance: A One Health Perspective. Microbiol. Spectr. 2018, 6, 521–547. [Google Scholar] [CrossRef]
- O’Neill, J. Tackling Drug-Resistant Infections Globally: Final Report and Recommendations the Review on Antimicrobial Resistance Chaired By Jim O’neill. 2016. Available online: https://amr-review.org/sites/default/files/160518_Final%20paper_with%20cover.pdf (accessed on 10 October 2024).
- Singer, A.C.; Shaw, H.; Rhodes, V.; Hart, A. Review of Antimicrobial Resistance in the Environment and Its Relevance to Environmental Regulators. Front. Microbiol. 2016, 7, 219380. [Google Scholar] [CrossRef]
- Van Boeckel, T.P.; Pires, J.; Silvester, R.; Zhao, C.; Song, J.; Criscuolo, N.G.; Gilbert, M.; Bonhoeffer, S.; Laxminarayan, R. Global Trends in Antimicrobial Resistance in Animals in Low- And Middle-Income Countries. Science 2019, 365, eaaw1944. [Google Scholar] [CrossRef]
- Booton, R.D.; Meeyai, A.; Alhusein, N.; Buller, H.; Feil, E.; Lambert, H.; Mongkolsuk, S.; Pitchforth, E.; Reyher, K.K.; Sakcamduang, W.; et al. One Health Drivers of Antibacterial Resistance: Quantifying the Relative Impacts of Human, Animal and Environmental Use and Transmission. One Health 2021, 12, 100220. [Google Scholar] [CrossRef]
- van Bunnik, B.A.D.; Woolhouse, M.E.J. Modelling the Impact of Curtailing Antibiotic Usage in Food Animals on Antibiotic Resistance in Humans. R. Soc. Open Sci. 2017, 4, 161067. [Google Scholar] [CrossRef]
- Chatterjee, A.; Modarai, M.; Naylor, N.R.; Boyd, S.E.; Atun, R.; Barlow, J.; Holmes, A.H.; Johnson, A.; Robotham, J.V. Quantifying Drivers of Antibiotic Resistance in Humans: A Systematic Review. Lancet Infect. Dis. 2018, 18, e368–e378. [Google Scholar] [CrossRef]
- FAO and WHO Joint FAO/WHO Expert Meeting in Collaboration with OIE on Foodborne Antimicrobial Resistance: Role of the Environment, Crops and Biocides: Meeting Report. Available online: https://www.who.int/publications/i/item/9789241516907 (accessed on 19 November 2023).
- Lima, T.; Domingues, S.; Silva, G.J. Da Manure as a Potential Hotspot for Antibiotic Resistance Dissemination by Horizontal Gene Transfer Events. Vet. Sci. 2020, 7, 110. [Google Scholar] [CrossRef]
- Richter, L.; du Plessis, E.M.; Duvenage, S.; Korsten, L. Occurrence, Phenotypic and Molecular Characterization of Extended-Spectrum- and AmpC- β-Lactamase Producing Enterobacteriaceae Isolated From Selected Commercial Spinach Supply Chains in South Africa. Front. Microbiol. 2020, 11, 487965. [Google Scholar] [CrossRef] [PubMed]
- Balali, G.I.; Yar, D.D.; Afua Dela, V.G.; Adjei-Kusi, P. Microbial Contamination, an Increasing Threat to the Consumption of Fresh Fruits and Vegetables in Today’s World. Int. J. Microbiol. 2020, 2020, 3029295. [Google Scholar] [CrossRef]
- FAO. FAOSTAT Analytical Brief 60 Agricultural Production Statistics Agricultural Production Statistics 2000–2021 FAOSTAT Analytical Brief 60 FAOSTAT Crops and Livestock Production Introduction. 2021. Available online: https://openknowledge.fao.org/server/api/core/bitstreams/58971ed8-c831-4ee6-ab0a-e47ea66a7e6a/content (accessed on 10 October 2024).
- Morita. Chapter 7—Past Growth in Agricultural Productivity in South Asia. In Current Directions in Water Scarcity Research; Elsevier: Amsterdam, The Netherlands, 2021; Volume 3, pp. 137–156. [Google Scholar] [CrossRef]
- Septembre-Malaterre, A.; Remize, F.; Poucheret, P. Fruits and Vegetables, as a Source of Nutritional Compounds and Phytochemicals: Changes in Bioactive Compounds during Lactic Fermentation. Food Res. Int. 2018, 104, 86–99. [Google Scholar] [CrossRef] [PubMed]
- Mir, S.A.; Shah, M.A.; Mir, M.M.; Dar, B.N.; Greiner, R.; Roohinejad, S. Microbiological Contamination of Ready-to-Eat Vegetable Salads in Developing Countries and Potential Solutions in the Supply Chain to Control Microbial Pathogens. Food Control 2018, 85, 235–244. [Google Scholar] [CrossRef]
- Collineau, L.; Boerlin, P.; Carson, C.A.; Chapman, B.; Fazil, A.; Hetman, B.; McEwen, S.A.; Jane Parmley, E.; Reid-Smith, R.J.; Taboada, E.N.; et al. Integrating Whole-Genome Sequencing Data into Quantitative Risk Assessment of Foodborne Antimicrobial Resistance: A Review of Opportunities and Challenges. Front. Microbiol. 2019, 10, 444886. [Google Scholar] [CrossRef]
- Chereau, F.; Opatowski, L.; Tourdjman, M.; Vong, S. Risk Assessment for Antibiotic Resistance in South East Asia. BMJ 2017, 358, 2–8. [Google Scholar] [CrossRef]
- Noor, A.U.Z.; Kabir, H.; Chowdhury, M.A.A.; Ather, M.F.; Hasan, M.K. An Emerging Route to Antibiotic Resistance in South Asia: A Correspondence. Ann. Med. Surg. 2023, 85, 335. [Google Scholar] [CrossRef]
- Brunn, A.; Kadri-Alabi, Z.; Moodley, A.; Guardabassi, L.; Taylor, P.; Mateus, A.; Waage, J. Characteristics and Global Occurrence of Human Pathogens Harboring Antimicrobial Resistance in Food Crops: A Scoping Review. Front. Sustain. Food Syst. 2022, 6, 824714. [Google Scholar] [CrossRef]
- Rethlefsen, M.L.; Kirtley, S.; Waffenschmidt, S.; Ayala, A.P.; Moher, D.; Page, M.J.; Koffel, J.B.; Blunt, H.; Brigham, T.; Chang, S.; et al. PRISMA-S: An Extension to the PRISMA Statement for Reporting Literature Searches in Systematic Reviews. Syst. Rev. 2021, 10, 39. [Google Scholar] [CrossRef] [PubMed]
- Aromataris, E.; Lockwood, C.; Porritt, K.; Pilla, B.; Jordan, Z. (Eds.) JBI Manual for Evidence Synthesis; JBI: Adelaide, Australia, 2024. [Google Scholar] [CrossRef]
- Chaturvedi, M.; Kumar, V.; Singh, D.; Kumar, S. Assessment of Microbial Load of Some Common Vegetables among Two Different Socioeconomic Groups. Int. Food Res. J. 2013, 20, 2927–2931. [Google Scholar]
- Rasheed, M.U.; Thajuddin, N.; Ahamed, P.; Teklemariam, Z.; Jamil, K. Antimicrobial Drug Resistance in Strains of Escherichia Isolated from Food Sources. Rev. Inst. Med. Trop. Sao Paulo 2014, 56, 341. [Google Scholar] [CrossRef]
- Soni, D.K.; Singh, M.; Singh, D.V.; Dubey, S.K. Virulence and Genotypic Characterization of Listeria Monocytogenes Isolated from Vegetable and Soil Samples. BMC Microbiol. 2014, 14, 241. [Google Scholar] [CrossRef]
- Mathur, A.; Joshi, A.; Harwani, D.; Ganga, M. Microbial Contamination of Raw Fruits and Vegetables. 2014. Available online: https://api.semanticscholar.org/CorpusID:8079441 (accessed on 27 November 2023).
- Kabir, A.; Das, A.K.; Kabir, M.S. Incidence of Antibiotic Resistant Pathogenic Bacteria in Vegetable Items Sold by Local and Super Shops in Dhaka City. Stamford J. Microbiol. 2015, 4, 13–18. [Google Scholar] [CrossRef]
- Chellapandi, K.; Ralte, L.; Malsawmtluangi, L.; Masih, L.; Kumar Singh, K.T.; Boro, D. Malaysian Journal of Microbiology Assessing Prevalence of Antibiotic Resistant Microbes on Fresh Marketed Vegetables of Aizawl City. Malays. J. Microbiol. 2015, 11, 40–46. [Google Scholar]
- Shah, M.S.; Eppinger, M.; Ahmed, S.; Shah, A.A.; Hameed, A.; Hasan, F. Multidrug-Resistant Diarrheagenic E. Coli Pathotypes Are Associated with Ready-to-Eat Salad and Vegetables in Pakistan. J. Korean Soc. Appl. Biol. Chem. 2015, 58, 267–273. [Google Scholar] [CrossRef]
- Kundu, S.K.; Islam, M.T. Prevalence of Pathogenic Bacteria Isolated from Two Selected Salad Vegetables and Antibiogram Profile of Klebsiella spp. Agriculturists 2016, 13, 9–17. [Google Scholar] [CrossRef]
- Nithya, A.; Babu, S. Prevalence of Plant Beneficial and Human Pathogenic Bacteria Isolated from Salad Vegetables in India. BMC Microbiol. 2017, 17, 64. Available online: https://bmcmicrobiol.biomedcentral.com/articles/10.1186/s12866-017-0974-x (accessed on 10 October 2024). [CrossRef]
- Mritunjay, S.K.; Kumar, V. A Study on Prevalence of Microbial Contamination on the Surface of Raw Salad Vegetables. 3 Biotech 2017, 7, 13. [Google Scholar] [CrossRef] [PubMed]
- Rabins, S.L.; Bhattacharya, A.; Ajay kumar, V.J.; Vijayan, C. PCR Based Detection and Biofilm Formation of Salmonella from Fresh Coriander Leaves (Coriandrum sativum). Asian J. Dairy. Food Res. 2018, 37, 144–148. [Google Scholar] [CrossRef]
- Kundu, A.; Wuertz, S.; Smith, W.A. Quantitative Microbial Risk Assessment to Estimate the Risk of Diarrheal Diseases from Fresh Produce Consumption in India. Food Microbiol. 2018, 75, 95–102. [Google Scholar] [CrossRef] [PubMed]
- Verma, P.; Saharan, V.V.; Nimesh, S.; Singh, A.P. Phenotypic and Virulence Traits of Escherichia Coli and Salmonella Strains Isolated from Vegetables and Fruits from India. J. Appl. Microbiol. 2018, 125, 270–281. [Google Scholar] [CrossRef]
- Ahmed, S.; Siddique, M.A.; Rahman, M.; Bari, M.L.; Ferdousi, S. A Study on the Prevalence of Heavy Metals, Pesticides, and Microbial Contaminants and Antibiotics Resistance Pathogens in Raw Salad Vegetables Sold in Dhaka, Bangladesh. Heliyon 2019, 5, e01205. [Google Scholar] [CrossRef]
- Abdus Sobur, M.; Al Momen Sabuj, A.; Sarker, R.; Taufiqur Rahman, A.M.M.; Lutful Kabir, S.M.; Tanvir Rahman, M. Antibiotic-Resistant Escherichia Coli and Salmonella Spp. Associated with Dairy Cattle and Farm Environment Having Public Health Significance. Vet. World 2019, 12, 984. [Google Scholar] [CrossRef]
- Sapkota, S.; Adhikari, S.; Khadka, S.; Adhikari, M.; Kandel, H.; Pathak, S.; Pandey, A.; Pandey, A. Multi-Drug Resistant Extended-Spectrum Beta-Lactamase Producing E. Coli and Salmonella on Raw Vegetable Salads Served at Hotels and Restaurants in Bharatpur, Nepal. BMC Res. Notes 2019, 12, 516. [Google Scholar] [CrossRef]
- Ghafur, A.; Shankar, C.; GnanaSoundari, P.; Venkatesan, M.; Mani, D.; Thirunarayanan, M.A.; Veeraraghavan, B. Detection of Chromosomal and Plasmid-Mediated Mechanisms of Colistin Resistance in Escherichia coli and Klebsiella pneumoniae from Indian Food Samples. J. Glob. Antimicrob. Resist. 2019, 16, 48–52. [Google Scholar] [CrossRef]
- Ali, B. Functional and Genetic Diversity of Bacteria Associated with the Surfaces of Agronomic Plants. Plants 2019, 8, 91. [Google Scholar] [CrossRef]
- Saksena, R.; Malik, M.; Gaind, R. Bacterial Contamination and Prevalence of Antimicrobial Resistance Phenotypes in Raw Fruits and Vegetables Sold in Delhi, India. J. Food Saf. 2020, 40, e12739. [Google Scholar] [CrossRef]
- Rathore, P.; Joy, S.S.; Yadav, R.; Ramakrishna, W. Co-Occurrence and Patterns of Phosphate Solubilizing, Salt and Metal Tolerant and Antibiotic-Resistant Bacteria in Diverse Soils. 3 Biotech 2021, 11, 356. [Google Scholar] [CrossRef] [PubMed]
- Shrivas, V.L.; Choudhary, A.K.; Hariprasad, P.; Sharma, S. Nutrient Concentrations Affect the Antimicrobial Resistance Profiles of Cattle Manures. Environ. Sci. Pollut. Res. 2021, 30, 25141–25147. [Google Scholar] [CrossRef] [PubMed]
- Priyanka; Meena, P.R.; Meghwanshi, K.K.; Rana, A.; Singh, A.P. Leafy Greens as a Potential Source of Multidrug-Resistant Diarrhoeagenic Escherichia Coli and Salmonella. Microbiology 2021, 167, 001059. [Google Scholar]
- Nepal, G.; Bhatta, S. Self-Medication with Antibiotics in WHO Southeast Asian Region: A Systematic Review. Cureus 2018, 10, e2428. [Google Scholar] [CrossRef]
- van Hoek, A.H.A.M.; Veenman, C.; van Overbeek, W.M.; Lynch, G.; de Roda Husman, A.M.; Blaak, H. Prevalence and Characterization of ESBL- and AmpC-Producing Enterobacteriaceae on Retail Vegetables. Int. J. Food Microbiol. 2015, 204, 1–8. [Google Scholar] [CrossRef]
Key search terms | Antimicrobial resistance-related terms (Combined by ‘OR’) (i) | Agriculture, agriculture products, and farm produce-related terms (Combined by ‘OR’) (ii) | Study site/country (Combined by ‘OR’) (iii) |
(“antibiotic*” OR “antimicrobial*” OR “antimicrobial resistan*” OR “antibiotic resistan*” OR “antibiotic resistant bacteria” OR “antibiotic resistant gene” OR “antimicrobial resistant organism” OR “antibiotic resistant pathogen”) | (“agriculture” OR “fresh produce” OR “vegetables” OR “salad” OR “fresh agriculture products” OR “raw vegetables” OR “salad vegetables” OR “fruits” OR “leafy green” OR “farming”) | (“india” OR “pakistan” OR “afghanistan” OR “bangladesh” OR “bhutan” OR “maldives” OR “nepal” OR “sri lanka” OR “south asia”) | |
Filters: from 2012 to 2022 |
Inclusion Criteria | Studies that detect and/or quantify bacteria, ARB, and/or ARGs on agriculture products (plant/plant products/vegetables/leafy green/fruits), and/or in agriculture production environments (soil/manure/water) |
Studies that detect and/or quantify bacteria, ARB, and/or ARGs in mixed or ready-to-eat salads | |
Studies conducted in South Asian countries | |
Full-text-peer-reviewed journal articles and grey literature | |
Language: English | |
Exclusion Criteria | Studies that did not include any fresh agriculture product |
Studies that include data on animal agriculture (e.g., dairy, meat, aquaculture, poultry) only | |
Studies that include data on animal-based foods (e.g., egg, milk, beef, pork, chicken, etc.) only | |
Studies that did not have data from the South Asian countries | |
All types of review articles |
Article No. | Authors | Publication Year | Country | Specific Localities | Frequency | Category of Locality | Category of Sample (Fresh Produce) | Category of Sample (Environment) | Studies Reported | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Market | Farm | Restaurant | Hotel | Household | Roadside Food Seller | Other | Root Vegetable | Leafy Vegetable | Vegetable | Herbs | Fruit | Legumes | Soil | Water | Manure | Microorganism Detected | Antibiotic-Resistance Tested | Antibiotic-Resistant Genes | ||||||
1 | Chaturvedi, M., Kumar, V., Singh, D., and Kumar [29] | 2013 | India | Shops | 8 | X | X | X | X | X | ||||||||||||||
2 | Rasheed, M. U., Thajuddin, N., Ahamed, P., Teklemariam, Z., and Jamil, K. [30] | 2014 | India | Localities | 12 | X | X | X | X | X | X | X | ||||||||||||
3 | Soni, D. K., Singh, M., Singh, D. V., and Dubey, S. K. [31] | 2014 | India | Agricultural Farm | N/A | X | X | X | X | X | X | X | X | |||||||||||
4 | Mathur, A., Joshi, A., Harwani, D., and Ganga, M. [32] | 2014 | India | Market | N/A | X | X | X | X | X | X | |||||||||||||
5 | Kabir, A., Das, A. K., and Kabir, M. S. [33] | 2015 | Bangladesh | Local market, Super market | 7 | X | X | X | X | X | X | X | ||||||||||||
6 | Chellapandi, K., Ralte, L., Malsawmtluangi, L., Masih, L., Kumar Singh, K. T., and Boro, D. [34] | 2015 | India | Vegetable market | 3 | X | X | X | X | X | X | |||||||||||||
7 | Shah, M. S., Eppinger, M., Ahmed, S., Shah, A. A., Hameed, A., and Hasan, F. [35] | 2015 | Pakistan | Local vegetable market and restaurant | N/A | X | X | X | X | X | X | X | ||||||||||||
8 | Kundu, S. K., and Islam, M. T. [36] | 2016 | Bangladesh | Local market | N/A | X | X | X | X | |||||||||||||||
9 | Nithya, A., and Babu, S. [37] | 2017 | India | Local market | N/A | X | X | X | X | |||||||||||||||
10 | Mritunjay, S. K., and Kumar, V. [38] | 2017 | India | Local market, retail market, local producer | N/A | X | X | X | X | X | X | X | ||||||||||||
11 | Rabins, S. L., Bhattacharya, A., Ajay kumar, V. J., and Vijayan, C. [39] | 2018 | India | Vegetable market | N/A | X | X | X | X | |||||||||||||||
12 | Kundu, A., Wuertz, S., and Smith, W. A. [40] | 2018 | India | Wholesale markets, foodmarts, roadside food seller | 3 5 1 | X | X | X | X | X | ||||||||||||||
13 | Verma, P., Saharan, V. V., Nimesh, S., and Singh, A. P. [41] | 2018 | India | Local market, agricultural fields | 70 40 | X | X | X | X | X | X | X | ||||||||||||
14 | Ahmed, S., Siddique, M. A., Rahman, M., Bari, M. L., and Ferdousi, S. [42] | 2019 | Bangladesh | Chain shops, wholesale market, retail market | 3 3 6 | X | X | X | X | X | X | |||||||||||||
15 | Abdus Sobur, M., Al Momen Sabuj, A., Sarker, R., Taufiqur Rahman, A. M. M., Lutful Kabir, S. M., and Tanvir Rahman, M. [43] | 2019 | Bangladesh | Dairy farm | 4 | X | X | X | X | X | X | X | X | X | ||||||||||
16 | Sapkota, S., Adhikari, S., Khadka, S., Adhikari, M., Kandel, H., Pathak, S., Pandey, A., and Pandey, A. [44] | 2019 | Nepal | Restaurant and hotel | N/A | X | X | X | X | X | X | |||||||||||||
17 | Ghafur, A., Shankar, C., GnanaSoundari, P., Venkatesan, M., Mani, D., Thirunarayanan, M. A., and Veeraraghavan, B. [45] | 2019 | India | Shops household | 14 8 | X | X | N/A | N/A | N/A | N/A | N/A | N/A | X | X | |||||||||
18 | Ali, B. [46] | 2019 | Pakistan | Vegetable shop, vegetable market, superstore | N/A | X | X | X | X | X | ||||||||||||||
19 | Saksena, R., Malik, M., and Gaind, R. [47] | 2020 | India | Retail vendor, wholesale market | N/A | X | X | X | X | X | X | |||||||||||||
20 | Rathore, P., Joy, S. S., Yadav, R., and Ramakrishna, W. [48] | 2021 | India | Agricultural field, non-agricultural field | 3 1 | X | X | X | X | |||||||||||||||
21 | Shrivas, V. L., Choudhary, A. K., Hariprasad, P., and Sharma, S. [49,50] | 2021 | India | Farming site, grazing site | 18 32 | X | X | X | ||||||||||||||||
22 | Priyanka, Meena, P. R., Meghwanshi, K. K., Rana, A., and Singh, A. P. [50] | 2021 | India | Retail shops, vendors, agricultural markets, supermarkets | 14 25 9 7 | X | X | X | X | X | X |
Article No. | Publication Year | Country | Category of Locality | Frequency | Category of Sample | Samples Reported | Frequency | Microorganism Tested |
---|---|---|---|---|---|---|---|---|
1 | 2013 | India | Market | 8 | Root vegetable | Potato | 4 | Total aerobic bacterial count |
Vegetable | Carrot | 4 | Yeast and mold count | |||||
Legumes | Radish | 4 | E. coli | |||||
Onion | 4 | Coliform count | ||||||
Garlic | 4 | |||||||
Ginger | 4 | |||||||
Cauliflower | 4 | |||||||
Cabbage | 4 | |||||||
Peas | 4 | |||||||
2 | 2014 | India | Other | 12 | Fruit | Cucumber | 30 | E. coli |
Root vegetable | Tomato | |||||||
Leafy vegetable | Beetroot | |||||||
Vegetable | Radish | |||||||
Carrot | ||||||||
Spinach | ||||||||
Cabbage | ||||||||
Lettuce | ||||||||
3 | 2014 | India | Farm | N/A | Fruit | Brinjal | 20 | Listeria monocytogenes |
Leafy vegetable | Chappan kaddu | 20 | ||||||
Vegetable | Chilli | 20 | ||||||
Legumes | Tomato | 20 | ||||||
Environment | Spinach | 20 | ||||||
Cauliflower | 20 | |||||||
Cabbage | 20 | |||||||
Broccoli | 20 | |||||||
Dolichos-Bean | 20 | |||||||
Cowpea | 20 | |||||||
Soil | 200 | |||||||
4 | 2014 | India | Market | N/A | Fruit | Mango | N/A | Bacillus |
Root vegetable | Lemon | Lactobacillus | ||||||
Leafy vegetable | Papaya | Caynebacterium | ||||||
Apple | Streptococcus | |||||||
Cucumber | Staphylococcus | |||||||
Chilli | Micrococcus | |||||||
Luffa | Pseudomonas | |||||||
Tomato | Enterobacteriaceae | |||||||
Potato | ||||||||
Onion | ||||||||
Spinach | ||||||||
5 | 2015 | Bangladesh | Market | 7 | Fruit | Tomato | 2 | Total heterotrophic bacteria |
Root vegetable | Carrot | 2 | Total coliform bacteria | |||||
Vegetable | Radish | 2 | Fecal coliform | |||||
Legumes | Turnip | 2 | Staphylococcus aureus | |||||
Cauliflower | 2 | Pseudomonas spp. | ||||||
Cabbage | 2 | Listeria spp. | ||||||
Bean | 2 | Salmonella and Shigella spp. | ||||||
Vibrio spp. | ||||||||
E. coli | ||||||||
6 | 2015 | India | Market | 3 | Fruit | Tomato | 27 | Total microbial load |
Root vegetable | Potato | E. coli | ||||||
Vegetable | Cabbage | Enterobacter spp. | ||||||
Klebsiella spp. | ||||||||
Proteus spp. | ||||||||
Citrobacter spp. | ||||||||
Serratia spp. | ||||||||
Staphylococcus spp. | ||||||||
7 | 2015 | Pakistan | Market Restaurant | N/A | Fruit | Cucumber | 200 | E. coli |
Root vegetable | Tomato | |||||||
Leafy vegetable | Carrot | |||||||
Vegetable | Spinach | |||||||
Lettuce | ||||||||
Ready-to-eat salad | 40 | |||||||
8 | 2016 | Bangladesh | Market | N/A | Fruit | Tomato | 7 | Total viable count |
Cucumber | 7 | Total coliform count | ||||||
Total staphylococcal count | ||||||||
Klebsiella spp. | ||||||||
Enterobacter spp. | ||||||||
Shigella spp. | ||||||||
Citrobacter spp. | ||||||||
E. coli | ||||||||
9 | 2017 | India | Market | N/A | Fruit | Cucumber | N/A | Density endophytic bacteria |
Root vegetable | Tomato | Total endophytic bacteria | ||||||
Carrot | Actinomycetes | |||||||
Onion | Pseudomonas spp. | |||||||
E. coli | ||||||||
Staphylococcus spp. | ||||||||
Salmonella spp. | ||||||||
10 | 2017 | India | Market | N/A | Fruit | Cucumber | 60 | Aerobic mesophilic count |
Root vegetable | Tomato | 60 | Psychotropic count | |||||
Leafy vegetable | Radish | 60 | Coliform count | |||||
Herbs | Carrot | 60 | Yeast and mold count | |||||
Beetroot | 60 | E. coli | ||||||
Cabbage | 60 | E. coli O157:H7 | ||||||
Spinach | 60 | Salmonella spp. | ||||||
Coriander | 60 | Listeria monocytogenes | ||||||
Exiguobacterium spp. | ||||||||
11 | 2018 | India | Market | N/A | Herbs | Coriander | 60 | Salmonella spp. |
12 | 2018 | India | Market Roadside food seller | 3 5 1 | Fruit | Cantaloupe | 17 | E. coli |
Herbs | Cucumber | 18 | Salmonella spp. | |||||
Pepper | 20 | Shiga toxin-producing E. coli | ||||||
English cucumber | 15 | Enterohemorrhagic E. coli | ||||||
Mint and Cilantro | 15 | Total Bacteroidales | ||||||
13 | 2018 | India | Market Farm | 70 40 | Fruit | Tomato | 80 | E. coli |
Root vegetable | Cantaloupe | 60 | Salmonella spp. | |||||
Leafy vegetable | Cucumber | 80 | ||||||
Carrot | 80 | |||||||
Radish | 80 | |||||||
Spinach | 140 | |||||||
14 | 2019 | Bangladesh | Market | 3 3 6 | Fruit | Tomato | 30 | Total aerobic count |
Vegetable | Cucumber | 30 | Total coliform count | |||||
Herbs | Lettuce | 30 | E. coli | |||||
Coriander | 30 | Salmonella | ||||||
Staphylococcus spp. | ||||||||
15 | 2019 | Bangladesh | Farm | 4 | Fruit | Tomato | 40 | Total viable count |
Leafy vegetable | Green chilli | Total E. coli count | ||||||
Environment | Malabar spinach | Total Salmonella count | ||||||
Red spinach | E. coli | |||||||
Salmonella spp. | ||||||||
Manure | 60 | Salmonella spp. | ||||||
Water | 20 | E. coli | ||||||
Salmonella spp. | ||||||||
Soil | 40 | E. coli | ||||||
Salmonella spp. | ||||||||
16 | 2019 | Nepal | Restaurant Hotel | N/A | Fruit | Cucumber | 72 | E. coli |
Root vegetable | Carrot | 72 | Salmonella spp. | |||||
(Ready-to-eat salad) | Radish | 72 | ||||||
17 | 2019 | India | Market Household | 14 8 | Vegetable | 63 | E. coli | |
Klebsiella spp. | ||||||||
Enterobacter | ||||||||
Citrobacter | ||||||||
18 | 2019 | Pakistan | Market | N/A | Root vegetable | Carrot | 12 | Staphylococcus spp. |
Vegetable | Turnip | 12 | Bacillus spp. | |||||
Cabbage | 12 | Citrobacter spp. | ||||||
Enterobacter spp. | ||||||||
Exiguobacterium spp. | ||||||||
Lysinibacillus fusiforms | ||||||||
Arthobacter nicotianae | ||||||||
Burkholderia cepacia | ||||||||
Acinetobacter spp. | ||||||||
Stenotrophomonas maltophilia | ||||||||
Serratia spp. | ||||||||
Pantoea dispersa | ||||||||
Khyvera cryecrescens | ||||||||
Klebsiella pneumoniae | ||||||||
Pseudomonas putida | ||||||||
19 | 2020 | India | Market | N/A | Fruit | Grapes | 1 | E. coli |
Root vegetable | Pear | 2 | Klebsiella spp. | |||||
Vegetable | Apple | 4 | Enterobacter spp. | |||||
Chilli pepper | 23 | Proteus spp. | ||||||
Tomato | 28 | Citrobacter spp. | ||||||
Cucumber | 28 | Providencia spp. | ||||||
Onion | 30 | Acinetobacter spp. | ||||||
Ginger | 14 | Pseudomonas spp. | ||||||
Carrot | 11 | |||||||
Garlic | 2 | |||||||
Radish | 2 | |||||||
Cabbage | 5 | |||||||
20 | 2021 | India | Farm | 3 1 | Environment | Soil | 4 | Total bacterial count |
Proteobacteria | ||||||||
Acidobacteria | ||||||||
Actinobacteria | ||||||||
Chloroflexi | ||||||||
21 | 2021 | India | Farm | 18 32 | Environment | Manure | 50 | |
22 | 2021 | India | Market | 14 25 9 7 | Leafy vegetable | Spinach | 220 | E. coli |
Vegetable | Fenugreek | 120 | Salmonella spp. | |||||
Cabbage | 90 | |||||||
Herbs | Peppermint | 170 | ||||||
Coriander | 230 |
Article No. | Country | Antibiotic-Resistant Genes Tested | E. coli | Salmonella spp. | Methodology | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Cow Dung | Soil | Water | Vegetable | Cow Dung | Soil | Water | Vegetable | Primer Sequence (5′-3′) | Approxband Size (bp) | Annealing Temp. (°C) | |||
15 | Bangladesh | ereA | 43.18% (19/44) | 36.36% (12/33) | 37.5% (3/8) | 30.77% (8/26) | 41.02% (16/39) | 34.61% (9/26) | 0.0% (0/5) | 26.67% (4/15) | F: GCCGGTGCTCATGAACTTGAG R: CGACTCTATTCGATCAGAGGC | 419 | 52 |
tetA | 88.89% (40/45) | 82.35% (28/34) | 75% (6/8) | 80.77% (21/26) | 84.61% (33/39) | 80.00% (20/25) | 80.00% (4/5) | 75.00% (12/16) | F: GGTTCACTCGAACGACGTCA R: CTGTCCGACAAGTTGCATGA | 577 | 57 | ||
tetB | 46.67% (21/45) | 38.23% (13/34) | 37.5% (3/8) | 38.46% (5/18) | 41.02% (16/39) | 36.00% (9/25) | 20.00% (1/5) | 31.25% (5/16) | F: CCTCAGCTTCTCAACGCGTG R: GCACCTTGCTGATGACTCTT | 634 | 56 | ||
SHV | 28.57% (10/35) | 26.92% (7/26) | 0% (0/6) | 27.78% (44/96) | 24.00% (6/25) | 25.00% (4/16) | 0.0% (0/2) | 16.7% (1/6) | F: TCGCCTGTGTATTATCTCCC R:CGCAGATAAATCACCACAATG | 768 | 52 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kalpana, P.; Yasobant, S.; Saxena, D.; Schreiber, C. Microbial Contamination and Antibiotic Resistance in Fresh Produce and Agro-Ecosystems in South Asia—A Systematic Review. Microorganisms 2024, 12, 2267. https://doi.org/10.3390/microorganisms12112267
Kalpana P, Yasobant S, Saxena D, Schreiber C. Microbial Contamination and Antibiotic Resistance in Fresh Produce and Agro-Ecosystems in South Asia—A Systematic Review. Microorganisms. 2024; 12(11):2267. https://doi.org/10.3390/microorganisms12112267
Chicago/Turabian StyleKalpana, Pachillu, Sandul Yasobant, Deepak Saxena, and Christiane Schreiber. 2024. "Microbial Contamination and Antibiotic Resistance in Fresh Produce and Agro-Ecosystems in South Asia—A Systematic Review" Microorganisms 12, no. 11: 2267. https://doi.org/10.3390/microorganisms12112267
APA StyleKalpana, P., Yasobant, S., Saxena, D., & Schreiber, C. (2024). Microbial Contamination and Antibiotic Resistance in Fresh Produce and Agro-Ecosystems in South Asia—A Systematic Review. Microorganisms, 12(11), 2267. https://doi.org/10.3390/microorganisms12112267