Next Article in Journal
Effects of Perennial Alfalfa on the Structure and Function of Soil Micro-Food Webs in the Loess Plateau
Next Article in Special Issue
Growth and Diversity of Spoiling and Foodborne Bacteria in Poultry Hamburgers in Modified Atmosphere and with Sulfites During Shelf Life
Previous Article in Journal
Development of a Novel Chimeric ND-GP cVLPs Vaccine for the Prevention of Goose-Derived Newcastle Disease and Gosling Plague
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Review

Microbial Contamination and Antibiotic Resistance in Fresh Produce and Agro-Ecosystems in South Asia—A Systematic Review

by
Pachillu Kalpana
1,2,
Sandul Yasobant
3,4,5,6,*,
Deepak Saxena
3,4,5,* and
Christiane Schreiber
7
1
Center for Development Research (ZEF), University of Bonn, 53113 Bonn, Germany
2
Department of Pharmacy, Faculty of Mathematics and Natural Sciences, University of Bonn, 53113 Bonn, Germany
3
School of Epidemiology & Public Health, Datta Meghe Institute of Higher Education and Research (DMIHER), Wardha 442107, Maharashtra, India
4
Department of Public Health Science, Indian Institute of Public Health Gandhinagar (IIPHG), Gandhinagar 382042, Gujarat, India
5
Centre for One Health Education, Research & Development (COHERD), Indian Institute of Public Health Gandhinagar (IIPHG), Gandhinagar 382042, Gujarat, India
6
Global Health, Institute for Hygiene and Public Health (IHPH), University Hospital Bonn, 53127 Bonn, Germany
7
GeoHealth Centre, Institute for Hygiene and Public Health (IHPH), University Hospital Bonn, 53127 Bonn, Germany
*
Authors to whom correspondence should be addressed.
Microorganisms 2024, 12(11), 2267; https://doi.org/10.3390/microorganisms12112267
Submission received: 6 September 2024 / Revised: 13 October 2024 / Accepted: 22 October 2024 / Published: 8 November 2024

Abstract

Fresh produce prone to microbial contamination is a potential reservoir for antimicrobial-resistant bacteria (ARB) and antimicrobial resistance genes (ARGs), posing challenges to food safety and public health. This systematic review aims to comprehensively assess the prevalence of bacterial pathogens and the incidence of ARB/ARGs in fresh produce and agro-ecosystems across South Asia. Twenty-two relevant studies published between 2012 and 2022 from three major scientific databases and the grey literature were identified. The results revealed a wide occurrence of microbial contamination in various types of fresh produce across South Asia, with a predominance of E. coli (16/22), Salmonella spp. (13/22), Staphylococcus spp. (5/22), and Klebsiella spp. (4/22). The agro-ecosystem serves as a complex interface for microbial interactions; studies have reported the prevalence of E. coli (1/4), Salmonella spp. (1/4) and Listeria monocytogenes (1/4) in farm environment samples. A concerning prevalence of ARB has been reported, with resistance to multiple classes of antibiotics. The presence of ARGs in fresh produce underscores the potential for gene transfer and the emergence of resistant pathogens. To conclude, our review provides insights into the requirements of enhanced surveillance, collaborative efforts, implementation of good agricultural practices, and public awareness for food safety and safeguarding public health in the region.

1. Introduction

The novel discovery of antibiotics in the 19th century transformed human health by saving millions of lives by treating diseases caused by bacterial infections [1]. The threat to this achievement came afterward with the increasing antimicrobial resistance (AMR), where microorganisms attain the ability to fight against previously effective antimicrobial drugs. This phenomenon of resistance in microorganisms leads to the extended persevere of infection in the body and triggers a higher risk of spreading to others [2]. AMR is now ranked among one of the top ten global health threats faced by humanity [3]. It is held to be responsible for nearly 1.27 million deaths worldwide in 2019, and this trend will increase globally if no remedial actions are taken [4]. It is estimated that global human mortality could reach up to 10 million people annually, with a cumulative loss in the global economy accounting for nearly USD 100 trillion by 2050 [4].
AMR varies geographically, but the expectation that more consumption of antibiotics in high-resource settings would lead to a corresponding higher burden of AMR-caused mortality was mistaken. On the contrary, the highest rates of deaths were reported in sub-Saharan Africa and South Asia [5]. Overall, 76.8 deaths in 100,000 of the human population have been experienced in South Asia. However, the high AMR burdens represent roles played by the prevalence of resistance and the underlying critical infections, which are reported higher in this region [6]. The other drivers that contribute to the observed higher burden in the South Asia region include inadequate health care systems, high accessibility to over-the-counter drugs, low biosecurity, unsafe food systems, and poor sanitation and hygiene, which also interpose to high and unregulated use of antibiotics [7].
The benefits of antibiotics do not restrict their usage only to human health care but also extend to the livestock and agriculture sectors [8]. The initial attempts to address this continually growing issue of AMR have prioritized human health care systems following livestock production [9]. The environmental sector, which could be contaminated with antimicrobial-resistant microbes and can generate reservoirs caused by discharges from wastewater treatment plants, for instance, has been less explored [10]. In the agricultural sector comprising food animal production and crop production areas, the focus has been paid to the former due to the high probability of transmission of zoonotic pathogens to humans through animal-sourced food. The majority (73%) of total antimicrobial consumption is reportedly used in animals raised for food, which is anticipated to rise even more with the projected growth in demand for animal proteins and with the necessity for strengthening livestock production systems in low–middle-income countries [11]. The usage of and demand for antibiotics established the reflection to focus on animal-sourced food in the food chain, but reductions in antimicrobial use in this particular agriculture sector may have a limited impact on tackling the issue of AMR infections [12,13].
In contrast, AMR transmission to humans through soil, water, and plants has been paid very minute consideration [14,15]. Crops cultivated in this broader setting for human consumption and animal feed enable the possibility of a direct link between the resistant microbes existing in the reservoir of agro-environment, humans, and animals [16]. In the food crop value chain, pre-harvest and post-harvest factors can contribute to contaminating fresh produce with antimicrobial-resistant bacteria (ARB). ARB harboring antimicrobial resistant genes (ARG) can be introduced to the crop environment through the application of animal waste as manure or crop fertilizer, by the use of contaminated irrigation water, or by residues from antimicrobial drugs used against crop pests [16]. Additionally, in pre-harvest conditions, cross-contamination of fresh produce by equipment or value chain actors can occur during harvest, and processing, washing, or handling in markets within the post-harvest period can play a role in ARB transmission [17].
In 2023, the Food and Agriculture Organization (FAO) and the World Health Organization (WHO) initiated promoting fruit and vegetable intake in healthy diets. Following the recommendation, the growing demand for fresh fruits and vegetables has increased and accounted for nearly 30% of global production in the last few years [18]. This increment has been gradual, with many worldwide variations in exports and imports [19]. However, the production of fruits and vegetables in Asian countries has almost doubled; hence, the exports are increasing faster than in other countries [20]. Fruits and vegetables are essential parts of providing nutrition, minerals, and vitamins to make a balanced diet and can prevent chronic diseases, including several micronutrient deficiencies, especially in developing countries [21]. Taking into consideration that vegetables undergo minimal or no processing in order to preserve the taste and their nutrient contents prior to ingestion by humans, fresh fruits and vegetables might serve as a vehicle for the transmission of human pathogens, ARB, and the related genes [22]. Until recently, risk analyses of foodborne AMR have focused almost exclusively on animal-based foods [23]. Moreover, AMR surveillance programs do not generally sample plant-based food, constraining baseline data for quantitative microbial risk assessments.
Most countries constituting the South Asia region are densely populated and share the issue of faster-growing AMR than any other region in the world [24]. The susceptibility to AMR contamination due to the close integration of people living near their livestock and agricultural areas creates a convenient setting for AMR spread [11]. The contamination of irrigation water resources by agricultural and industrial wastewater, lack of sanitation and hygiene measures, and the dependency on antimicrobials to compensate for poor animal husbandry practices associated with underdeveloped surveillance systems contribute more towards the faster-growing AMR in South Asia than in any other region in the world [25]. In addition, poor regulation in the supply chains of antimicrobials and fewer barriers to over-the-counter purchase of antimicrobials for the farmers, combined with limited access to agricultural extension services to acquire knowledge of agronomic techniques and skills to improve productivity, food security, and livelihoods, facilitate opportunities for misapplication of antimicrobials [26]. For these reasons, crop production systems in South Asia may be an underestimated source of dissemination of resistant bacteria to humans in those regions and potentially other parts of the world via international food supply chains.
In this review, we employed a systematic approach to explore the studies on microbial contamination and broad-spectrum patterns of AMR characterized in fresh produce for human consumption with a particular interest in South Asia. The objective of this review was to consolidate the current state of knowledge and data available and summarize the bacterial pathogens, antibiotic-resistant bacteria (ARB), and antibiotic-resistant genes (ARG) already detected and reported in fresh produce and the related agro-environment.

2. Materials and Methods

This study used a systematic review to categorize the studies conducted to answer a specific research question: which bacteria, antibiotic-resistant bacteria (ARB), and antibiotic-resistant genes (ARGs) are known to be widespread in the fresh produce and the agro-environment of the South Asia region? A protocol was developed according to the specified research question, including inclusion/exclusion criteria, search engines, and research sources. The selection and reporting of the relevant studies were performed using the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) selection method [27]. The review protocol has not been registered. No automation tool was used in any step of this review process.

2.1. Information Sources

The three most important electronic scientific bibliographic databases, PubMed, Web of Science, and Scopus, were searched systematically for published peer-reviewed literature. Additionally, the grey literature was searched online via Google Scholar and Google. To ensure a comprehensive evaluation of the relevant literature, the reference lists of articles found by search and included in PRISMA analyses were scanned for all relevant published studies.

2.2. Search Strategy

Relevant published scientific studies were searched using the following series of steps: Initially, a preliminary search was performed to identify and gather keywords from the published literature, Google Scholar, and Google for each concept on the topic of interest until November 2023. The specified keywords were then used for the advanced search in PubMed, and the foremost step was to search the keywords independently to hit upon the MeSH terms in the MeSH hierarchy tree. The key search terms were divided into three domains: (i) antimicrobial resistance; (ii) agriculture, agriculture products, and farm produce; and (iii) study site/country. Boolean logic (“AND” and “OR”) was applied to combine the MeSH terms together for the search of published literature. The search was framed between the years 2012 and 2022. The search terms used to explore all three scientific databases with the Boolean operators for this study are shown in Table 1.

2.3. Study Selection Procedure

According to the PRISMA guidelines, the four steps adhered to the selection process in this review were (i) identification, (ii) screening, (iii) eligibility, and (iv) inclusion. The studies found by the database search were exported to a Microsoft Excel spreadsheet, where the first step was to eliminate duplicate entries by considering the title, authors, and publication year. The shortlisted studies obtained after the elimination step were further reviewed by independently screening their titles and abstracts by two authors. A study was considered potentially relevant if it mentioned antimicrobial resistance in combination with agriculture, agriculture products, or farm products-related terms. The set of studies consolidated after this screening was then subjected to a full article review by two authors individually for further evaluation. In order to evaluate only original studies, articles published in the form of review articles, books, book chapters, conference abstracts/proceedings, or guidelines were not considered, thus preventing information from being duplicated in the results. Next, pre-specified criteria for inclusion and exclusion mentioned in Table 2 were applied to determine which studies were relevant and should be finally evaluated. Only studies that demonstrated an explicit and clear link to the objective of the study and the review concept and those meeting all the pre-defined inclusion criteria were eligible to be included in the final synthesis.

2.4. Synthesis

The studies that met the set of inclusion criteria developed for the review were used to extract the relevant data, which were administered and merged in a data extraction spreadsheet created on Microsoft Excel. The data collection formats developed by Joana Briggs Institute (JBI) suitable for systematic review were employed for the data extraction process [28]. The author’s name, year of publication, study settings/location, sample characteristics, and outcome measures were collected. The heterogeneous nature of the studies found in the form of study design, type of samples, different methods, and breakpoints used for the antimicrobial susceptibility led to performing a narrative synthesis to synthesize the findings of the studies. Afterward, the studies were further scanned, and the data were extracted on the following factors: type of samples investigated, number of samples screened, type of microorganism reported, number of isolates found, the method used for antimicrobial susceptibility testing, resistance reported against antibiotics, and the specific AMR genes if reported. The data were then grouped based on the critical results found through narrative analysis of all the studies included in this review.

3. Results

3.1. Search and Study Selection

The preliminary literature search throughout the electronic databases and the grey literature yielded after the duplication removal brought into 1401 studies. The titles and abstracts of all the studies were screened, and 1380 studies were eliminated in the first screening criteria due to the unrelated study concept. Finally, 26 studies, including five studies identified through hand search, were forwarded for full-text evaluation against the eligibility criteria, and 22 of them passed through eligibility assessment and were included in the final data synthesis. The complete study selection process followed for the review is picturized through the PRISMA flow chart in Figure 1.

3.2. Study Characteristics

A total of 22 published studies were included in the final review process, engaging a varied number of samples, ranging from fresh produce to environmental samples representing the agro-environment. The focus area of this study, which is the South Asia region, comprises eight countries. These eight countries include Bangladesh, Bhutan, India, Maldives, Nepal, Afghanistan, Pakistan, and Sri Lanka. However, the distribution of the published articles in these countries varies greatly, with a range of 15 in one and none in the other part of this region. The highest number of studies conducted in the region was in India (n = 15), followed by Bangladesh (n = 4), Pakistan (n = 2) and Nepal (n = 1). No studies were reported from the remaining four countries that are part of South Asia. The country wise studies included in the review are illustrated pictorially in Figure 2. Table 3 represents the basic characteristics of all the included articles.
The observational studies were included in this review to provide data from the natural environment. In the included studies, researchers surveyed samples from the agro-ecosystem for the presence of microbial contamination and, in limited, also explored the AMR pattern of the microorganisms and reported the prevalence of antibiotic-resistant strains from the agro-ecosystem. However, only one study included the investigation of ARGs on vegetables and environment samples.

3.3. Sample Characteristics

3.3.1. Setting of Reported Samples

Most studies collected and analyzed multiple sample types with a significant variance in the number of samples in the 22 included articles in this review. The majority of studies reported vegetables and fruits sampled from different categories of the market (72.7%, n = 16), which were stated as markets, local markets, retail markets, shops, wholesale markets, supermarkets, and food marts in the included studies. The studies reported from farms marked second in place (22.7%, n = 5) consisted of fresh produce along with related environment samples, as shown in Figure 3. The farms subset was considered for the studies that collected samples from agricultural fields, dairy farms, and grazing sites. The studies focused on ready-to-eat salads collected samples from hotels or restaurants (9.1%, n = 2). A study reported that samples were collected from roadside food stalls (4.5%, n = 1), which is very common in the geographical locations of the studies selected for this review. Interestingly, apart from the sites mentioned above, a study reported sample collection from households (4.5%, n = 1). On one side, from all these specific sample collection settings in the mentioned studies, one of the studies mentioned the sample collection from different localities (4.5%). The random sampling method was the most often reported method for sample collection in this final set of studies.

3.3.2. Category of Samples

A significant percentage of reported samples focused on vegetables consumed in raw form by humans. Some of the studies’ raw consumed vegetables were also reported as salad vegetables. The group of vegetables sampled differs between the studies in terms of both the number and the type of vegetables analyzed. The more detailed review process revealed that the 22 studies reported different kinds of vegetables categorized into six groups for analysis purposes. The six groups consisted of fruits (tomato, cucumber, pepper, brinjal, chili, luffa, apple, papaya, lemon, mango, cantaloupe, pear, grapes, and chappan kaddu), root vegetables (carrot, radish, turnip, beetroot, onion, garlic, ginger, and potato), leafy vegetable (lettuce, fenugreek, and spinach), vegetable (cabbage, cauliflower, and broccoli), herbs (coriander and mint) and legumes (peas, cowpea, bean). The distribution is detailed in the Supplementary Materials.
However, the most frequently observed sample among all the studies was tomato (n = 13), followed by cucumber (n = 11), carrot (n = 10), cabbage (n = 9), and spinach (n = 8). The two studies that reported ready-to-eat salads or vegetable salads had a precise categorization in the type of sample analyzed and were similarly considered and analyzed for our review [30,44]. A few studies reported fruit samples, including apples, papaya, lemon, pear, and grapes [32]. Four studies involving the environmental samples alongside vegetables included farm soil, manure fertilizer, and irrigation water [31,43,48,49]. The detailed information on the samples in all the included studies is listed in Supplementary Table S1.

3.4. Microbial Contamination

In Table 4, the studies that have reported the contamination of samples by any microorganisms are also reported. The studies followed different methodologies as per the aim of the respective study to isolate and identify the type of microorganism. The studies focusing on microbial contamination also looked for the total bacterial counts along with any specific pathogenic microorganisms. The analysis of the methodologies followed by the studies shows that most of the samples were analyzed by microbiological culturing methods (18/22) to report the contamination of specific microorganisms or the total bacterial contamination. Three studies reported the contamination of samples using molecular techniques [35,37,48]. One of the studies did not report the contamination of particular microorganisms but reported the antibiotic-resistant bacteria [49]. The detailed methodologies, including the media, incubation time, and temperature, are summarized in the Supplementary Table S1.

3.4.1. Microorganism Investigated

Contemplating the data obtained from the detailed study of the articles, the most frequently recorded species of interest were E. coli, Salmonella spp., Staphylococcus spp., and Klebsiella spp. The observations from these species comprised primary culture-positive sample records in vegetables and the soil, manure, and irrigation water samples. Other microorganisms reported in the study set included Bacillus cereus, Listeria spp., Pseudomonas spp. Enterobacter spp., Vibrio spp. Proteus spp., Citrobacter spp., Serratia spp., Shigella spp. Acinetobacter spp. across all sample groups. Many of the studies also deliberated on specific pathogens such as E. coliO157:H7 and Diarrheagenic E. coli Pathotypes (DEPs). Two of the studies also reported scarce data on the yeast and fungal contamination of the vegetables during the search for this review.

3.4.2. Microbial Contamination of Vegetable and Food Samples

All 22 articles investigated and successfully detected bacteria in the samples analyzed in the respective studies. The studies detected bacteria of more than 20 different genera in the group of vegetables and fruits, as represented in Table 4. Three of the studies detected the total number of bacterial counts for reporting the microbial load on the samples [29,34,38]. Five studies have reported the contamination as the number of bacterial isolates recovered in all the samples of the respective studies [32,34,36,44,47]. Among the prevalence of bacteria selected explicitly in most of the studies and also frequently observed bacteria were E. coli, found in 16 out of 22 included articles.
E. coli strains were mainly reported from cucumbers, tomatoes, carrots, cabbage, and leafy green vegetables. In one of the recent studies conducted in India, which reports among 830 samples including cabbage, fenugreek, coriander, spinach, and peppermint, 117 samples (14%) were contaminated with E. coli strains, and approximately 43% of them were identified as diarrheagenic E. coli pathotypes (DEPs). Staphylococcus spp. was reported in carrot, cucumber, onion, and tomato samples. In the studies that reported the contamination rate in all samples collected, the contamination range was found to be between 15% and 28.6%. Among the five articles that focused on and analyzed Klebsiella spp., the range of contamination was reported to be from 41% to 43%. The most common contaminated sample was reported to be tomato. The only study that reported the collection of vegetable samples at the household level in India also reported the presence of Klebsiella spp. Staphylococcus spp. and Klebsiella spp. were analyzed in six and five studies, respectively.
Some other microorganisms were also investigated and reported in the studies involving Enterobacter spp. (5/22), Pseudomonas spp. (4/22), Listeria spp. (3/22), Bacillus spp. (2/22), Exiguobacterium spp. (2/22), Acinetobacter spp. (3/22), and Vibrio spp. (1/22). The included studies also analyzed microbial contamination in different aggregated forms and reported as total viable counts, total heterotrophic count, total aerobic count, aerobic mesophilic count, psychotropic count, total Bacteroides, the total coliform counts, and total endophytic counts on the samples.

3.4.3. Microbial Contamination of Agro-Ecosystem Samples

A study conducted in Bangladesh tested farm environment samples comprising manure, irrigation water, and soil and reported the presence of E. coli and Salmonella spp. in all kinds of samples. The most contaminated sample reported in this study was soil, with more than 90% of samples contaminated with E. coli and 70% with Salmonella spp., followed by manure with 80% of E. coli and 70% with Salmonella spp. The irrigation water was the least contaminated, with 45% of the sample positive for E. coli and 30% for Salmonella spp. Another study that tested rhizospheric soil of the vegetable samples reported detection of Listeria monocytogenes in ten of the 200 samples collected in India. The other two studies that tested the soil and manure samples have not mainly focused on the detection of any specific bacteria. A study focused on soil samples using next-generation sequencing (NGS) technology to analyze the whole bacterial community present in the soil sample collected from different agricultural fields and concentrate on reporting the total bacterial count, Proteobacteria, Acidobacteria, Actinobacteria, and Chloroflexi.

3.5. Antimicrobial Susceptibility Testing

In 18 of the 22 studies, data on the antimicrobial resistance patterns of the isolated microorganisms were reported. Two primary methods have been reported in the studies for detecting the AMR patterns of the reported microorganisms. In 13 studies, the Kirby Bauer method of the disk diffusion test was employed, and in 2 other studies, the broth microdilution method was used for AMR detection by CLSI standards. In all the studies that followed the disk diffusion method, Muller–Hinton Agar was used, and the plates were incubated for 24 h at 37 °C after bacteria spread and antibiotic disc placement. In the other three studies, one study did not mention the method used to identify the AMR pattern. The other study calculated the percentage of ampicillin-resistant bacteria only by plating the diluted soil samples directly on an LB agar medium containing 100 µg/mL ampicillin. The study that profiled antibiotic resistance of manure used the serially diluted sample, followed by plating on a nutrient agar medium containing fluconazole as an antifungal (50 mg L−1) agent. The eight selected antibiotic discs were then placed on plates and incubated for 2 days at 30 °C.
Fifteen out of the eighteen studies followed the interpretive criteria and standards of Clinical and Laboratory Standards Institute (CLSI) guidelines for reporting the resistance profile of the isolated microorganisms. The details of the studies that reported AMR patterns of the microorganism tested, including the antibiotics tested and the resistance reported, are tabularized in Supplementary Table S1. The three other studies that were reported followed a slightly different approach, as mentioned above, for reporting AMR patterns, which included not the isolates but the direct samples that were tested in these studies.

3.5.1. Antimicrobial Susceptibility Pattern

A significant difference was observed in the number of antimicrobial drugs applied to analyze the resistance and susceptibility patterns of the same type of microorganisms. The number ranges from 5 to 23, found in different studies. Due to the number and type of tested antimicrobials, the resistance patterns of all the isolates were diverse among the studies. The details regarding the AMR susceptibility pattern reported in the included studies are summarized in Supplementary Table S1.

3.5.2. Extended Spectrum Beta-Lactamase (ESBL)

The three articles identified positive E. coli isolates and used a double-disc diffusion method to categorize them further as ESBL and non-ESBL producers. The highest percentage of ESBL producers (62%) was reported in the total number of Gram-negative isolates from vegetable salads. The 23 E. coli isolates identified from fruit, root vegetables, leafy vegetables, and vegetable samples reported only two isolates as ESBL producers. The ready-to-eat salads analyzed in one of the studies reported a total of nine ESBL producers, which included four E. coli and five Salmonella spp.

3.5.3. Other Specific Resistance Bacteria

One of the included studies focused on some particular resistance patterns among the E. coli isolated from the vegetable and fruit samples. This specific study reported 8 ESBL-producing isolates from the 141 Enterobacteriaceae isolates and further identified 22 Amp-C-β producers, 6 carbapenem resistance, and 6 metallo-β-lactamase-producers.

3.6. ARG in the Fresh Produce and Agro-Ecosystem

Although molecular methods were employed in some studies to identify the virulent genes and evaluate the related analysis, there was only one study found in our review of 22 papers that were engrossed in reporting the prevalence of ARGs in fresh produce and the agro-ecosystem samples collected in this particular study and the details are shown in Table 5. This study was conducted in Bangladesh and focused on tetracycline resistance genes, particularly tetA and tetB, the ESBL gene SHV, and the erythromycin-resistant gene ereA.

4. Discussion

The included studies in this review reported the microbial contamination of fresh produce in diverse South Asian settings. While 22 articles are included in this more detailed review, 16 studies explore the reporting of resistant strains of human pathogenic microbes isolated from fresh produce and/or environment samples. We employed a systematic approach to extract the data from the included studies about the significant microorganisms reported on the fresh produce and the related environment samples. In the case of characterizing AMR in focused samples, both the phenotypic and genotypic results are analyzed. However, a firm conclusion could not be made on the prevalence of the microorganism and the relative importance of different kinds of resistance and AMR patterns because of the substantial heterogeneity between study methods and conditions; nonetheless, some broad, indicative patterns emerge from our analysis.

4.1. Relevant Vegetables and Fruits Within Reviewed Studies

Among the 22 studies that were included in the more detailed review process, around six different groups of fresh produce, including root vegetables, leafy vegetables, vegetables, herbs, fruits, and legumes, were studied. Some studies included fruits or samples from ready-to-eat salads comprising most of the sample types mentioned in the group. Among all the fresh produce samples listed in the results, cucumber, tomato, and carrot were found to be the predominately sampled due to their high and routine consumption in raw form and also a significant contribution to salads [32,35,36,37,38,42,44]. Studies from the South Asia region considered sampling majorly from different levels within the distribution chain of fresh produce. However, the most significant sampling was conducted from markets, mainly local, retail, and supermarkets, and it was rarely reported from street vendors. Some of the studies also sampled from the farm environment, including soil, irrigation water, and manure [31,43,48,49]. The apparent reason behind the selection of the location considered for sampling is unclear. Still, it might be because the markets are easy to access and provide a wide variety of samples at the same place, which is the main point within the farm-to-fork supply chain where it reaches the consumers.

4.2. Relevant Bacteria of Fresh Produce Within the Reviewed Studies

Among the prevalence of bacteria reported explicitly in most of the studies, E. coli was found in the highest numbers in 16 out of 22 included articles. Therefore, E. coli acts as the most popular fecal indicator bacterium in scientific research on food contamination in the South Asian region. This is in line with WHO guidelines with surveillance strategies concerning food hygiene and also with scientific research in other parts of the world due to the species’ characteristics multiplying only within their specific ecological niche, which is the intestine of humans and animals, but not within the environment [15]. E. coli strains were mainly reported from cucumbers, tomatoes, carrots, cabbage, and leafy green vegetables. In one of the recent studies conducted in India, which reports among 830 samples of leafy vegetables, including cabbage, fenugreek, coriander, spinach, and peppermint, 117 samples (14%) were contaminated with E. coli strains, and approximately 43% of them were identified as diarrheagenic E. coli pathotypes (DEPs) [50]. The DEP strains were also reported in leafy and non-leafy vegetables, including cucumber, carrot, and salad samples analyzed in another study in Pakistan [33]. That underlines the function of E. coli not only as an indicator but as a relevant pathogen within the South Asian Region, especially India and Pakistan. Among all pathogens in fresh produce, E. coli was found to be the predominant one. This could be the result of its ubiquity in nature [43], which is also one of the reasons for the indicator suitability of the species. The methodical ease in detection and isolation of E. coli also primes this microorganism as one of the major selected and detected in studies.
The second-in-line of the most common bacteria tested was Salmonella spp. 13 out of 22 articles reported the analysis of Salmonella spp. on fresh produce. For example, a study from Bangladesh reported the presence of Salmonella spp. on the tested samples of lettuce, cucumber, tomato, and coriander leaf [42]. Another study in Bangladesh, where the samples were collected directly from the farm, reported a higher prevalence, with approximately 50% positive samples of all the vegetables [43]. In Nepal, Salmonella spp. was detected in ready-to-eat salads collected from hotels and restaurants [44]. Possible reasons for the high prevalence of Salmonella could include poor hygiene and improper handling at markets and restaurants [44]. The improper management of manure in the production environment of fresh produce may be the cause of transmission of E. coli and Salmonella spp. to vegetables [43]. Colonization and persistence on the plant surfaces with significantly increased virulence potential of both species are stated to aid the formation of reported specific phenotypic traits of biofilms along with the production of cellulose and curli-fimbriae [41].
The detection of Staphylococcus spp. and Klebsiella spp. was reported in five and four studies, respectively. Staphylococcus spp. were reported to have recovered from carrot, cucumber, onion, and tomato samples [30,32,33,37]. One of the two studies that reported contamination of fruits with Staphylococcus spp. were conducted in India, but the percentage of positive samples could not be calculated due to a lack of information about the total numbers investigated [32]. Among the four articles that detected the presence of Klebsiella spp., the most common contaminated sample was reported to be tomato. One of the studies that reported the collection of vegetable samples at the household level in India reported the presence of Klebsiella spp. [45].
Other microorganisms that were often investigated and detected on fresh produce and fruits were Listeria spp., Pseudomonas spp., Vibrio spp., Bacillus spp., and Enterobacter spp. All the mentioned bacteria genera are known to be human pathogens; however, some of them are conditionally pathogenic. A few of the articles also reported microbial contamination of the fresh produce in the form of total viable counts, total coliform counts, and total endophytic counts [33,36,37,42].
Fresh produce contaminated with all the bacterial pathogens creates a food safety issue that is associated with many different kinds of human infections. Therefore, surveillance programs, including plant-based food samples, are needed, and the reported foodborne pathogens should be included in the panel of already monitored bacterial pathogens.

4.3. Relevant Bacteria of Agro-Ecosystem Within the Reviewed Studies

The reviewed studies (n = 4) investigated farm environment samples comprising manure, irrigation water, and soil/rhizospheric soil. The reported presence of E. coli and Salmonella spp. in all kinds of environment samples with the highest contamination frequency of soil samples (90% positive for E. coli and 70% positive for Salmonella spp.) [43] underlined ubiquitous fecal contamination. E. coli is one of the most prevalent facultative anaerobic bacteria in the gastrointestinal tract of humans and animals. The general practice of applying cow dung as manure in many of the agricultural practices followed in the South Asia region could be the reason for the highest prevalence of the reported species in soil samples. The finding that manure was also frequent, but irrigation water was least contaminated [43] underlined the different importance of transmission routes.
The abundance of Listeria monocytogenes detection in the rhizospheric soil of vegetable samples (10/200 samples positive) indicates, in contrast, that the transmission of Listeria spp. by raw vegetables is a minor health threat in India [31]. However, that pathogen is generally stated to be ubiquitous in the environment.

Relevant Antibiotics, Resistance Levels, and Resistance Patterns Within the Reviewed Studies

Antibiotic resistances were not studied very often among the reviewed studies. However, the isolates’ resistance levels and patterns were diverse among the studies due to the number of tested species and antimicrobials. Besides the standard methods followed for the AMR susceptibility pattern, two studies that tested AMR in soil and manure samples reported AMR following a slightly different procedure. In both studies, the samples were tested instead of the isolated microorganisms. The samples were diluted and plated on agar plates.
In view of E. coli and Salmonella spp. from the vegetable samples, the highest resistance levels were reported to azithromycin (100%), followed by tetracycline and erythromycin, and found to be similar in the case of isolates from soil, manure, and water samples [43]. The antibiotic resistance levels and patterns exhibited by Salmonella spp. also differ according to a second study that confirms the antibiotics that are most commonly used in the Southeast Asia region are erythromycin, azithromycin, and tetracycline [36,51].
Concerning ESBL-producing pathogens, the prevalence was reported in vegetable salads, ready-to-eat salads, and fruits [30,34,44,47]. The results of a small study conducted in India that found both ESBL-producing E. coli and non-ESBL producers in similar abundance, on top of significant differences in multi-resistance levels between the groups (up to nearly double in ESBL bacteria), have to be questioned in view to certainty and generalizability of that results, which we rate to be low due to a small sample size (n = 6) [30]. A study of more certainty because of a bigger sample size detected a much lower ESBL abundance of 6% (8/141) in Enterobacteriaceae isolates. A similar abundance was shown for carbapenem resistance and metallo beta lactamase-producers of 6% each. A much higher abundance of 16% was identified for AmpC beta-lactamases producers [47]. Listeria monocytogenes antibiotic resistance profiles showed the highest resistance to ciprofloxacin and cefotaxime antimicrobials, similar to those isolated from vegetable and soil samples [31].
Research interest in multi-resistances of vegetable-associated bacteria within the South Asian region during the last decade, in general, seems not to be very high due to the small number of papers dealing with that topic. E. coli and Salmonella spp. isolates reported from fresh produce were resistant to multiple antibiotics of clinical importance, such as erythromycin [44]. In the case of Klebsiella spp., three major antibiotics that were reported to be resistant were Amoxycillin, Ceftriaxone, and Tetracycline [36]. Resistance patterns of the 75% isolates of Listeria monocytogenes from vegetables and 50% from rhizospheric soil samples exhibited resistance to ciprofloxacin and cefotaxime, underlining the reduction efficiency of the particular antibiotics [31].
Following the explanations by Saptoka et al. (2019), the enteric bacteria fecal flora is specified to be substantially resistant, and E. coli is considered the leading transporter of antimicrobial resistance [44]. The increasing amount of antibiotics in the livestock sector affects the entire agro-ecosystem. The soil of the farm is heavily contaminated with resistant bacteria out of manure, which may have contaminated the vegetables produced on the contaminated soil. The use of unsafe water for irrigation could also contribute to the spread of ARB on the vegetables and increase prevalence in the agro-ecosystem [44]. Still, it may be less relevant regarding low contamination levels found by Abdus Sobur et al. (2019) [43]. The unhygienic conditions at the markets and lack of personal hygiene are also associated with the contamination of fresh produce with ARB. The lack of knowledge and awareness among the food handlers in restaurants with the ready-to-eat salad preparation steps further increases the risk of spreading pathogens and ARB on the plate [44].
Only one article presented resistance findings at gene levels in E. coli and Salmonella spp. isolated from irrigation water, vegetables, soil, and manure samples. General abundance levels of the resistance genes investigated increase in this order. The four resistance genes tetA, tetB (both responsible for resistance against tetracycline), SHV (beta-lactamases and ESBL), and ereA (encoding for Erythromycin Esterase) selected for testing, and the fact that the tetracycline resistance genes were most prevalent [43], underline the importance of Tetracyclines and Erythromycin (or their loss in effectivity) within the South Asian region, and especially for Bangladesh, where the study was conducted and tetracycline is one of the widely used antibiotics [43]. But, other than in the phenotypical testings [43], no macrolide resistance was verified by ARG here. Thus, it could be supposed, but is not indicated in the studies and therefore has to be further verified, that beta-lactam antibiotics may be used more often than macrolides in the South Asian region, or/and ESBL-based resistance may be worse than macrolide resistance in clinical surveillance and therapy.

5. Limitations

Our review systematically evaluated the microbial contamination, the prevalence of ARB and ARGs in fresh produce, and the environment samples of the agro-ecosystem of the South Asia region. In the narrow sense, the articles analyzed precluded us from reporting the multiple routes and exposure pathways that might be involved in the contamination of fresh produce or identifying practices that could aid in mitigating these risks. Any risk assessment regarding the extent of the human health risks associated with the consumption of contaminated fresh produce containing pathogens, ARB, or ARGs, was not the aim of this review.
Most of the studies focused on the prevalence of specific bacterial pathogens on samples, which limited the data on the presence of other foodborne pathogens. It is not always clear if the selection of investigated and reported species and resistances in each study is based on medical evidence within the South Asian region, e.g., clinical surveillance and therapy or personal researcher preferences.
In studies that reported the detection of ARBs by aggregating the phenotypic results, the information on the total number of samples tested or provided full susceptibility was missing. The analysis of the collected data from the studies often reports only the presence of resistance instead of the prevalence. The publication bias related to the studies with the resistance results prioritized for publication, leading to conclusions of resistant organisms on fresh produce, was unavoidable. Studies reporting the presence of resistant microorganisms reported the prevalence among the isolates instead of the collected sample groups. The resistance profiles of the same bacteria were found to be diverse among the studies owing to location, number of samples, types of samples (vegetable, soil, water, and manure), choice of antibiotics investigated, and detection and identification procedures followed. Due to the finding of heterogeneity among the included articles, a statistical analysis to prove significance was not performed. The lack of studies focussing on detecting ARGs in samples limited the analysis.
Thus, the reviewed studies showed a broad variation in study designs and a lack of standardized methods and data reporting, which challenged the comparability and understanding in our review and impeded the identification of generalizable, clear, and significant facts, such as the situation or trend applicable to the South Asian region.
The review showed an urgent need to standardize detection methods for environmental samples. In our experience, the practice of existing standards optimized for clinical samples or such with low background flora cannot be used due to the high microbial background in environmental matrices like soil, plants, manure, etc.

6. Conclusions

This review contributes to understanding AMR occurring in the fresh produce and agro-ecosystem. Our results indicate that the presence of pathogenic microorganisms on fresh produce that harbor resistance traits reflected by the presence of ARB and ARGS pose potential public health risks for consumers. The most frequent produce type found included raw-consumed vegetables or salad vegetables consumed with minimal processing, including tomato, cucumber, carrot, cabbage, and spinach. The most commonly encountered bacterial isolates contaminating the food and food-producing environment include E. coli, Salmonella spp., Staphylococcus spp., and Klebsiella spp. The reported bacteria were resistant to the most commonly used antimicrobials by humans in the South Asia region, such as tetracycline and erythromycin in fresh produce and agro-ecosystems in the published literature. This represents the complexity of contamination pathways involving human and environmental sources. The results from this review indicate potential food security and food safety issues and significant AMR exposure risk for consumers. The data on antimicrobial-resistant bacteria in a wide range of plant-origin foods reported from various regions of the world indicate the possible route of dissemination of antimicrobial-resistant bacteria and their genes to humans [52]. This highlights the essential need to incorporate plant-based food in AMR-related surveillance systems. In addition, including samples from the immediate food production environment, such as soil, irrigation water, etc., is equally vital in complementing the AMR in food and environmental dimensions. However, the considerable challenge for incorporating plant-based food in surveillance systems is the lack of standardized indicators of microbes, methods of measuring resistance, and types of AMR, which are reported in this review. This challenge requires considerable input from various stakeholders, but it is necessary for systematic surveillance, reporting, and comparison of data worldwide to assess potential risks. Future studies should focus on the South Asia region to quantify ARB/ARGs in fresh produce and its production environment.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microorganisms12112267/s1, Table S1: Additional information.

Author Contributions

All authors contributed substantially to the design of the study. Conceptualization, P.K. and C.S.; methodology, P.K.; formal analysis, P.K. and S.Y.; investigation, P.K. and S.Y.; data curation, P.K. and S.Y.; writing—original draft preparation, P.K.; writing—review and editing, S.Y., D.S. and C.S.; visualization, P.K.; supervision, S.Y., D.S. and C.S. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the University of Bonn, the University of Applied Sciences Bonn-Rhein-Sieg, and the Ministry of Culture and Science of North Rhine-Westphalia, Germany, through the Forschungskolleg “One Health and Urban Transformation”. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Data Availability Statement

The study data are available upon request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Hutchings, M.; Truman, A.; Wilkinson, B. Antibiotics: Past, Present and Future. Curr. Opin. Microbiol. 2019, 51, 72–80. [Google Scholar] [CrossRef] [PubMed]
  2. Bennani, H.; Mateus, A.; Mays, N.; Eastmure, E.; Stärk, K.D.C.; Häsler, B. Overview of Evidence of Antimicrobial Use and Antimicrobial Resistance in the Food Chain. Antibiotics 2020, 9, 49. [Google Scholar] [CrossRef] [PubMed]
  3. Kumar, S. Antimicrobial Resistance: A Top Ten Global Public Health Threat. eClinicalMedicine 2021, 41, 101221. [Google Scholar] [CrossRef]
  4. World Bank. Drug-Resistant Infections. A Threat to Our Economic Future; World Bank: Washington, DC, USA, 2017; Available online: https://www.worldbank.org/en/topic/health/publication/drug-resistant-infections-a-threat-to-our-economic-future (accessed on 8 November 2023).
  5. Murray, C.J.; Shunji Ikuta, K.; Sharara, F.; Swetschinski, L.; Robles Aguilar, G.; Gray, A.; Han, C.; Bisignano, C.; Rao, P.; Wool, E.; et al. Global Burden of Bacterial Antimicrobial Resistance in 2019: A Systematic Analysis. Lancet 2022, 399, 629–655. [Google Scholar] [CrossRef]
  6. Murray, C.J.L.; Afshin, A.; Alam, T.; Ashbaugh, C.; Barthelemy, C.; Biehl, M.; Brauer, M.; Compton, K.; Cromwell, E.; Dandona, L.; et al. Global Burden of 369 Diseases and Injuries in 204 Countries and Territories, 1990–2019: A Systematic Analysis for the Global Burden of Disease Study 2019. Lancet 2020, 396, 1204–1222. [Google Scholar] [CrossRef]
  7. Holmes, A.H.; Moore, L.S.P.; Sundsfjord, A.; Steinbakk, M.; Regmi, S.; Karkey, A.; Guerin, P.J.; Piddock, L.J.V. Understanding the Mechanisms and Drivers of Antimicrobial Resistance. Lancet 2016, 387, 176–187. [Google Scholar] [CrossRef]
  8. McEwen, S.A.; Collignon, P.J. Antimicrobial Resistance: A One Health Perspective. Microbiol. Spectr. 2018, 6, 521–547. [Google Scholar] [CrossRef]
  9. O’Neill, J. Tackling Drug-Resistant Infections Globally: Final Report and Recommendations the Review on Antimicrobial Resistance Chaired By Jim O’neill. 2016. Available online: https://amr-review.org/sites/default/files/160518_Final%20paper_with%20cover.pdf (accessed on 10 October 2024).
  10. Singer, A.C.; Shaw, H.; Rhodes, V.; Hart, A. Review of Antimicrobial Resistance in the Environment and Its Relevance to Environmental Regulators. Front. Microbiol. 2016, 7, 219380. [Google Scholar] [CrossRef]
  11. Van Boeckel, T.P.; Pires, J.; Silvester, R.; Zhao, C.; Song, J.; Criscuolo, N.G.; Gilbert, M.; Bonhoeffer, S.; Laxminarayan, R. Global Trends in Antimicrobial Resistance in Animals in Low- And Middle-Income Countries. Science 2019, 365, eaaw1944. [Google Scholar] [CrossRef]
  12. Booton, R.D.; Meeyai, A.; Alhusein, N.; Buller, H.; Feil, E.; Lambert, H.; Mongkolsuk, S.; Pitchforth, E.; Reyher, K.K.; Sakcamduang, W.; et al. One Health Drivers of Antibacterial Resistance: Quantifying the Relative Impacts of Human, Animal and Environmental Use and Transmission. One Health 2021, 12, 100220. [Google Scholar] [CrossRef]
  13. van Bunnik, B.A.D.; Woolhouse, M.E.J. Modelling the Impact of Curtailing Antibiotic Usage in Food Animals on Antibiotic Resistance in Humans. R. Soc. Open Sci. 2017, 4, 161067. [Google Scholar] [CrossRef]
  14. Chatterjee, A.; Modarai, M.; Naylor, N.R.; Boyd, S.E.; Atun, R.; Barlow, J.; Holmes, A.H.; Johnson, A.; Robotham, J.V. Quantifying Drivers of Antibiotic Resistance in Humans: A Systematic Review. Lancet Infect. Dis. 2018, 18, e368–e378. [Google Scholar] [CrossRef]
  15. FAO and WHO Joint FAO/WHO Expert Meeting in Collaboration with OIE on Foodborne Antimicrobial Resistance: Role of the Environment, Crops and Biocides: Meeting Report. Available online: https://www.who.int/publications/i/item/9789241516907 (accessed on 19 November 2023).
  16. Lima, T.; Domingues, S.; Silva, G.J. Da Manure as a Potential Hotspot for Antibiotic Resistance Dissemination by Horizontal Gene Transfer Events. Vet. Sci. 2020, 7, 110. [Google Scholar] [CrossRef]
  17. Richter, L.; du Plessis, E.M.; Duvenage, S.; Korsten, L. Occurrence, Phenotypic and Molecular Characterization of Extended-Spectrum- and AmpC- β-Lactamase Producing Enterobacteriaceae Isolated From Selected Commercial Spinach Supply Chains in South Africa. Front. Microbiol. 2020, 11, 487965. [Google Scholar] [CrossRef] [PubMed]
  18. Balali, G.I.; Yar, D.D.; Afua Dela, V.G.; Adjei-Kusi, P. Microbial Contamination, an Increasing Threat to the Consumption of Fresh Fruits and Vegetables in Today’s World. Int. J. Microbiol. 2020, 2020, 3029295. [Google Scholar] [CrossRef]
  19. FAO. FAOSTAT Analytical Brief 60 Agricultural Production Statistics Agricultural Production Statistics 2000–2021 FAOSTAT Analytical Brief 60 FAOSTAT Crops and Livestock Production Introduction. 2021. Available online: https://openknowledge.fao.org/server/api/core/bitstreams/58971ed8-c831-4ee6-ab0a-e47ea66a7e6a/content (accessed on 10 October 2024).
  20. Morita. Chapter 7—Past Growth in Agricultural Productivity in South Asia. In Current Directions in Water Scarcity Research; Elsevier: Amsterdam, The Netherlands, 2021; Volume 3, pp. 137–156. [Google Scholar] [CrossRef]
  21. Septembre-Malaterre, A.; Remize, F.; Poucheret, P. Fruits and Vegetables, as a Source of Nutritional Compounds and Phytochemicals: Changes in Bioactive Compounds during Lactic Fermentation. Food Res. Int. 2018, 104, 86–99. [Google Scholar] [CrossRef] [PubMed]
  22. Mir, S.A.; Shah, M.A.; Mir, M.M.; Dar, B.N.; Greiner, R.; Roohinejad, S. Microbiological Contamination of Ready-to-Eat Vegetable Salads in Developing Countries and Potential Solutions in the Supply Chain to Control Microbial Pathogens. Food Control 2018, 85, 235–244. [Google Scholar] [CrossRef]
  23. Collineau, L.; Boerlin, P.; Carson, C.A.; Chapman, B.; Fazil, A.; Hetman, B.; McEwen, S.A.; Jane Parmley, E.; Reid-Smith, R.J.; Taboada, E.N.; et al. Integrating Whole-Genome Sequencing Data into Quantitative Risk Assessment of Foodborne Antimicrobial Resistance: A Review of Opportunities and Challenges. Front. Microbiol. 2019, 10, 444886. [Google Scholar] [CrossRef]
  24. Chereau, F.; Opatowski, L.; Tourdjman, M.; Vong, S. Risk Assessment for Antibiotic Resistance in South East Asia. BMJ 2017, 358, 2–8. [Google Scholar] [CrossRef]
  25. Noor, A.U.Z.; Kabir, H.; Chowdhury, M.A.A.; Ather, M.F.; Hasan, M.K. An Emerging Route to Antibiotic Resistance in South Asia: A Correspondence. Ann. Med. Surg. 2023, 85, 335. [Google Scholar] [CrossRef]
  26. Brunn, A.; Kadri-Alabi, Z.; Moodley, A.; Guardabassi, L.; Taylor, P.; Mateus, A.; Waage, J. Characteristics and Global Occurrence of Human Pathogens Harboring Antimicrobial Resistance in Food Crops: A Scoping Review. Front. Sustain. Food Syst. 2022, 6, 824714. [Google Scholar] [CrossRef]
  27. Rethlefsen, M.L.; Kirtley, S.; Waffenschmidt, S.; Ayala, A.P.; Moher, D.; Page, M.J.; Koffel, J.B.; Blunt, H.; Brigham, T.; Chang, S.; et al. PRISMA-S: An Extension to the PRISMA Statement for Reporting Literature Searches in Systematic Reviews. Syst. Rev. 2021, 10, 39. [Google Scholar] [CrossRef] [PubMed]
  28. Aromataris, E.; Lockwood, C.; Porritt, K.; Pilla, B.; Jordan, Z. (Eds.) JBI Manual for Evidence Synthesis; JBI: Adelaide, Australia, 2024. [Google Scholar] [CrossRef]
  29. Chaturvedi, M.; Kumar, V.; Singh, D.; Kumar, S. Assessment of Microbial Load of Some Common Vegetables among Two Different Socioeconomic Groups. Int. Food Res. J. 2013, 20, 2927–2931. [Google Scholar]
  30. Rasheed, M.U.; Thajuddin, N.; Ahamed, P.; Teklemariam, Z.; Jamil, K. Antimicrobial Drug Resistance in Strains of Escherichia Isolated from Food Sources. Rev. Inst. Med. Trop. Sao Paulo 2014, 56, 341. [Google Scholar] [CrossRef]
  31. Soni, D.K.; Singh, M.; Singh, D.V.; Dubey, S.K. Virulence and Genotypic Characterization of Listeria Monocytogenes Isolated from Vegetable and Soil Samples. BMC Microbiol. 2014, 14, 241. [Google Scholar] [CrossRef]
  32. Mathur, A.; Joshi, A.; Harwani, D.; Ganga, M. Microbial Contamination of Raw Fruits and Vegetables. 2014. Available online: https://api.semanticscholar.org/CorpusID:8079441 (accessed on 27 November 2023).
  33. Kabir, A.; Das, A.K.; Kabir, M.S. Incidence of Antibiotic Resistant Pathogenic Bacteria in Vegetable Items Sold by Local and Super Shops in Dhaka City. Stamford J. Microbiol. 2015, 4, 13–18. [Google Scholar] [CrossRef]
  34. Chellapandi, K.; Ralte, L.; Malsawmtluangi, L.; Masih, L.; Kumar Singh, K.T.; Boro, D. Malaysian Journal of Microbiology Assessing Prevalence of Antibiotic Resistant Microbes on Fresh Marketed Vegetables of Aizawl City. Malays. J. Microbiol. 2015, 11, 40–46. [Google Scholar]
  35. Shah, M.S.; Eppinger, M.; Ahmed, S.; Shah, A.A.; Hameed, A.; Hasan, F. Multidrug-Resistant Diarrheagenic E. Coli Pathotypes Are Associated with Ready-to-Eat Salad and Vegetables in Pakistan. J. Korean Soc. Appl. Biol. Chem. 2015, 58, 267–273. [Google Scholar] [CrossRef]
  36. Kundu, S.K.; Islam, M.T. Prevalence of Pathogenic Bacteria Isolated from Two Selected Salad Vegetables and Antibiogram Profile of Klebsiella spp. Agriculturists 2016, 13, 9–17. [Google Scholar] [CrossRef]
  37. Nithya, A.; Babu, S. Prevalence of Plant Beneficial and Human Pathogenic Bacteria Isolated from Salad Vegetables in India. BMC Microbiol. 2017, 17, 64. Available online: https://bmcmicrobiol.biomedcentral.com/articles/10.1186/s12866-017-0974-x (accessed on 10 October 2024). [CrossRef]
  38. Mritunjay, S.K.; Kumar, V. A Study on Prevalence of Microbial Contamination on the Surface of Raw Salad Vegetables. 3 Biotech 2017, 7, 13. [Google Scholar] [CrossRef] [PubMed]
  39. Rabins, S.L.; Bhattacharya, A.; Ajay kumar, V.J.; Vijayan, C. PCR Based Detection and Biofilm Formation of Salmonella from Fresh Coriander Leaves (Coriandrum sativum). Asian J. Dairy. Food Res. 2018, 37, 144–148. [Google Scholar] [CrossRef]
  40. Kundu, A.; Wuertz, S.; Smith, W.A. Quantitative Microbial Risk Assessment to Estimate the Risk of Diarrheal Diseases from Fresh Produce Consumption in India. Food Microbiol. 2018, 75, 95–102. [Google Scholar] [CrossRef] [PubMed]
  41. Verma, P.; Saharan, V.V.; Nimesh, S.; Singh, A.P. Phenotypic and Virulence Traits of Escherichia Coli and Salmonella Strains Isolated from Vegetables and Fruits from India. J. Appl. Microbiol. 2018, 125, 270–281. [Google Scholar] [CrossRef]
  42. Ahmed, S.; Siddique, M.A.; Rahman, M.; Bari, M.L.; Ferdousi, S. A Study on the Prevalence of Heavy Metals, Pesticides, and Microbial Contaminants and Antibiotics Resistance Pathogens in Raw Salad Vegetables Sold in Dhaka, Bangladesh. Heliyon 2019, 5, e01205. [Google Scholar] [CrossRef]
  43. Abdus Sobur, M.; Al Momen Sabuj, A.; Sarker, R.; Taufiqur Rahman, A.M.M.; Lutful Kabir, S.M.; Tanvir Rahman, M. Antibiotic-Resistant Escherichia Coli and Salmonella Spp. Associated with Dairy Cattle and Farm Environment Having Public Health Significance. Vet. World 2019, 12, 984. [Google Scholar] [CrossRef]
  44. Sapkota, S.; Adhikari, S.; Khadka, S.; Adhikari, M.; Kandel, H.; Pathak, S.; Pandey, A.; Pandey, A. Multi-Drug Resistant Extended-Spectrum Beta-Lactamase Producing E. Coli and Salmonella on Raw Vegetable Salads Served at Hotels and Restaurants in Bharatpur, Nepal. BMC Res. Notes 2019, 12, 516. [Google Scholar] [CrossRef]
  45. Ghafur, A.; Shankar, C.; GnanaSoundari, P.; Venkatesan, M.; Mani, D.; Thirunarayanan, M.A.; Veeraraghavan, B. Detection of Chromosomal and Plasmid-Mediated Mechanisms of Colistin Resistance in Escherichia coli and Klebsiella pneumoniae from Indian Food Samples. J. Glob. Antimicrob. Resist. 2019, 16, 48–52. [Google Scholar] [CrossRef]
  46. Ali, B. Functional and Genetic Diversity of Bacteria Associated with the Surfaces of Agronomic Plants. Plants 2019, 8, 91. [Google Scholar] [CrossRef]
  47. Saksena, R.; Malik, M.; Gaind, R. Bacterial Contamination and Prevalence of Antimicrobial Resistance Phenotypes in Raw Fruits and Vegetables Sold in Delhi, India. J. Food Saf. 2020, 40, e12739. [Google Scholar] [CrossRef]
  48. Rathore, P.; Joy, S.S.; Yadav, R.; Ramakrishna, W. Co-Occurrence and Patterns of Phosphate Solubilizing, Salt and Metal Tolerant and Antibiotic-Resistant Bacteria in Diverse Soils. 3 Biotech 2021, 11, 356. [Google Scholar] [CrossRef] [PubMed]
  49. Shrivas, V.L.; Choudhary, A.K.; Hariprasad, P.; Sharma, S. Nutrient Concentrations Affect the Antimicrobial Resistance Profiles of Cattle Manures. Environ. Sci. Pollut. Res. 2021, 30, 25141–25147. [Google Scholar] [CrossRef] [PubMed]
  50. Priyanka; Meena, P.R.; Meghwanshi, K.K.; Rana, A.; Singh, A.P. Leafy Greens as a Potential Source of Multidrug-Resistant Diarrhoeagenic Escherichia Coli and Salmonella. Microbiology 2021, 167, 001059. [Google Scholar]
  51. Nepal, G.; Bhatta, S. Self-Medication with Antibiotics in WHO Southeast Asian Region: A Systematic Review. Cureus 2018, 10, e2428. [Google Scholar] [CrossRef]
  52. van Hoek, A.H.A.M.; Veenman, C.; van Overbeek, W.M.; Lynch, G.; de Roda Husman, A.M.; Blaak, H. Prevalence and Characterization of ESBL- and AmpC-Producing Enterobacteriaceae on Retail Vegetables. Int. J. Food Microbiol. 2015, 204, 1–8. [Google Scholar] [CrossRef]
Figure 1. PRISMA flowchart diagram illustrating the selection process of studies for the systematic review. * Consider, if feasible to do so, reporting the number of records identified from each database or register searched (rather than the total number across all databases/registers). ** If automation tools were used, indicate how many records were excluded by a human and how many were excluded by automation tools.
Figure 1. PRISMA flowchart diagram illustrating the selection process of studies for the systematic review. * Consider, if feasible to do so, reporting the number of records identified from each database or register searched (rather than the total number across all databases/registers). ** If automation tools were used, indicate how many records were excluded by a human and how many were excluded by automation tools.
Microorganisms 12 02267 g001
Figure 2. A pictorial illustration of the studies conducted in different countries of the South Asia region.
Figure 2. A pictorial illustration of the studies conducted in different countries of the South Asia region.
Microorganisms 12 02267 g002
Figure 3. Distribution of reported sample settings of the publications.
Figure 3. Distribution of reported sample settings of the publications.
Microorganisms 12 02267 g003
Table 1. Search strategy for the systematic review.
Table 1. Search strategy for the systematic review.
Key search termsAntimicrobial resistance-related terms
(Combined by ‘OR’) (i)
Agriculture, agriculture products, and farm produce-related terms
(Combined by ‘OR’) (ii)
Study site/country
(Combined by ‘OR’) (iii)
(“antibiotic*” OR “antimicrobial*” OR “antimicrobial resistan*” OR “antibiotic resistan*” OR “antibiotic resistant bacteria” OR “antibiotic resistant gene” OR “antimicrobial resistant organism” OR “antibiotic resistant pathogen”)(“agriculture” OR “fresh produce” OR “vegetables” OR “salad” OR “fresh agriculture products” OR “raw vegetables” OR “salad vegetables” OR “fruits” OR “leafy green” OR “farming”)(“india” OR “pakistan” OR “afghanistan” OR “bangladesh” OR “bhutan” OR “maldives” OR “nepal” OR “sri lanka” OR “south asia”)
Filters: from 2012 to 2022
Table 2. Inclusion and exclusion criteria followed for the systematic review.
Table 2. Inclusion and exclusion criteria followed for the systematic review.
Inclusion CriteriaStudies that detect and/or quantify bacteria, ARB, and/or ARGs on agriculture products (plant/plant products/vegetables/leafy green/fruits), and/or in agriculture production environments (soil/manure/water)
Studies that detect and/or quantify bacteria, ARB, and/or ARGs in mixed or ready-to-eat salads
Studies conducted in South Asian countries
Full-text-peer-reviewed journal articles and grey literature
Language: English
Exclusion CriteriaStudies that did not include any fresh agriculture product
Studies that include data on animal agriculture (e.g., dairy, meat, aquaculture, poultry) only
Studies that include data on animal-based foods (e.g., egg, milk, beef, pork, chicken, etc.) only
Studies that did not have data from the South Asian countries
All types of review articles
Table 3. Basic characteristics of the included study articles.
Table 3. Basic characteristics of the included study articles.
Article No.AuthorsPublication YearCountrySpecific LocalitiesFrequencyCategory of LocalityCategory of Sample
(Fresh Produce)
Category of Sample
(Environment)
Studies Reported
MarketFarmRestaurantHotelHouseholdRoadside Food SellerOtherRoot VegetableLeafy VegetableVegetableHerbsFruitLegumesSoilWaterManureMicroorganism DetectedAntibiotic-Resistance TestedAntibiotic-Resistant Genes
1Chaturvedi, M., Kumar, V., Singh, D., and Kumar [29]2013IndiaShops8X X X X X
2Rasheed, M. U., Thajuddin, N., Ahamed, P., Teklemariam, Z., and Jamil, K. [30]2014IndiaLocalities12 XXXX X XX
3Soni, D. K., Singh, M., Singh, D. V., and Dubey, S. K. [31]2014IndiaAgricultural FarmN/A X XX XXX XX
4Mathur, A., Joshi, A., Harwani, D., and Ganga, M. [32]2014IndiaMarketN/AX XX X XX
5Kabir, A., Das, A. K., and Kabir, M. S. [33]2015BangladeshLocal market, Super
market
7X X X XX XX
6Chellapandi, K., Ralte, L., Malsawmtluangi, L., Masih, L., Kumar Singh, K. T., and Boro, D. [34]2015IndiaVegetable market3X X X X XX
7Shah, M. S., Eppinger, M., Ahmed, S., Shah, A. A., Hameed, A., and Hasan, F. [35]2015PakistanLocal vegetable market and restaurantN/AX X XX X XX
8Kundu, S. K., and Islam, M. T. [36]2016BangladeshLocal marketN/AX X XX
9Nithya, A., and Babu, S. [37]2017IndiaLocal marketN/AX X X X
10Mritunjay, S. K., and Kumar, V. [38]2017IndiaLocal market, retail market, local producerN/AX XXXXX X
11Rabins, S. L., Bhattacharya, A., Ajay kumar, V. J., and Vijayan, C. [39]2018IndiaVegetable marketN/AX X XX
12Kundu, A., Wuertz, S., and Smith, W. A. [40]2018IndiaWholesale markets, foodmarts, roadside food seller3
5
1
X X XX X
13Verma, P., Saharan, V. V., Nimesh, S., and Singh, A. P. [41]2018IndiaLocal market, agricultural fields70
40
XX XX X XX
14Ahmed, S., Siddique, M. A., Rahman, M., Bari, M. L., and Ferdousi, S. [42]2019BangladeshChain shops, wholesale market, retail market3
3
6
X X XX XX
15Abdus Sobur, M., Al Momen Sabuj, A., Sarker, R., Taufiqur Rahman, A. M. M., Lutful Kabir, S. M., and Tanvir Rahman, M. [43]2019BangladeshDairy farm4 X X X XXXXXX
16Sapkota, S., Adhikari, S., Khadka, S., Adhikari, M., Kandel, H., Pathak, S., Pandey, A., and Pandey, A. [44]2019NepalRestaurant and hotelN/A XX X X XX
17Ghafur, A., Shankar, C., GnanaSoundari, P., Venkatesan, M., Mani, D., Thirunarayanan, M. A., and Veeraraghavan, B. [45]2019IndiaShops
household
14
8
X X N/AN/AN/AN/AN/AN/A XX
18Ali, B. [46]2019PakistanVegetable shop, vegetable market, superstoreN/AX X X XX
19Saksena, R., Malik, M., and Gaind, R. [47]2020IndiaRetail vendor, wholesale marketN/AX X X X XX
20Rathore, P., Joy, S. S., Yadav, R., and Ramakrishna, W. [48]2021IndiaAgricultural field, non-agricultural field3
1
X X XX
21Shrivas, V. L., Choudhary, A. K., Hariprasad, P., and Sharma, S. [49,50]2021IndiaFarming site, grazing site18
32
X X X
22Priyanka, Meena, P. R., Meghwanshi, K. K., Rana, A., and Singh, A. P. [50]2021IndiaRetail shops, vendors, agricultural markets, supermarkets14
25
9
7
X XXX XX
N/A means not applicable
Table 4. Microbial contamination of fresh produce and agro-ecosystem in the included study articles.
Table 4. Microbial contamination of fresh produce and agro-ecosystem in the included study articles.
Article No.Publication YearCountryCategory of LocalityFrequencyCategory of SampleSamples ReportedFrequencyMicroorganism Tested
12013IndiaMarket8Root vegetablePotato4Total aerobic bacterial count
VegetableCarrot4Yeast and mold count
LegumesRadish4E. coli
Onion4Coliform count
Garlic4
Ginger4
Cauliflower4
Cabbage4
Peas4
22014IndiaOther12Fruit Cucumber30E. coli
Root vegetableTomato
Leafy vegetableBeetroot
VegetableRadish
Carrot
Spinach
Cabbage
Lettuce
32014IndiaFarmN/AFruitBrinjal20Listeria monocytogenes
Leafy vegetableChappan kaddu20
VegetableChilli20
LegumesTomato20
EnvironmentSpinach20
Cauliflower20
Cabbage20
Broccoli20
Dolichos-Bean20
Cowpea20
Soil200
42014IndiaMarketN/AFruitMangoN/ABacillus
Root vegetableLemonLactobacillus
Leafy vegetablePapayaCaynebacterium
AppleStreptococcus
CucumberStaphylococcus
ChilliMicrococcus
LuffaPseudomonas
TomatoEnterobacteriaceae
Potato
Onion
Spinach
52015BangladeshMarket7FruitTomato2Total heterotrophic bacteria
Root vegetableCarrot2Total coliform bacteria
VegetableRadish2Fecal coliform
LegumesTurnip2Staphylococcus aureus
Cauliflower2Pseudomonas spp.
Cabbage2Listeria spp.
Bean2Salmonella and Shigella spp.
Vibrio spp.
E. coli
62015IndiaMarket3FruitTomato27Total microbial load
Root vegetablePotatoE. coli
VegetableCabbageEnterobacter spp.
Klebsiella spp.
Proteus spp.
Citrobacter spp.
Serratia spp.
Staphylococcus spp.
72015PakistanMarket RestaurantN/AFruitCucumber200E. coli
Root vegetableTomato
Leafy vegetableCarrot
VegetableSpinach
Lettuce
Ready-to-eat salad 40
82016BangladeshMarketN/AFruitTomato7Total viable count
Cucumber7Total coliform count
Total staphylococcal count
Klebsiella spp.
Enterobacter spp.
Shigella spp.
Citrobacter spp.
E. coli
92017IndiaMarketN/AFruitCucumberN/ADensity endophytic bacteria
Root vegetableTomatoTotal endophytic bacteria
CarrotActinomycetes
OnionPseudomonas spp.
E. coli
Staphylococcus spp.
Salmonella spp.
102017IndiaMarketN/AFruitCucumber60Aerobic mesophilic count
Root vegetableTomato60Psychotropic count
Leafy vegetableRadish60Coliform count
HerbsCarrot60Yeast and mold count
Beetroot60E. coli
Cabbage60E. coli O157:H7
Spinach60Salmonella spp.
Coriander60Listeria monocytogenes
Exiguobacterium spp.
112018IndiaMarketN/AHerbsCoriander60Salmonella spp.
122018IndiaMarket Roadside food seller3
5
1
FruitCantaloupe17E. coli
HerbsCucumber18Salmonella spp.
Pepper20Shiga toxin-producing E. coli
English cucumber15Enterohemorrhagic E. coli
Mint and Cilantro15Total Bacteroidales
132018IndiaMarket
Farm
70
40
FruitTomato80E. coli
Root vegetableCantaloupe60Salmonella spp.
Leafy vegetableCucumber80
Carrot80
Radish80
Spinach140
142019BangladeshMarket3
3
6
FruitTomato30Total aerobic count
VegetableCucumber30Total coliform count
HerbsLettuce30E. coli
Coriander30Salmonella
Staphylococcus spp.
152019BangladeshFarm4FruitTomato40Total viable count
Leafy vegetableGreen chilliTotal E. coli count
EnvironmentMalabar spinachTotal Salmonella count
Red spinachE. coli
Salmonella spp.
Manure60Salmonella spp.
Water20E. coli
Salmonella spp.
Soil40E. coli
Salmonella spp.
162019NepalRestaurant
Hotel
N/AFruitCucumber72E. coli
Root vegetableCarrot72Salmonella spp.
(Ready-to-eat salad)Radish72
172019IndiaMarket
Household
14
8
Vegetable 63E. coli
Klebsiella spp.
Enterobacter
Citrobacter
182019PakistanMarketN/ARoot vegetableCarrot12Staphylococcus spp.
VegetableTurnip12Bacillus spp.
Cabbage12Citrobacter spp.
Enterobacter spp.
Exiguobacterium spp.
Lysinibacillus fusiforms
Arthobacter nicotianae
Burkholderia cepacia
Acinetobacter spp.
Stenotrophomonas maltophilia
Serratia spp.
Pantoea dispersa
Khyvera cryecrescens
Klebsiella pneumoniae
Pseudomonas putida
192020IndiaMarketN/AFruitGrapes1E. coli
Root vegetablePear2Klebsiella spp.
VegetableApple4Enterobacter spp.
Chilli pepper23Proteus spp.
Tomato28Citrobacter spp.
Cucumber28Providencia spp.
Onion30Acinetobacter spp.
Ginger14Pseudomonas spp.
Carrot11
Garlic2
Radish2
Cabbage5
202021IndiaFarm3
1
EnvironmentSoil4Total bacterial count
Proteobacteria
Acidobacteria
Actinobacteria
Chloroflexi
212021IndiaFarm18
32
EnvironmentManure50
222021IndiaMarket14
25
9
7
Leafy vegetableSpinach220E. coli
VegetableFenugreek120Salmonella spp.
Cabbage90
HerbsPeppermint170
Coriander230
The grey color means the particular study doesn’t report any microorganism. N/A means not applicable.
Table 5. ARG reported on fresh produce and agro-ecosystems in the included study article.
Table 5. ARG reported on fresh produce and agro-ecosystems in the included study article.
Article No. CountryAntibiotic-Resistant Genes TestedE. coliSalmonella spp.Methodology
Cow DungSoilWaterVegetableCow DungSoilWaterVegetablePrimer Sequence (5′-3′)Approxband Size (bp)Annealing Temp. (°C)
15BangladeshereA43.18%
(19/44)
36.36%
(12/33)
37.5%
(3/8)
30.77%
(8/26)
41.02%
(16/39)
34.61%
(9/26)
0.0%
(0/5)
26.67%
(4/15)
F: GCCGGTGCTCATGAACTTGAG R: CGACTCTATTCGATCAGAGGC 41952
tetA88.89%
(40/45)
82.35%
(28/34)
75%
(6/8)
80.77%
(21/26)
84.61%
(33/39)
80.00%
(20/25)
80.00%
(4/5)
75.00%
(12/16)
F: GGTTCACTCGAACGACGTCA R: CTGTCCGACAAGTTGCATGA 57757
tetB46.67%
(21/45)
38.23%
(13/34)
37.5%
(3/8)
38.46%
(5/18)
41.02%
(16/39)
36.00%
(9/25)
20.00%
(1/5)
31.25%
(5/16)
F: CCTCAGCTTCTCAACGCGTG R: GCACCTTGCTGATGACTCTT 63456
SHV28.57%
(10/35)
26.92%
(7/26)
0%
(0/6)
27.78%
(44/96)
24.00%
(6/25)
25.00%
(4/16)
0.0%
(0/2)
16.7%
(1/6)
F: TCGCCTGTGTATTATCTCCC R:CGCAGATAAATCACCACAATG 76852
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kalpana, P.; Yasobant, S.; Saxena, D.; Schreiber, C. Microbial Contamination and Antibiotic Resistance in Fresh Produce and Agro-Ecosystems in South Asia—A Systematic Review. Microorganisms 2024, 12, 2267. https://doi.org/10.3390/microorganisms12112267

AMA Style

Kalpana P, Yasobant S, Saxena D, Schreiber C. Microbial Contamination and Antibiotic Resistance in Fresh Produce and Agro-Ecosystems in South Asia—A Systematic Review. Microorganisms. 2024; 12(11):2267. https://doi.org/10.3390/microorganisms12112267

Chicago/Turabian Style

Kalpana, Pachillu, Sandul Yasobant, Deepak Saxena, and Christiane Schreiber. 2024. "Microbial Contamination and Antibiotic Resistance in Fresh Produce and Agro-Ecosystems in South Asia—A Systematic Review" Microorganisms 12, no. 11: 2267. https://doi.org/10.3390/microorganisms12112267

APA Style

Kalpana, P., Yasobant, S., Saxena, D., & Schreiber, C. (2024). Microbial Contamination and Antibiotic Resistance in Fresh Produce and Agro-Ecosystems in South Asia—A Systematic Review. Microorganisms, 12(11), 2267. https://doi.org/10.3390/microorganisms12112267

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop