Animal Model Studies, Antibiotic Resistance and Toxin Gene Profile of NE Reproducing Clostridium perfringens Type A and Type G Strains Isolated from Commercial Poultry Farms in China
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Sample Processing and Isolation of Bacteria
2.3. Morphological Characteristics of C. perfringens
2.4. Biochemical Characterization of C. perfringens Strains
2.5. Identification of C. perfringens Toxinotypes through Quantitative Real-Time PCR (qPCR)
2.6. Confirmation of NetB Gene Sequence
2.7. Growth Curve for Clostridium Perfringens Type G Strains (D25) and (MZI)
2.8. Animal Model Studies
2.8.1. Chicks and Their Grouping
2.8.2. Bacterial and Coccidial Strains
2.8.3. Experimental Design
2.8.4. Lesion Scoring and Histopathology
2.9. Antibiotic Susceptibility Testing
2.10. Statistical Analysis
3. Results
3.1. Morphological and Biochemical Characteristics of C. perfringens Strains
3.2. Positivity Rate (%) of Clostridium perfringens
3.3. Molecular Typing through Quantitative Real-Time PCR (qPCR)
3.4. Cloning and Sequencing of NetB Toxin Gene
3.5. Growth Curve for Clostridium perfringens Type G Strains (D25) and (MZI)
3.6. NE Lesion Score
3.7. Histopathological Changes in the Small Intestine (Disease Induced Chicks)
3.8. Antimicrobial Susceptibility Results for C. perfringens Type G (D25 & MZI) Strains
4. Discussion
5. Conclusions
Author Contributions
Funding
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Cooper, K.K.; Songer, J.G.; Uzal, F.A. Diagnosing clostridial enteric disease in poultry. J. Vet. Diagn. Investig. 2013, 25, 314–327. [Google Scholar] [CrossRef] [PubMed]
- Prescott, J.F.; Parreira, V.R.; Mehdizadeh Gohari, I.; Lepp, D.; Gong, J. The pathogenesis of necrotic enteritis in chickens: What we know and what we need to know: A review. Avian Pathol. 2016, 45, 288–294. [Google Scholar] [CrossRef]
- Skinner, J.T.; Bauer, S.; Young, V.; Pauling, G.; Wilson, J. An economic analysis of the impact of subclinical (mild) necrotic enteritis in broiler chickens. Avian Dis. 2010, 54, 1237–1240. [Google Scholar] [PubMed]
- Islam, M.; Rashid, S.; Juli, M.; Hoque, M.; Akter, M. Necrotic enteritis in chickens: Pathological, bacteriological and therapeutical investigation. Int. J. Sustain. Crop Prod. 2009, 4, 1–8. [Google Scholar]
- Balachandran, P.; Srinivasan, P.; Balasubramaniam, G.; Sivaseelan, S.; Murthy, T. Prevalence and predisposing factors in spontaneous cases of necrotic enteritis in cage reared commercial layer chicken. Adv. Anim. Vet. Sci 2018, 6, 113–120. [Google Scholar] [CrossRef]
- Dhillon, A.; Roy, P.; Lauerman, L.; Schaberg, D.; Weber, S.; Bandli, D.; Wier, F. High mortality in egg layers as a result of necrotic enteritis. Avian Dis. 2004, 48, 675–680. [Google Scholar] [CrossRef]
- Goossens, E.; Van Erum, J.; De Gussem, M.; Van Limbergen, T.; Callens, C.; De Zutter, L.; Ducatelle, R.; Van Immerseel, F. Incidence and associated risk factors of necrotic enteritis in Belgian layer pullet flocks. Avian Pathol. 2020, 49, 476–485. [Google Scholar] [CrossRef]
- Van Immerseel, F.; Rood, J.I.; Moore, R.J.; Titball, R.W. Rethinking our understanding of the pathogenesis of necrotic enteritis in chickens. Trends Microbiol. 2009, 17, 32–36. [Google Scholar] [CrossRef]
- Gaucher, M.; Quessy, S.; Letellier, A.; Arsenault, J.; Boulianne, M. Impact of a drug-free program on broiler chicken growth performances, gut health, Clostridium perfringens and Campylobacter jejuni occurrences at the farm level. Poult. Sci. 2015, 94, 1791–1801. [Google Scholar] [CrossRef]
- Li, C.; Lillehoj, H.S.; Gadde, U.D.; Ritter, D.; Oh, S. Characterization of Clostridium perfringens strains isolated from healthy and necrotic enteritis-afflicted broiler chickens. Avian Dis. 2017, 61, 178–185. [Google Scholar] [CrossRef]
- Shojadoost, B.; Vince, A.R.; Prescott, J.F. The successful experimental induction of necrotic enteritis in chickens by Clostridium perfringens: A critical review. Vet. Res. 2012, 43, 1–12. [Google Scholar] [CrossRef]
- Rood, J.I.; Keyburn, A.L.; Moore, R.J. NetB and necrotic enteritis: The hole movable story. Avian Pathol. 2016, 45, 295–301. [Google Scholar] [CrossRef]
- Prescott, J.F.; Smyth, J.A.; Shojadoost, B.; Vince, A. Experimental reproduction of necrotic enteritis in chickens: A review. Avian Pathol. 2016, 45, 317–322. [Google Scholar] [CrossRef]
- Immerseel, F.V.; Buck, J.D.; Pasmans, F.; Huyghebaert, G.; Haesebrouck, F.; Ducatelle, R. Clostridium perfringens in poultry: An emerging threat for animal and public health. Avian Pathol. 2004, 33, 537–549. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Adams, V.; Bannam, T.L.; Miyamoto, K.; Garcia, J.P.; Uzal, F.A.; Rood, J.I.; McClane, B.A. Toxin plasmids of Clostridium perfringens. Microbiol. Mol. Biol. Rev. 2013, 77, 208–233. [Google Scholar] [CrossRef]
- Rood, J.I.; Adams, V.; Lacey, J.; Lyras, D.; McClane, B.A.; Melville, S.B.; Moore, R.J.; Popoff, M.R.; Sarker, M.R.; Songer, J.G. Expansion of the Clostridium perfringens toxin-based typing scheme. Anaerobe 2018, 53, 5–10. [Google Scholar] [CrossRef] [PubMed]
- Keyburn, A.L.; Boyce, J.D.; Vaz, P.; Bannam, T.L.; Ford, M.E.; Parker, D.; Di Rubbo, A.; Rood, J.I.; Moore, R.J. NetB, a new toxin that is associated with avian necrotic enteritis caused by Clostridium perfringens. PLoS Pathog. 2008, 4, e26. [Google Scholar] [CrossRef]
- Wade, B.; Keyburn, A.L.; Haring, V.; Ford, M.; Rood, J.I.; Moore, R.J. The adherent abilities of Clostridium perfringens strains are critical for the pathogenesis of avian necrotic enteritis. Vet. Microbiol. 2016, 197, 53–61. [Google Scholar] [CrossRef]
- Cooper, K.K.; Songer, J.G. Virulence of Clostridium perfringens in an experimental model of poultry necrotic enteritis. Vet. Microbiol. 2010, 142, 323–328. [Google Scholar] [CrossRef] [PubMed]
- Mohiuddin, M.; Yuan, W.; Song, Z.; Liao, S.; Qi, N.; Li, J.; Lv, M.; Wu, C.; Lin, X.; Hu, J. Experimental induction of necrotic enteritis with or without predisposing factors using netB positive Clostridium perfringens strains. Gut Pathog. 2021, 13, 1–7. [Google Scholar] [CrossRef]
- Teirlynck, E.; Gussem, M.; Dewulf, J.; Haesebrouck, F.; Ducatelle, R.; Van Immerseel, F. Morphometric evaluation of “dysbacteriosis” in broilers. Avian Pathol. 2011, 40, 139–144. [Google Scholar] [CrossRef]
- Wei, B.; Cha, S.-Y.; Zhang, J.-F.; Shang, K.; Park, H.-C.; Kang, J.; Lee, K.-J.; Kang, M.; Jang, H.-K. Antimicrobial susceptibility and association with toxin determinants in Clostridium perfringens isolates from chickens. Microorganisms 2020, 8, 1825. [Google Scholar] [CrossRef]
- Park, J.Y.; Kim, S.; Oh, J.Y.; Kim, H.R.; Jang, I.; Lee, H.S.; Kwon, Y.K. Characterization of Clostridium perfringens isolates obtained from 2010 to 2012 from chickens with necrotic enteritis in Korea. Poult. Sci. 2015, 94, 1158–1164. [Google Scholar] [CrossRef] [PubMed]
- Praveen Kumar, N.; Vinod Kumar, N.; Karthik, A. Molecular detection and characterization of Clostridium perfringens toxin genes causing necrotic enteritis in broiler chickens. Trop. Anim. Health Prod. 2019, 51, 1559–1569. [Google Scholar] [CrossRef]
- Mohiuddin, M.; Iqbal, Z.; Rahman, S.U. Prevalence of Clostridium perfringens [Beta] 2-toxin in sheep and goat population in Punjab, Pakistan. Thai J. Vet. Med. 2016, 46, 491. [Google Scholar]
- Yang, W.-Y.; Chou, C.-H.; Wang, C. Characterization of toxin genes and quantitative analysis of netB in necrotic enteritis (NE)-producing and non-NE-producing Clostridium perfringens isolated from chickens. Anaerobe 2018, 54, 115–120. [Google Scholar] [CrossRef]
- Keyburn, A.L.; Sheedy, S.A.; Ford, M.E.; Williamson, M.M.; Awad, M.M.; Rood, J.I.; Moore, R.J. Alpha-toxin of Clostridium perfringens is not an essential virulence factor in necrotic enteritis in chickens. Infect. Immun. 2006, 74, 6496–6500. [Google Scholar] [CrossRef]
- Wayne, P. Performance Standards for Antimicrobial Susceptibility Testing, 19th ed.; M100-S19; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2011; 19th ed. approved standard. [Google Scholar]
- Mohiuddin, M.; Iqbal, Z.; Siddique, A.; Liao, S.; Salamat, M.K.F.; Qi, N.; Din, A.M.; Sun, M. Prevalence, genotypic and phenotypic characterization and antibiotic resistance profile of Clostridium perfringens type A and D isolated from feces of sheep (Ovis aries) and goats (Capra hircus) in Punjab, Pakistan. Toxins 2020, 12, 657. [Google Scholar] [CrossRef] [PubMed]
- Fan, Y.-C.; Wang, C.-L.; Wang, C.; Chen, T.-C.; Chou, C.-H.; Tsai, H.-J. Incidence and antimicrobial susceptibility to Clostridium perfringens in premarket broilers in Taiwan. Avian Dis. 2016, 60, 444–449. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.; Zhang, W.; Ai, D.; Zhang, R.; Lu, Q.; Luo, Q.; Shao, H. Prevalence and characterization of Clostridium perfringens in broiler chickens and retail chicken meat in central China. Anaerobe 2018, 54, 100–103. [Google Scholar] [CrossRef]
- Chalmers, G.; Bruce, H.; Hunter, D.; Parreira, V.; Kulkarni, R.; Jiang, Y.-F.; Prescott, J.; Boerlin, P. Multilocus sequence typing analysis of Clostridium perfringens isolates from necrotic enteritis outbreaks in broiler chicken populations. J. Clin. Microbiol. 2008, 46, 3957–3964. [Google Scholar] [CrossRef]
- Osman, K.; Elhariri, M. Antibiotic resistance of Clostridium perfringens isolates from broiler chickens in Egypt. Rev. Sci. Tech. 2013, 32, 841–850. [Google Scholar] [CrossRef] [PubMed]
- Gharaibeh, S.; Al Rifai, R.; Al-Majali, A. Molecular typing and antimicrobial susceptibility of Clostridium perfringens from broiler chickens. Anaerobe 2010, 16, 586–589. [Google Scholar] [CrossRef] [PubMed]
- Xueqin, N.; ZhengYin, S.; Dong, Z.; Xiaoli, Z.; Gong, J.-h. Isolation, identification and genotyping of Clostridium perfringens from chickens in Sichuan province. Chin. J. Zoonoses 2009, 25, 737–786. [Google Scholar]
- Hussain, R.; Guangbin, Z.; Abbas, R.Z.; Siddique, A.B.; Mohiuddin, M.; Khan, I.; Rehman, T.U.; Khan, A. Clostridium perfringens Types A and D Involved in Peracute Deaths in Goats Kept in Cholistan Ecosystem During Winter Season. Front. Vet. Sci. 2022, 9, 849856. [Google Scholar] [CrossRef] [PubMed]
- Xu, W.; Wang, H.; Liu, L.; Miao, Z.; Huo, Y.; Zhong, Z. Prevalence and characterization of Clostridium perfringens isolated from different chicken farms in China. Anaerobe 2021, 72, 102467. [Google Scholar] [CrossRef] [PubMed]
- Haider, Z.; Ali, T.; Ullah, A.; Basit, A.; Tahir, H.; Tariq, H.; Ilyas, S.Z.; Hayat, Z.; Rehman, S.-u. Isolation, toxinotyping and antimicrobial susceptibility testing of Clostridium perfringens isolated from Pakistan poultry. Anaerobe 2022, 73, 102499. [Google Scholar] [CrossRef] [PubMed]
- Mohiuddin, M.; Mudasser, H.; Zahid, I.; Iftikhar, H. Immune response of rabbits to hemorrhagic septicemia vaccine formulations adjuvanted with montanide isa-206, paraffin oil and alum. Asian J. Agric. Biol. 2014, 2, 161–167. [Google Scholar]
- Clark, D.P.; Pazdernik, N.J.; McGehee, M.R. Chapter 23—Plasmids. In Molecular Biology, 3rd ed.; Clark, D.P., Pazdernik, N.J., McGehee, M.R., Eds.; Elsevier (Academic Cell): Amsterdam, The Netherlands, 2019; pp. 712–748. [Google Scholar] [CrossRef]
- Martin, T.G.; Smyth, J.A. Prevalence of netB among some clinical isolates of Clostridium perfringens from animals in the United States. Vet. Microbiol. 2009, 136, 202–205. [Google Scholar] [CrossRef]
- Sarmah, H.; Hazarika, R.; Tamuly, S.; Deka, P.; Manoharan, S.; Sharma, R.K. Evaluation of different antigenic preparations against necrotic enteritis in broiler birds using a novel Clostridium perfringens type G strain. Anaerobe 2021, 70, 102377. [Google Scholar] [CrossRef]
- Keyburn, A.L.; Portela, R.W.; Ford, M.E.; Bannam, T.L.; Yan, X.X.; Rood, J.I.; Moore, R.J. Maternal immunization with vaccines containing recombinant NetB toxin partially protects progeny chickens from necrotic enteritis. Vet. Res. 2013, 44, 108. [Google Scholar] [CrossRef] [PubMed]
- Keyburn, A.L.; Yan, X.-X.; Bannam, T.L.; Van Immerseel, F.; Rood, J.I.; Moore, R.J. Association between avian necrotic enteritis and Clostridium perfringens strains expressing NetB toxin. Vet. Res. 2010, 41, 1–8. [Google Scholar] [CrossRef] [PubMed]
- To, H.; Suzuki, T.; Kawahara, F.; Uetsuka, K.; Nagai, S.; Nunoya, T. Experimental induction of necrotic enteritis in chickens by a netB-positive Japanese isolate of Clostridium perfringens. J. Vet. Med. Sci. 2017, 79, 350–358. [Google Scholar] [CrossRef] [PubMed]
- Abildgaard, L.; Sondergaard, T.E.; Engberg, R.M.; Schramm, A.; Højberg, O. In vitro production of necrotic enteritis toxin B, NetB, by netB-positive and netB-negative Clostridium perfringens originating from healthy and diseased broiler chickens. Vet. Microbiol. 2010, 144, 231–235. [Google Scholar] [CrossRef]
- Lu, M.; Li, R.W.; Zhao, H.; Yan, X.; Lillehoj, H.S.; Sun, Z.; Oh, S.; Wang, Y.; Li, C. Effects of Eimeria maxima and Clostridium perfringens infections on cecal microbial composition and the possible correlation with body weight gain in broiler chickens. Res. Vet. Sci. 2020, 132, 142–149. [Google Scholar] [CrossRef]
- Yang, W.-Y.; Lee, Y.-J.; Lu, H.-Y.; Branton, S.L.; Chou, C.-H.; Wang, C. The netB-positive Clostridium perfringens in the experimental induction of necrotic enteritis with or without predisposing factors. Poult. Sci. 2019, 98, 5297–5306. [Google Scholar] [CrossRef]
- Saleem, G. Necrotic Enteritis, Disease Induction, Predisposing Factors and Novel Biochemical Markers in Broilers Chickens. Ph.D. Thesis, University Of Glasgow, Glasgow, UK, 2013. [Google Scholar]
- Hargis, B. Overview of Necrotic Enteritis in Poultry. 2014. Available online: https://www.merckvetmanual.com/poultry/necrotic-enteritis/overview-of-necrotic-enteritis-in-poultry (accessed on 20 September 2022).
- Mwangi, S.; Timmons, J.; Fitz-Coy, S.; Parveen, S. Characterization of Clostridium perfringens recovered from broiler chicken affected by necrotic enteritis. Poult. Sci. 2019, 98, 128–135. [Google Scholar] [CrossRef]
- Udhayavel, S.; Ramasamy, G.T.; Gowthaman, V.; Malmarugan, S.; Senthilvel, K. Occurrence of Clostridium perfringens contamination in poultry feed ingredients: Isolation, identification and its antibiotic sensitivity pattern. Anim. Nutr. 2017, 3, 309–312. [Google Scholar] [CrossRef]
- Algammal, A.M.; Elfeil, W.M. PCR based detection of Alpha toxin gene in Clostridium perfringens strains isolated from diseased broiler chickens. Benha Vet. Med. J. 2015, 29, 333–338. [Google Scholar] [CrossRef]
- Gad, W.; Hauck, R.; Krüger, M.; Hafez, H. Determination of antibiotic sensitivities of Clostridium perfringens isolates from commercial turkeys in Germany in vitro. Arch. Für Geflügelkunde 2011, 75, 80–83. [Google Scholar]
- Agarwal, A.; Narang, G.; Rakha, N.; Mahajan, N.; Sharma, A. In vitro lecithinase activity and antibiogram of Clostridium perfringens isolated from broiler chickens. Haryana Vet. 2009, 48, 81–84. [Google Scholar]
- Mehtaz, S.; Borah, P.; Sharma, R.; Chakraborty, A. Antibiogram of Clostridium perfringens isolated from animals and foods. Indian Vet. J. 2013, 90, 54–56. [Google Scholar]
- Ibrahim, R.; Monazi, I.; Soliman, A. clostridial infection in chickens “studying the pathogenicity and evaluation of the effect of some growth promotors on broiler performance”. Assiut Vet. Med. J. 2001, 45, 253–267. [Google Scholar]
- Slavić, Đ.; Boerlin, P.; Fabri, M.; Klotins, K.C.; Zoethout, J.K.; Weir, P.E.; Bateman, D. Antimicrobial susceptibility of Clostridium perfringens isolates of bovine, chicken, porcine, and turkey origin from Ontario. Can. J. Vet. Res. 2011, 75, 89–97. [Google Scholar]
- Johansson, A.; Greko, C.; Engström, B.; Karlsson, M. Antimicrobial susceptibility of Swedish, Norwegian and Danish isolates of Clostridium perfringens from poultry, and distribution of tetracycline resistance genes. Vet. Microbiol. 2004, 99, 251–257. [Google Scholar] [CrossRef] [PubMed]
- Llanco, L.; Nakano, V.; Ferreira, A.; Avila-Campos, M. Toxinotyping and antimicrobial susceptibility of Clostridium perfringens isolated from broiler chickens with necrotic enteritis. Int. J. Microbiol. Res. 2012, 4, 290. [Google Scholar]
Toxin Genes | Primers | Primers Sequence (5′–3′) | Genbank Acc. Number | Fragment Size (bp) |
---|---|---|---|---|
CPA | CPA F | GATGGAAAAATTGATGGAAC | L43545 | 136 |
CPA R | CATGCATGTTCTCTTTTAAAAT | |||
CPB | CPB F | TATTCCTAAAAATACAATTTCTCA | KP064410 | 212 |
CPB R | CTGTAAATTTTGTATCCCATGA | |||
ITX | ITX F | CTAGCCCAAATTCTATATTTTTGTA | X73562 | 222 |
ITX R | GTTGGTAAAAGATGTGTTTTAATAG | |||
ETX | ETX F | TTAGTTTATCGGATACAGTAAAT | M95206 | 242 |
ETX R | ATAATCTTATTTTATTCCTGGTG | |||
TPEL | TPEL F | GCGATTATGAAACTATTATATGGTA | EU848493 | 168 |
TPEL R | TAACTTCCATTCTTTCTCTATA | |||
CPE | CPE F | GATAGCTTAGGAAATATTGATCAAG | X81849 | 217 |
CPE R | GTAAATTAAGCTTTTGAGTCCA | |||
NetB | NetB F | TGAGACTAAGGACGGTTATAATA | FJ189497 | 214 |
NetB R | TTGATATTCAACTATTATTACAGAT |
Group/s | No. of Chicks | Group Details | Dietary Factor Added (Day/s) | Coccidia Challenge Day/s | C. perfringens Challenge Day/s | Sampling Time (Day) |
---|---|---|---|---|---|---|
1 | 10 | F-E-ACP+ | - | - | 14, 15, 16, 17 | 20 |
2 | 10 | F-E-GCP+ | ||||
3 | 10 | F-E+CP- | 9 | - | ||
4 | 10 | F-E+ACP+ | 14, 15, 16, 17 | |||
5 | 10 | F-E+GCP+ | ||||
6 | 10 | F-E-CP- | - | - | ||
7 | 10 | F+E-ACP+ | 8–20 | 14, 15, 16, 17 | ||
8 | 10 | F+E-GCP+ | ||||
9 | 10 | F+E+CP- | 9 | - | ||
10 | 10 | F+E+ACP+ | 14, 15, 16, 17 | |||
11 | 10 | F+E+GCP+ | ||||
12 | 10 | F+E-CP- | - | - |
S.No | Inhibition Zone Diameter | Sensitivity |
---|---|---|
1. | <10 mm | Resistant (R) |
2. | 10~15 mm | Moderately sensitive (I) |
3. | >15 mm | Highly Sensitive (S) |
Sr. No | Samples (Location) | No. of Samples Collected | Samples Positive for C. perfringens | Positivity Rate for C. perfringens (%) |
---|---|---|---|---|
1. | Anhui | 50 | 10 | 20% |
2. | Guangdong | 56 | 11 | 19.6% |
3. | Fujian | 19 | 12 | 63.1% |
4. | Guangxi | 48 | 11 | 22.9% |
Total | 173 | 44 | 25.4% |
Groups | Chicks (No) | Lesion Score (No of Chicks) | Mean ± Standard Deviation | ||||||
---|---|---|---|---|---|---|---|---|---|
0+ | 1+ | 2+ | 3+ | 4+ | 5+ | 6+ | |||
G1(F-E-ACP+) | 10 | 3 | 2 | 5 | 0 | 0 | 0 | 0 | 1.5 ± 1.08 |
G2(F-E-GCP+) | 10 | 2 | 1 | 7 | 0 | 0 | 0 | 0 | 1.9 ± 1.10 |
G3(F-E+CP-) | 10 | 8 | 0 | 2 | 0 | 0 | 0 | 0 | 0.4 ± 0.85 |
G4(F-E+ACP+) | 10 | 2 | 0 | 2 | 6 | 0 | 0 | 0 | 2.2 ± 1.23 |
G5(F-E+GCP+) | 10 | 1 | 0 | 4 | 4 | 1 | 0 | 0 | 2.5 ± 1.08 |
G6(F-E-CP-) | 10 | 7 | 3 | 0 | 0 | 0 | 0 | 0 | 0.0 ± 0.0 |
G7(F+E-ACP+) | 10 | 2 | 0 | 4 | 4 | 0 | 0 | 0 | 2.0 ± 1.15 |
G8(F+E-GCP+) | 10 | 2 | 0 | 4 | 4 | 0 | 0 | 0 | 2.0 ± 1.15 |
G9(F+E+CP-) | 10 | 0 | 0 | 2 | 0 | 0 | 0 | 0 | 0.6 ± 0.97 |
G10(F+E+ACP+) | 10 | 1 | 0 | 0 | 6 | 3 | 0 | 0 | 3.0 ± 1.15 |
G11(F+E+GCP+) | 10 | 0 | 0 | 0 | 4 | 6 | 0 | 0 | 3.2 ± 1.22 |
G12(F+E-CP-) | 10 | 6 | 4 | 0 | 0 | 0 | 0 | 0 | 0.0 ± 0.0 |
C. perfringens | Strain D25 | Strain MZ1 | ||
---|---|---|---|---|
Antibiotics | Zone of Inhibition (mm) | Sensitivity | Zone of Inhibition (mm) | Sensitivity |
Kanamycin | 0 | R | 11 | I |
Polymyxin B | 0 | R | 0 | R |
Ceftriaxone | 15 | I | 16 | S |
Amoxicillin | 26 | S | 34 | S |
Tetracycline | 0 | R | 0 | R |
Amikacin | 0 | R | 0 | R |
Neomycin | 0 | R | 0 | R |
Penicillin | 24 | S | 28 | S |
Florfenicol | 0 | R | 16 | S |
Enrofloxacin | 16 | S | 19 | S |
Streptomycin | 0 | R | 0 | R |
Ampicillin | 25 | S | 26 | S |
Metronidazole | 0 | R | 0 | R |
Ciprofloxacin | 20 | S | 20 | S |
Gentamicin | 0 | R | 11 | I |
Cefotaxime | 22 | S | 20 | S |
Nystatin | 0 | R | 0 | R |
Ofloxacin | 22 | S | 20 | S |
Doxycycline | 0 | R | 0 | R |
Cephalexin | 11 | I | 11 | I |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mohiuddin, M.; Song, Z.; Liao, S.; Qi, N.; Li, J.; Lv, M.; Lin, X.; Cai, H.; Hu, J.; Liu, S.; et al. Animal Model Studies, Antibiotic Resistance and Toxin Gene Profile of NE Reproducing Clostridium perfringens Type A and Type G Strains Isolated from Commercial Poultry Farms in China. Microorganisms 2023, 11, 622. https://doi.org/10.3390/microorganisms11030622
Mohiuddin M, Song Z, Liao S, Qi N, Li J, Lv M, Lin X, Cai H, Hu J, Liu S, et al. Animal Model Studies, Antibiotic Resistance and Toxin Gene Profile of NE Reproducing Clostridium perfringens Type A and Type G Strains Isolated from Commercial Poultry Farms in China. Microorganisms. 2023; 11(3):622. https://doi.org/10.3390/microorganisms11030622
Chicago/Turabian StyleMohiuddin, Mudassar, Zhongfeng Song, Shenquan Liao, Nanshan Qi, Juan Li, Minna Lv, Xuhui Lin, Haiming Cai, Junjing Hu, Shaobing Liu, and et al. 2023. "Animal Model Studies, Antibiotic Resistance and Toxin Gene Profile of NE Reproducing Clostridium perfringens Type A and Type G Strains Isolated from Commercial Poultry Farms in China" Microorganisms 11, no. 3: 622. https://doi.org/10.3390/microorganisms11030622
APA StyleMohiuddin, M., Song, Z., Liao, S., Qi, N., Li, J., Lv, M., Lin, X., Cai, H., Hu, J., Liu, S., Zhang, J., Gu, Y., & Sun, M. (2023). Animal Model Studies, Antibiotic Resistance and Toxin Gene Profile of NE Reproducing Clostridium perfringens Type A and Type G Strains Isolated from Commercial Poultry Farms in China. Microorganisms, 11(3), 622. https://doi.org/10.3390/microorganisms11030622