Next Article in Journal
Multicentre Surveillance of Candida Species from Blood Cultures during the SARS-CoV-2 Pandemic in Southern Europe (CANCoVEU Project)
Previous Article in Journal
Biosynthesis of Novel Tellurium Nanorods by Gayadomonas sp. TNPM15 Isolated from Mangrove Sediments and Assessment of Their Impact on Spore Germination and Ultrastructure of Phytopathogenic Fungi
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Screening and Identification of Coastal Chilean Thraustochytrids for Arachidonic Acid Production: Biotechnological Potential of Ulkenia visurgensis Lng2-Strain

by
Cinthia Vasquez-Sandoval
1,
José Navarrete
1,
Paula Herrera-Herrera
1,
Patricio Dantagnan
2,
Paola Diaz-Navarrete
2,
Patricia Arancibia-Avila
3 and
Claudia Oviedo
4,*
1
Laboratorio de Bioprocesos y Biotratamientos, Departamento de Ingeniería en Maderas, Facultad de Ingeniería, Universidad del Bío-Bío, Concepción 4081112, Chile
2
Departamento de Ciencia Agropecuarias y Acuícolas, Núcleo de Investigación en Producción Alimentaria y Facultad de Recursos Naturales, Universidad Católica de Temuco, Temuco 4810302, Chile
3
Laboratorio de Ecofisiología y Microalgas, Departamento de Ciencias Básicas, Facultad de Ciencias, Universidad del Bío-Bío, Chillán 3800708, Chile
4
Departamento de Química, Facultad de Ciencias, Universidad del Bío-Bío, Concepción 4081112, Chile
*
Author to whom correspondence should be addressed.
Microorganisms 2023, 11(3), 559; https://doi.org/10.3390/microorganisms11030559
Submission received: 19 January 2023 / Revised: 14 February 2023 / Accepted: 15 February 2023 / Published: 22 February 2023
(This article belongs to the Section Microbial Biotechnology)

Abstract

:
Thraustochytrids are unicellular heterotrophic marine protists that have been described as producing a high content of polyunsaturated fatty acids (PUFAs). Among them, arachidonic acid (ARA) stands out as a precursor of several mediators of pivotal importance for the immune system. However, the biotechnological potential of thraustochytrids for ARA production has not been developed. The objective of this study is to isolate and identify native strains from different Chilean coastal environments and evaluate in vitro the effect of culture parameters such as C/N ratio (19 and 33) and temperature (15 °C and 23 °C) on biomass production and arachidonic acid content. A total of nine strains were identified and classified into four genera of the Thraustochitridae family. The Lng2 strain with 99% identity belongs to the species Ulkenia visurgenis and was the most prominent one for ARA production. Temperature had an effect on the PUFA profile but not on the ARA content nor on the biomass yield. Additionally, the C/N ratio has been identified as a key parameter. The ARA productivity increased by 92% (from 0.6 to 8.3 ARA mg/g-DW) and its total biomass by 62.7% (from 1.9 to 5.1 g/L) at a high C/N ratio (33) as compared to the control.

1. Introduction

Thraustochytrids are unicellular heterotrophic marine protists widely distributed in marine and estuarine ecosystems and frequently associated with organic material in decay [1,2]. Currently, there are nine genera of the family Thraustochytriidae: Thraustochytrium, Japonochytrium Schizochytrium, Ulkenia, Aurantiochytrium, Sicyoidochytrium, Parietichytrium, Botryochytrium, and Monorhizochytrium and they are classified according to their morphological characteristics, ultrastructure, life cycles, and biochemical markers [1]. These microorganisms have been characterized as oleaginous since they use two independent routes for fatty acid synthesis: A standard pathway (aerobic) for the production of saturated fatty acids; and a polyketide synthase-like synthase pathway (anaerobic) to synthesize the very long chain unsaturated fatty acids PUFAs (VLCPUFAs) such as DHA (22:6n-3) and arachidonic acid (ARA) (20:4n-6) [1,3,4,5,6,7,8,9,10].
PUFAs are necessary as nutrients for human and animal health, growth, and development [11,12]. Two families represent these PUFAs: n-6 (u ω-6) and n-3 (u ω-3), which are biosynthesized from linoleic acid and linolenic acid, respectively; humans cannot synthesize the latter; therefore, they must be incorporated through diet [11,12,13,14]. Among the ω-6 series, ARA stands out as one of the cell membrane phospholipids, esterified in the Sn-2 position. Free ARA, catalyzed by a phospholipase, is a precursor of various physiological mediators involved in inflammatory responses such as prostaglandins and thromboxanes [15].
ARA and DHA are fundamental in the formation of the structural genesis and functionality of the human nervous and visual systems and act as neuroprotective agents against degenerative diseases such as Parkinson’s and Alzheimer’s [16,17,18,19]. Both fatty acids constitute more than 30% of the lipid structure of the brain and of the retinal rods and cones [11]. In addition, ARA regulates electrical activity in the brain, muscles, and heart by acting on voltage-gated ion channels [11,14]. The FAO recommends an additional intake of ARA and DHA in premature infants, without breastfeeding, to improve the growth and development of the central nervous system and retina [11,12]. Poor intake of ARA can cause hair loss, fatty liver, anemia, and reduced fertility in adults [11,13]. In fish feed, studies reveal important and diverse roles of ARA in various physiological and nutritional processes [20,21,22]. For example, the inclusion of ARA and vitamin E in the diet of the Atlantic salmon (Salmo salar) can improve the indicators of nonspecific immunity, leucocyte respiratory burst, lysozyme activity, and reduction of cumulative mortality [23].
Initially, some oleaginous plants were considered as sustainable sources in the production of PUFAs, especially the linoleic precursor. However, their use is limited, since genetic engineering is necessary to obtain modified plants that produce fatty acids in commercial quantities [24]. Microorganisms have also been described for PUFAs production such as bacteria, filamentous fungi, microalgae, and heterotrophic protists [25,26,27,28].
In the Mortierella alpina fungus, the ARA is 80% with respect to the total lipids, but it requires long culture periods, i.e., two weeks, to reach this value [29,30,31]. Bacterial strains Shwenella sp. and Colwellia sp. have also been described as producing DHA and EPA. However, they are not considered viable for commercial production since they have a lower accumulation of PUFAs with respect to total lipids (2–5%) [27,32]. Other candidates are autotrophic microalgae. Parietochloris incisa and Porphyridium purpureum stand out, the latter, red unicellular microalgae, under stress conditions (of light intensity, pH, temperature, salinity, and nutrient deficiency) can reach 40% ARA of total fatty acids [33,34]. However, its large-scale commercialization is limited by its autotrophic metabolism, which implies low accessibility of cells to light when there is high cell density, evaporation problems, and the use of large extensions of land for its cultivation [35,36].
Reports on ARA abundance with respect to their total fatty acid profile are limited for heterotrophic protists. There are data available on Schizochytrium sp. and Crypthecodinium cohnii (C. cohnii ATCC 50060), both with 2.2% as can be inferred from Ganuza [37]. In the Ulkenia sp. KF13 strain, it is 1.7% [38] and in Thraustochytriidae sp. AS4-A1, it is 6.2% [39]. However, these microorganisms have the natural ability to accumulate a high content of lipids, which can be increased by optimizing key factors in culture [40,41,42,43,44]. In this context, and in an effort aimed at identifying new sources of ARA, heterotrophic microorganisms of the Thraustochytriaceae family are becoming relevant.
Nutritional and environmental conditions have an important effect on the total lipid content and on its PUFA fraction in thraustochytrids. An important role of parameters such as C/N ratio and temperature has been described [43,44,45,46,47]. Indeed, N deficiency in the culture medium would inhibit cell division; hence, the C flow is directed towards lipid production [43]. On the other hand, temperature affects cell growth and PUFA composition of most microorganisms [45,46]. Hence, under low temperature conditions, more ARA and DHA are synthesized and incorporated into the membrane to maintain its fluidity and permeability [43,44,45].
Considering the biotechnological potential of thraustochytridiae in the production of ARA, studies that undertake the search for ARA-producing strains are needed. Accordingly, the objective of this work was to isolate and identify thraustochytrids from different Chilean estuarine and coastal environments, evaluating in vitro their ARA production and studying the effect of culture parameters such as C/N ratio and temperature on biomass production and ARA content.

2. Materials and Methods

2.1. Isolation and Culture Conditions

Marine samples were collected from five different Chilean coastal sites and habitats. Samples were obtained from the water column (15–20 cm depth) or sediment. A sampling sites map was constructed using the Google Maps platform (Figure 1). For thraustochytrids isolation, the pollen technique was performed [48]. The presence of thraustochytrids adhered to pine pollen was verified by optical microscopy. Subsequently, samples were filtered (nylon filter, 20 μm) and cultivated on solid culture medium 790 (yeast extract 1 g/L, peptone 1 g/L, glucose 5 g/L, and agar 15 g/L) prepared in diluted artificial seawater (NaCl 27.12 g/L, MgCl2 × 6H2O 5.23 g/L, MgSO4 × 7H2O 6.77 g/L, CaCl2 × H2O 0.15 g/L, KCl 0.725 g/L, and NaHCO3 0.202 g/L) and a final concentration of 0.3 g/L of streptomycin and penicillin G (Sigma Aldrich Co., Steinheim, Germany). Incubation was performed at 22 °C for 5 to 7 days. Selected colonies were subcultured in liquid 790.

2.2. DNA Extraction and PCR Assays

Freeze-dried biomass from pure cultures was resuspended with a lysis buffer (200 μL; 0.25 M Tris-Cl; 0.1 M Na2-EDTA; 2% w/v SDS; 0.1 M NaCl at pH 8.2). DNA was extracted with phenol/chloroform/isoamyl alcohol cold (4 °C) and precipitated with cold ethanol (70%, 4 °C). For molecular identification, partial regions of the 18S rRNA gene were amplified by PCR using a master mix reaction (Buffer 5 µL; dNTPs 1 µL; MgCL2 (50 mM) 1.5 µL; ADN 5 µL; Taq 0.2 µL) and two pairs of specific primers [49,50,51] (18S001′5 AACCTGGTTGATCCTGCCAGTA 3′, 18S13′ 5CCTTGTTACGACTTCACCTTCCTCT 3′ and FA2′ 5 GTCTGGTGCCAGCAGCCGCG 3′, RA3 CAATCGGTAGGTGCGACGGGCGG). The cyclic amplification program was: 3 min denaturation at 95 °C, 35 cycles of 1 min amplification at 94 °C, 1 min at 50 °C, and 1 min at 72 °C, with 10 min extension for the elongation stage. The PCR products were visualized on a 2% green agarose gel.
The obtained sequences were compared with those available in the Genbank database (National Center for Biotechnology Information, USA: NCBI Home page http://www.ncbi accessed on 10 October 2021). The search for the most related homologous sequences was performed using the BLAST program available on the NCBI web server.
Taxonomic evaluation, DNA alignment, and interpretation of sequences were performed by using Geneious Prime software [52]. BLAST was performed against the GenBank database. Representative sequences alignment was done by using MUSCLE [53]. Jmodeltest 2.1.10 [54] software was used for the alignment best-fit model of nucleotide substitution selection. Phylogenetic reconstruction was done by using Bayesian inference (BI) method in MrBayes 3.2.6 [55] geneious plugin.

2.3. Screening for High ARA-Producing Strains and Total Biomass Assessment

Pure strains obtained in 2.2 were cultivated in triplicate, in 100 mL 790-liquid medium using 250 mL flasks, at 20 °C and 120 rpm for 7 days. To determine the final biomass resulting from each cultivated strain, the biomass was washed thrice, centrifuged at 1798 rcf for 5 min, and finally, the biomass was lyophilized, and dry weight (DW) was determined gravimetrically.
For the extraction of total lipids, Folch’s method [56] was applied. Each sample was homogenized in a chloroform/methanol (2:1, v/v) mixture, then centrifuged at 1614 rcf in a refrigerated centrifuge (Ependorf, model 4303), to separate the water-soluble and organic phases. The organic phase was then separated, and the chloroform was evaporated using a mini-evaporator. The amount of total lipids present in each sample was expressed as a percentage of its dry weight. Fatty acids methyl esters (FAME) were prepared from the extracted lipids according to Morrison and Smith (1964) [57].
Fatty acids were separated in a gas chromatograph (Hewlett Packard 6890 series II Plus, Wilmington, NC, USA) using a 30 m × 0.25 mm × 0.20 µm capillary column SPTM 2380 (Supelco, Bellefonte, PA, USA). Helium was used as a carrier gas. FAME was analyzed by comparison with a well characterized standard such as SUPELCOTM 37 component FAME Mix (Sigma-Aldrich, St. Louis, MO, USA). Fatty acids were expressed as percentage of total identified FAME. The productivity of ARA, EPA, and DHA were expressed in mg/dry biomass.

2.4. Temperature Effect on Growth Curve and Glucose Consumption

The highest ARA-producing strains detected in 2.3, i.e., ARA mg /biomass g-DW were cultivated at different temperatures (15 °C and 23 °C) for 5.5 days at 120 rpm. Biomass was estimated in triplicate, initially every 3 h and then every 12 h, by cell DW as follows: Cell cultures were harvested, centrifuged (1798 rcf for 5 min), washed (three times) with distilled water, and subsequently lyophilized for gravimetric determination. Glucose consumption was estimated spectrophotometrically at the same time intervals as biomass, using a commercial SPINREACT Kit (Glucose-LQ).

2.5. C/N Ratio Effect on Productivity de ARA

To evaluate the effect of C/N ratio on ARA production, batch fermentations were performed using the selected Ulkenia visurgensis (Leng2 strain).
An accurate determination of C and N content present in the reagents used was performed by elemental analysis Thermo Scientific (FlashSmart™ Elemental Analyzer) at Universidad Católica de Temuco (Table 1).
While preparing the culture media, the C/N ratio was modified by altering the content of the main carbon source (glucose from 10 to 40 g/L) and the content of Peptone (from 2 to 4 g/L) and yeast extract (from 1 to 2 g/L).
The C/N ratio of each medium, control (15), C/N 19 (1), and C/N 33 (2), was calculated considering the amount of carbon and nitrogen provided by the reagents: glucose, peptone, and yeast extract. The experiments were performed in triplicate and cultured for 5 days with orbital agitation (120 rpm) at 23 °C.
The C/N ratio of each medium, listed in Table 1, was calculated by the amount of carbon and nitrogen provided by glucose, peptone, and yeast extract. The experiments were performed in triplicate and cultured for 5 days with orbital agitation (120 rpm) at 23 °C.

2.6. Statistical Analysis

Statistical analyses (ANOVA and Student’s t-test) were performed using the MATLAB program (R2019b, The MathWorks Inc., Natick, MA, USA; 2018) to compare biomass and ARA yield obtained in the native strains and the treatments with C/N ratio in the Lng2 strain, respectively. A significance level of 95% (p < 0.05) was used to determine significant differences.

3. Results

3.1. Morphological Characteristics and Genetic Identification

Using the pine pollen technique, nine strains (Table 2) were obtained from diverse Chilean coastal environments (Figure 1). Through the partial amplification of the 18S rRNA gene, it was possible to identify four genera of thraustochytrids: Ulkenia sp: strains Quint1, LNO, and PtoM (GenBank accession numbers|AB810968.1|), U. visurgensis; strain Lng2 (GenBank accession numbers|HQ228958.1|), Thraustochytrium sp.; strains Lng1, Lng3, Pich3 and Pich4 (GenBank accession numbers|HQ228958.1|), and Botryochytrium sp.; strain Lng6 (GenBank accession numbers|AB973506.1|) (Table 2). All strains exhibit a high identity over 99% with the correspondent sequences stored in GenBank, thus confirming the taxonomic classification within the Thraustrochytriidae Family.
Under microscopic observation, the strain Lng2 (U. visurgensis) presents a spherical shape with mature sporangia containing zoospores (Figure 2). The comparison of the 18S rRNA gene shows that the Lng2 strain exhibits a common ancestor, with two strains; Ulkenia aff visurgensis BAFCult 3541 (HQ228980) and Ulkenia aff visurgensis BAFCult 3529 (HQ228958), with a bootstrap value of 0.99 and 0.94, respectively (Figure 3). The 18S rRNA partial sequence of strain Lng2 are available in GenBank (accession number: OM228767) (Figure 3).

3.1.1. Screening for High ARA-Producing Strains

The productivity of ARA, EPA, and DHA in mg/biomass g-DW and their respective percentages (related to their total lipids) was determined in all the native strains isolates (Table 3). ARA was detected in the nine identified strains with percentages of total lipids from a minimum of 2.59% to a maximum of 9.31% in the Pch3 and LNO strains, respectively. The maximum cellular biomass (DW) corresponds to the Lng3 strain with 1.12 g-DW/L. However, its percentage of ARA (2.97%) is low, limiting its biotechnological potential. On the other hand, the Lng2 strain isolated from an estuarine zone, with 5.44% of ARA has the highest productivity (5.81 ARA mg/ biomass g DW); although its biomass is low (0.45 g/L), its DHA percentage levels (44.78%), EPA (16.26%), and total lipids (10.68%) are remarkably high compared to the other strains. Based on Lng2 (U. visurgensis) high PUFAs productivity including ARA, the culture parameters were assayed for that strain by evaluating the effect of temperature and the C/N ratio on the productivity of ARA and cell biomass.
Figure 4 shows the total biomass growth kinetics of Lng2 strain during a 5.5 d (132 h) culture at two temperatures (15 and 23 °C) and its respective glucose consumption. Lng2 grew faster at 23 °C than at 15 °C. The exponential growth 3–5 d (72–120 h) and the stationary phase (from 5 d onwards) occurred at the same intervals for both temperatures. At 23 °C, the maximum biomass was obtained at 1.723 g-DW/L at 120 h. Additionally, in relation to glucose, it was observed that the remaining substrate is 1.04 g glucose/L at 23 °C (132 h). However, at 15 °C and similar culture hours, the value is three times higher than in the higher temperature (3.44 g glucose/L), which is an interesting trait for industrial scaling prospects.
The effect of temperature (15 °C and 23 °C) on the fatty acid profile and yield of ARA was evaluated during the exponential phase (from 3 d) and at the beginning of the stationary phase (5 d) (Table 4). The maximum biomass is 1.46 g-DW/L (exponential phase) and the minimum is 1.09 g-DW/L (stationary phase), both at 23 °C. The maximum yield of ARA (mg/biomass g DW) is at 3.87 (15 °C) and the minimum is at 1.88 (23 °C), both in the exponential phase.
Lower temperature does affect the profile of fatty acids, mainly PUFAs. At 15 °C, the total percentage of ARA in the biomass is 47.1% higher than the culture at 23 °C (3.99 and 1.88%, respectively) during the exponential phase (Table 4). In addition, PUFAs represent 44% of the total fatty acids at the same temperature and cultivated period.

3.1.2. Evaluation of C/N Ratio on the Productivity of ARA

Figure 5 describes the important effect that the C/N ratio has on cell biomass and ARA productivity. At a C/N ratio of 19, the biomass increases from 1.9 g-DW /L (control) to 4.4 g-DW/L (i.e., a 56.8% increase). However, this value is even higher at a C/N ratio of 33 with final biomass of 5.3 g-DW/L, i.e., 64.1% more than the control. Additionally, the highest productivity of ARA also corresponds to this last C/N ratio of 33 with 8.3 ARA mg/biomass g-DW, which is the highest ARA yield found in this study.
Figure 6 shows the distribution of fatty acids with respect to the carbon and nitrogen ratio present in the culture medium. Saturated fatty acids predominate in the C/N ratios of 19 and 33 with percentages of 50.3% and 55.6%, respectively. Additionally, PUFAs are the second most important group of total lipids, their values are 44.1% for the control strain and 43.1% at C/N ratio of 19 and 32.2 for the C/N ratio of 33. The C/N ratio has an important effect on the total lipids (%). This value increase from 1.5% to 27.5% and 27.6% in a C/N ratio of 19 and 33, respectively, was achieved, i.e., 94.6% more than the control. Although an increase of 1.7-fold of the C/N ratio does not affect the proportion of total lipids, it triggers a high ARA yield (Figure 5B).

3.1.3. Effect of Culture Conditions on Cell Biomass and ARA Yields

Among all the identified native strains, non-significant differences between their total biomass yields were found. The same trend was observed for the ARA yields among these native strains, where non-significant differences were found (ANOVA, p > 0.05) (Table 3).
Temperature had a non-significant effect on the LNG2 strain cultures (Table 4. ANOVA, p > 0.05), whereas the two C/N ratios assayed had a significant effect as compared to the control, on the LNG2 strain cultures (Figure 5 Student’s test, p < 0.05).

4. Discussion

4.1. Morphological Characteristics and Genetic Identification

The literature describes a wide geographical distribution of thraustochytrids and highlights their versatility to adapt to various marine environments with particular characteristics of temperature, light, and suspended decomposing material [1,3,38]. In this study, samples of thraustochytrids were isolated from coastal environments along Chile. The genus Ulkenia sp. was the most frequently identified. Thraustochytrids have been reported in mangroves [58,59] whose intertidal zones are exposed to freshwater courses. Interestingly, three genera of thraustochytrids (Thraustochytrium sp., U. visurgensis, and Botryochytrium sp.) were identified in the Lenga estuary, whose salinity fluctuates due to freshwater inflows from a river. Additionally, to our knowledge, this research reports the genus Botryochytrium sp. for the first time in Chile [6,7,39,60].

4.2. Biomass and Yield in Strain Natives

The Lng2 native strain of the genus U. visugensis has a 5.44% ARA content out of the total lipids and its yield is 5.81 ARA mg/ biomass g-DW (Table 2). These values are significant as compared to the ones reported of strains isolated from an estuary and cultivated in an optimized medium (composed of 1 g peptone, 1 g yeast extract, 20 g glucose, 1 L seawater, 25 °C) where the yields for S. mangrovei strains I AO-1 and IXm-6, Schizochitryum sp. strain BSn-1 and Thraustrochytrium sp. strain Ira-8 are 0.9, 0.4, 0.7, and 5.5 ARA mg/biomass g-DW, respectively [61]. The latter reported yields are lower than the ones obtained from the native Lng2 strain cultivated in a non-optimized medium in this research.

4.3. Evaluation of the Effect of Temperature on Strain Lng2 (U.visurgensis)

Temperature is one of the most important environmental factors affecting growth rate. Low temperatures inhibit cell development but stimulate the synthesis of fatty acids, mainly PUFAs [28,45]. For example, the biomass in Aurantiochytrium sp. strain mh0186 grown at 10 °C (0.6 g-DW/L) was considerably lower than at 15 °C (6.7 g-DW/L). However, the percentage of DHA increased from 59% to 75% (total lipids basis) when the temperature dropped from 15 °C to 10 °C [62]. A proteomics study indicates that cold stress inhibits the supply of cellular energy by glycolysis and the Krebs cycle, which could explain the low biomass yields [63]. However, in this study, a greater temperature difference (23 °C and 15 °C) did not significantly affect the cell biomass yield of Lng2 strain (always over 1 g-DW/L) (Table 4). In general, this yield fits in the usual range reported for batch cultures in thraustochytrids (from 0.5 to 2.3 g-DW/L) [6]. A feasible explanation for the non-significant effect of temperature on biomass yields found in the Lng2 strain could be related to the estuarine origin of that strain (Table 2). As an estuary is a dynamic ecosystem, its marine population is constantly subjected to physicochemical changes [64]. These adaptability traits [65,66] could account for the behavior of the Lng2 strain (isolated from an estuary) whose biomass yield is not affected by the assayed temperatures. Therefore, similar biomass yields are obtained regardless of whether it is cultivated at 15 °C or 23 °C (Table 4). On the other hand, in the Lng2 strain, low temperatures stimulate the synthesis of PUFAS and increase its ARA content as well, with differences of 23% (from 15 °C to 23 °C) and 53% (from 15 °C to 23 °C), respectively, at the exponential phase. These results are in accordance with previous reports [62,67,68]. These changes are associated with membrane integrity and functional maintenance. ARA and DHA are incorporated into the membrane to preserve its fluidity and permeability [11,45,46]. On the other hand, the yield of ARA is similar at both culture temperatures assayed (Table 4). The plasticity of the strain to adapt to low temperatures without slowing down its cell biomass yield hints at the potential of the Lng2 strain for both ARA and PUFAs production in industrial-scale fermentation.

4.4. Evaluation the Reason C/N in the Biomass and Yield of ARA in Strain Lng2 (U. visurgensis)

Nutrients such as carbon and nitrogen are key in the cellular development of thraustochytrids. Our results confirm that the concentration of glucose (from 5 g-DW/L to 40 g-DW/L) as a carbon source directly affects the increase in its total biomass (i.e., 62.7% with respect to the control). Previous studies [7] with the strain T. areum ATCC 34304 obtained an increase of 13.8% when glucose was added to the culture medium (from 5 to 20 g-DW/L). Accordingly, the yield of ARA had a significant increase at a higher concentration of glucose in culture reaching up to 8.3 ARA mg/biomass g-DW, i.e., 92.8% with respect to the control in just 3 days. Other studies on the microalga Porphyridium purpureum obtained yields of 10.87 and 10.61 ARA mg/biomass g-DW after 18 days of culture, by adding NaCO3 and 5-ALA, respectively, hence obtaining an increase of 11% and 16.1% with respect to the control conditions [69].
The results obtained in this study indicate that the C/N ratio has a significant effect on ARA yield and final biomass. However, excess carbon leads to the synthesis of saturated lipids and to an inhibition of the synthesis of membrane-associated PUFAs [70]. Similar results were observed in this research at a high C/N ratio (33) as the percentage of saturated fatty acids was 9.5% higher than the control and 25.6% lower in PUFAs content. However, there was an increase in total lipids of 94.5% with respect to control conditions (Figure 6). It is necessary in future studies to accurately determine the N concentration required by the Lng2 strain in order to optimize ARA synthesis.
Thraustochytrids are fast-growing heterotrophic organisms that can use alternative and low-cost carbon sources for cultivation, for example, lignocellulosic biomass [47] and waste from pig industries [71]. This nutritional plasticity allows efficient use of resources and decreases the costs associated with production, and desired characteristics in a strain with commercial potential [72,73,74,75]. The increase in ARA productivity in the Lng2 U. visurgensis strain mediated by nutritional variation is a key factor to be considered for future studies by optimizing the culture medium. In all, the results found in this study highlight the Lng2 strain as a potential candidate for ARA production.

5. Conclusions

A total of nine strains collected in diverse coastal Chilean environments were isolated and successfully maintained in laboratory conditions. They were classified into four genera corresponding to the thraustochitridae family; Thraustochytrium sp., U. visurgensis, Botryochytrium sp., and Ulkenia sp.
The Lng2 strain was identified as U. visurgensis with a 99.43% identity. Their sequences were included in the GenBank database (number access: OM228767.1). An initial screening singled out the Lng2 strain (U. visurgensis) as the most promising one for ARA production. Results derived from the temperature effect (15 °C and 23 °C) indicate that this factor affects the PUFA profile but not the ARA content nor the biomass yield.
The proportion of nutrients (carbon and nitrogen) is a key parameter for the Lng2 strain. The productivity of ARA increased by 92% (from 0.6 to 8.3 ARA mg/g-DW) and its total biomass by 62.7% (from 1.9 to 5.1 g/L) at a high C/N ratio (33) as compared to control. This research provides evidence of the potential of Lng2 strain for ARA production.

Author Contributions

Conceptualization of project, J.N., P.D. and C.V.-S.; methodology, P.H.-H., P.D., P.D.-N., P.A.-A., J.N. and C.V.-S.; project funding, J.N. and P.D.; formal analysis, C.O. and C.V.-S.; writing—original draft preparation, C.V.-S.; writing—review and editing, C.O. This research is part of the thesis dissertation of C.V.-S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by CONICYT+ FONDEF/CONCURSO IDeA I+D FONDEF/CONICYT 2019 + ID18I10364.

Data Availability Statement

Partial 18S gene sequencing strain Lng2 GenBank (accession number: OM228767).

Acknowledgments

The authors would like to acknowledge the biodeterioration laboratory, University of Bío Bío, for lending their laboratories and equipment. The authors would also like to thank the University of Bio Bio for the Doctoral Scholarship and Research Grant Decree. The authors are grateful to the aerospace engineer Matías Yañez who kindly helped construct the graphics of the sampling sites map.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Marchan, L.F.; Chang, K.J.L.; Nichols, P.D.; Mitchell, W.J.; Polglase, J.L.; Gutierrez, T. Taxonomy, ecology and biotechnological applications of thraustochytrids: A review. Biotechnol. Adv. 2018, 36, 26–46. [Google Scholar] [CrossRef]
  2. Leyland, B.; Leu, S.; Boussiba, S. Are Thraustochytrids algae? Fungal Biol. 2017, 121, 835–840. [Google Scholar] [CrossRef]
  3. Aasen, I.M.; Ertesvåg, H.; Heggeset, T.M.; Liu, B.; Brautaset, T.; Vadstein, O.; Ellingsen, T.E. Thraustochytrids as production organisms for docosahexaenoic acid (DHA), squalene, and carotenoids. Appl. Microbiol. Biotechnol. 2016, 100, 4309–4321. [Google Scholar] [CrossRef]
  4. Qiu, X. Biosynthesis of docosahexaenoic acid (DHA, 22:6-4, 7,10,13,16,19): Two distinct pathways. Prostaglandins Leukot. Essent. Fat. Acids 2003, 68, 181–186. [Google Scholar] [CrossRef]
  5. Sun, X.M.; Ren, L.J.; Ji, X.J.; Chen, S.L.; Guo, D.S.; Huang, H. Adaptive evolution of Schizochytrium sp. by continuous high oxygen stimulations to enhance docosahexaenoic acid synthesis. Bioresour. Technol. 2016, 211, 374–381. [Google Scholar] [CrossRef]
  6. Caamaño, E.; Loperena, L.; Hinzpeter, I.; Pradel, P.; Gordillo, F.; Corsini, G.; Tello, M.; Lavín, P.; González, A.R. Isolation and molecular characterization of Thraustochytrium strain isolated from Antarctic Peninsula and its biotechnological potential in the production of fatty acids. Braz. J. Microbiol. 2017, 48, 671–679. [Google Scholar] [CrossRef]
  7. Shene, C.; Leyton, A.; Esparza, Y.; Flores, L.; Quilodrán, B.; Hinzpeter, I.; Rubilar, M. Microbial oils and fatty acids: Effect of carbon source on docosahexaenoic acid (C22:6 n-3,DHA) production by thraustochytrid strains. J. Soil Sci. Plant Nutr. 2010, 10, 207–216. [Google Scholar] [CrossRef]
  8. Qiu, X.; Hong, H.; MacKenzie, S.L. Identification of a Δ4 fatty acid desaturase from Thraustochytrium sp. involved in the biosynthesis of docosahexaenoic acid by heterologous expression in Saccharomyces cerevisiae and Brassica juncea. J. Biol. Chem. 2001, 276, 31561–31566. [Google Scholar] [CrossRef]
  9. Schmidt, E.B.; Christensen, J.H.; Aardestrup, I.; Madsen, T.; Riahi, S.; Hansen, V.E. Marine n-3 fatty acids: Basic features and background. Lipids 2001, 36, S65–S68. [Google Scholar] [CrossRef]
  10. Ma, W.; Liu, M.; Zhang, Z.; Xu, Y.; Huang, P.; Guo, D.; Sun, X.; Huang, H. Efficient co-production of EPA and DHA by Schizochytrium sp. via regulation of the polyketide synthase pathway. Commun. Biol. 2022, 5, 1356. [Google Scholar] [CrossRef]
  11. Valenzuela, B.A.; Nieto, K.S. Ácidos grasos omega-6 y omega-3 en la nutrición perinatal: Su importancia en el desarrollo del sistema nervioso y visual. Rev. Chil. Pediatría 2003, 74, 149–157. [Google Scholar] [CrossRef]
  12. Wendel, K.; Aas, M.F.; Gunnarsdottir, G.; Rossholt, M.E.; Bratlie, M.; Nordvik, T.; Landsend, E.C.S.; Fugelseth, D.; Domellöf, M.; Pripp, A.H.; et al. Effect of arachidonic and docosahexaenoic acid supplementation on respiratory outcomes and neonatal morbidities in preterm infants. Clin. Nutr. 2023, 42, 22–28. [Google Scholar] [CrossRef]
  13. Hansen, J.; Schade, D.; Harris, C.; Merkel, K.; Adamkin, D. Docosahexaenoic acid plus arachidonic acid enhance preterm infant growth. Prostaglandins Leukot. Essent. Fat. Acids 1997, 57, 196. [Google Scholar]
  14. Clandinin, M.T.; van Aerde, J.E.; Merkel, K.L.; Harris, C.L.; Springer, M.A.; Hansen, J.W.; Diersen-Schade, D.A. Growth and development of preterm infants fed infant formulas containing docosahexaenoic acid and arachidonic acid. J. Pediatr. 2005, 146, 461–468. [Google Scholar] [CrossRef]
  15. Brenna, J.T.; Diau, G.Y. The influence of dietary docosahexaenoic acid and arachidonic acid on central nervous system polyunsaturated fatty acid composition. Prostaglandins Leukot. Essent. Fat. Acids 2007, 77, 247–250. [Google Scholar] [CrossRef]
  16. Orellana, P.; Valenzuela, R.; Valenzuela, A.; Morales, G.I. Efectos neuroprotectores del ácido araquidónico y del ácido docosahexaenoico en las etapas extremas de la vida: Una visión integradora. Rev. Chil. Nutr. 2018, 45, 80–88. [Google Scholar] [CrossRef]
  17. Kinsella, J.E.; Lokesh, B.; Broughton, S.; Whelan, J. Dietary polyunsaturated fatty acids and eicosanoids: Potential effects on the modulation of inflammatory and immune cells: An overview. Nutrition 1990, 6, 2415. [Google Scholar]
  18. Hallahan, B.; Garland, M.R. Essential fatty acids and mental health. Br. J. Psychiatry 2005, 186, 275–277. [Google Scholar] [CrossRef]
  19. Valenzuela, R.; Sanhueza, J.; Valenzuela, A. Docosahexaenoic Acid (DHA), an Important Fatty Acid in Aging and the Protection of Neurodegenerative Diseases. J. Nutr. Ther. 2012, 1, 63–72. [Google Scholar] [CrossRef]
  20. Xu, H.; Meng, X.; Wei, Y.; Ma, Q.; Liang, M.; Turchini, G.M. Arachidonic acid matters. Rev. Aquac. 2022, 14, 1912–1944. [Google Scholar] [CrossRef]
  21. Araújo, B.C.; Skrzynska, A.K.; Marques, V.H.; Tinajero, A.; del Rio-Zaragoza, O.B.; Viana, M.T.; Mata-Sotres, J.A. Dietary Arachidonic Acid (20:4n-6) Levels and Its Effect on Growth Performance, Fatty Acid Profile, Gene Expression for Lipid Metabolism, and Health Status of Juvenile California Yellowtail (Seriola dorsalis). Fishes 2022, 7, 185. [Google Scholar] [CrossRef]
  22. Li, C.; Xing, X.; Qi, H.; Liu, Y.; Jian, F.; Wang, J. The arachidonic acid and its metabolism pathway play important roles for Apostichopus japonicus infected by Vibrio splendens. Fish Shellfish. Immunol. 2022, 125, 152–160. [Google Scholar] [CrossRef]
  23. Dantagnan, P.; Gonzalez, K.; Hevia, M.; Betancor, M.B.; Hernández, A.J.; Borquez, A.; Montero, D. Effect of the arachidonic acid/vitamin E interaction on the immune response of juvenile Atlantic salmon (Salmo salar) challenged against Piscirickettsia salmonis. Aquac. Nutr. 2017, 23, 710–720. [Google Scholar] [CrossRef]
  24. Alonso, D.L.; Maroto, F.G. Plants as ‘chemical factories’ for the production of polyunsaturated fatty acids. Biotechnol. Adv. 2000, 18, 481–497. [Google Scholar] [CrossRef]
  25. Perez-Garcia, O.; Escalante, F.M.E.; de-Bashan, L.E.; Bashan, Y. Heterotrophic cultures of microalgae: Metabolism and potential products. Water Res. 2011, 45, 11–36. [Google Scholar] [CrossRef]
  26. Abdo, S.M.; Ali, G. Potential production of omega fatty acids from microalgae. Int. J. Pharm. Sci. Rev. Res. 2018, 34, 210–215. [Google Scholar]
  27. Gupta, A.; Barrow, C.J.; Puri, M. Omega-3 biotechnology: Thraustochytrids as a novel source of omega-3 oils. Biotechnol. Adv. 2012, 30, 1733–1745. [Google Scholar] [CrossRef]
  28. Shanab, S.M.M.; Hafez, R.M.; Fouad, A.S. A Review on algae and plants as potential source of arachidonic acid. J. Adv. Res. 2018, 11, 3–13. [Google Scholar] [CrossRef]
  29. Kikukawa, H.; Sakuradani, E.; Ando, A.; Shimizu, S.; Ogawa, J. Arachidonic acid production by the oleaginous fungus Mortierella alpina 1S-4: A review. J. Adv. Res. 2018, 11, 15–22. [Google Scholar] [CrossRef]
  30. Ghobadi, Z.; Hamidi-Esfahani, Z.; Azizi, M.H. Statistical optimization of arachidonic acid synthesis by Mortierella alpina CBS 754.68 in a solid-state fermenter. Food Sci. Nutr. 2022, 10, 436–444. [Google Scholar] [CrossRef]
  31. Li, Y.-W.; Guo, Q.; Peng, Q.-Q.; Shen, Q.; Nie, Z.-K.; Ye, C.; Shi, T.-Q. Recent Development of Advanced Biotechnology in the Oleaginous Fungi for Arachidonic Acid Production. ACS Synth. Biol. 2022, 11, 3163–3173. [Google Scholar] [CrossRef]
  32. Nichols, D.S.; McMeekin, T.A. Biomarker techniques to screen for bacteria that produce polyunsaturated fatty acids. J. Microbiol. Methods 2002, 48, 161–170. [Google Scholar] [CrossRef]
  33. Bigogno, C.; Khozin-goldberg, I.; Cohen, Z. accumulation of arachidonic acid-rich triacylglycerols in the microalga Parietochloris Incisa (Trebuxiophyceae, Chlorophyta). Phytochemistry 2002, 60, 135–143. [Google Scholar] [CrossRef]
  34. Jiao, K.; Xiao, W.; Xu, Y.; Zeng, X.; Ho, S.H.; Laws, E.A.; Lu, Y.; Ling, X.; Shi, T.; Sun, Y.; et al. Using a trait-based approach to optimize mixotrophic growth of the red microalga Porphyridium Purpureum towards fatty acid production. Biotechnol. Biofuels 2018, 11, 273. [Google Scholar] [CrossRef]
  35. Lee, Y.-K. Microalgal mass culture systems and methods: Their limitations and potential. J. Appl. Phycol. 2001, 13, 307–315. [Google Scholar] [CrossRef]
  36. Pérez, A.; Labbé, J. Microalgas, Cultivo y Beneficios. Rev. Biol. Mar. Oceanogr. 2014, 49, 157–173. [Google Scholar] [CrossRef]
  37. Ganuza, E.; Benítez-Santana, T.; Atalah, E.; Vega-Orellana, O.; Ganga, R.; Izquierdo, M.S. Crypthecodinium cohnii and Schizochytrium sp. as potential substitutes to fisheries-derived oils from seabream (Sparus aurata) microdiets. Aquaculture 2008, 277, 109–116. [Google Scholar] [CrossRef]
  38. Fan, K.W.; Chen, F. Production of high-value products by marine microalgae Thraustochytrids. In Bioprocessing for Value-Added Products from Renewable Resources; Elsevier: Amsterdam, The Netherlands, 2007; pp. 293–323. [Google Scholar]
  39. Quilodrán, B.; Hinzpeter, I.; Hormazabal, E.; Quiroz, A.; Shene, C. Docosahexaenoic acid (C22:6n−3, DHA) and astaxanthin production by Thraustochytriidae sp. AS4-A1 a native strain with high similitude to Ulkenia sp.: Evaluation of liquid residues from food industry as nutrient sources. Enzym. Microb. Technol. 2010, 47, 24–30. [Google Scholar] [CrossRef]
  40. Colonia, B.S.O.; de Melo Pereira, G.V.; de Carvalho, J.C.; dos Santos Sousa, P.H.; Fanka, L.S.; Rodrigues, C.; Medeiros, A.B.P.; Soccol, C.R. Lipids produced by microalgae and thraustochytrids. In Biomass, Biofuels, Biochemicals; Elsevier: Amsterdam, The Netherlands, 2022; pp. 191–217. [Google Scholar]
  41. Bai, M.; Sen, B.; Wen, S.; Ye, H.; He, Y.; Zhang, X.; Wang, G. Culturable Diversity of Thraustochytrids from Coastal Waters of Qingdao and Their Fatty Acids. Mar. Drugs 2022, 20, 229. [Google Scholar] [CrossRef]
  42. Chauhan, A.S.; Patel, A.K.; Chen, C.-W.; Chang, J.-S.; Michaud, P.; Dong, C.-D.; Singhania, R.R. Enhanced production of high-value polyunsaturated fatty acids (PUFAs) from potential thraustochytrid Aurantiochytrium sp. Bioresour. Technol. 2023, 370, 128536. [Google Scholar] [CrossRef]
  43. Morabito, C.; Bournaud, C.; Maës, C.; Schuler, M.; Aiese Cigliano, R.; Dellero, Y.; Maréchal, E.; Amato, A.; Rébeillé, F. The lipid metabolism in thraustochytrids. Prog. Lipid Res. 2019, 76, 101007. [Google Scholar] [CrossRef]
  44. Orozco Colonia, B.S.; Vinícius de Melo Pereira, G.; Soccol, C.R. Omega-3 microbial oils from marine thraustochytrids as a sustainable and technological solution: A review and patent landscape. Trends Food Sci. Technol. 2020, 99, 244–256. [Google Scholar] [CrossRef]
  45. Zeng, Y.; Ji, X.J.; Lian, M.; Ren, L.J.; Jin, L.J.; Ouyang, P.K.; Huang, H. Development of a temperature shift strategy for efficient docosahexaenoic acid production by a marine fungoid protist, Schizochytrium sp. HX-308. Appl. Biochem. Biotechnol. 2011, 164, 249–255. [Google Scholar] [CrossRef]
  46. Sun, X.M.; Ren, L.J.; Ji, X.J.; Huang, H. Enhancing biomass and lipid accumulation in the microalgae Schizochytrium sp. by addition of fulvic acid and EDTA. AMB Express 2018, 8, 150. [Google Scholar] [CrossRef]
  47. Patel, A.; Karageorgou, D.; Katapodis, P.; Sharma, A.; Rova, U.; Christakopoulos, P.; Matsakas, L. Bioprospecting of thraustochytrids for omega-3 fatty acids: A sustainable approach to reduce dependency on animal sources. Trends Food Sci. Technol. 2021, 115, 433–444. [Google Scholar] [CrossRef]
  48. Hinzpeter, I.; Shene, C.; Masson Salaué, L. Alternativas Biotecnológicas Para la Producción de Ácidos Grasos Poliinsaturados Omega-3. September 2006. Available online: https://repositorio.uchile.cl/handle/2250/120596 (accessed on 1 November 2021).
  49. Honda, D.; Yokochi, T.; Nakahara, T.; Raghukumar, S.; Nakagiri, A.; Schaumann, K.; Higashihara, T. Molecular phylogeny of labyrinthulids and thraustochytrids based on the sequencing of 18S ribosomal RNA gene. J. Eukaryot. Microbiol. 1999, 46, 637–647. [Google Scholar] [CrossRef]
  50. Mo, C.; Douek, J.; Rinkevich, B. Development of a PCR strategy for thraustochytrid identification based on 18S rDNA sequence. Mar. Biol. 2002, 140, 883–889. [Google Scholar] [CrossRef]
  51. Yokoyama, R.; Honda, D. Taxonomic rearrangement of the genus Schizochytrium sensu lato based on morphology, chemotaxonomic characteristics, and 18S RRNA Gene Phylogeny (Thraustochytriaceae, Labyrinthulomycetes): Emendation for Schizochytrium and erection of Aurantiochytrium and Oblongichytrium Gen. Nov. Mycoscience 2007, 48, 199–211. [Google Scholar]
  52. Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; et al. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef]
  53. Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef]
  54. Posada, D. Selection of Models of DNA Evolution with jModelTest. Methods Mol. Biol. 2009, 537, 93–112. [Google Scholar]
  55. Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 2001, 17, 754–755. [Google Scholar] [CrossRef]
  56. Folch, J.; Lees, M.; Sloane, G.H. A simple method for the isolation and purification of total lipides from animal tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [CrossRef]
  57. Morrison, W.R.; Smith, L.M. Preparation of Fatty Acid Methyl Esters and Dimethylacetals from Lipids with Boron Fluoride-Methanol. J. Lipid Res. 1964, 5, 600–608. [Google Scholar] [CrossRef]
  58. Wang, Q.; Ye, H.; Xie, Y.; He, Y.; Sen, B.; Wang, G. Culturable Diversity and Lipid Production Profile of Labyrinthulomycete Protists Isolated from Coastal Mangrove Habitats of China. Mar. Drugs 2019, 17, 268. [Google Scholar] [CrossRef]
  59. Abdel-Wahab, M.A.; El-Samawaty, A.E.-R.M.A.; Elgorban, A.M.; Bahkali, A.H. Fatty acid production of thraustochytrids from Saudi Arabian mangroves. Saudi J. Biol. Sci. 2021, 28, 855–864. [Google Scholar] [CrossRef]
  60. Pino, N.L.; Socias, C.; González, R.R. Marine fungoid producers of DHA, EPA and carotenoids from central and southern Chilean marine ecosystems. Rev. Biol. Mar. Oceanogr. 2015, 50, 507–520. [Google Scholar] [CrossRef]
  61. Leano, E.; Gapasin, R.; Polohan, B.; Vrijmoed, L.; Vrijmoed, B. Growth and fatty acid production of thraustochytrids from Panay mangroves, Philippines. Fungal Divers 2003, 12, 111–122. [Google Scholar]
  62. Taoka, Y.; Nagano, N.; Okita, Y.; Izumida, H.; Sugimoto, S.; Hayashi, M. Influences of culture temperature on the growth, lipid content and fatty acid composition of Aurantiochytrium sp. Strain mh0186. Mar. Biotechnol. 2009, 11, 368–374. [Google Scholar] [CrossRef]
  63. Ma, Z.; Tan, Y.; Cui, G.; Feng, Y.; Cui, Q.; Song, X. Transcriptome and gene expression analysis of DHA producer Aurantiochytrium under low temperature conditions. Sci. Rep. 2015, 5, 14446. [Google Scholar] [CrossRef]
  64. Sarathy, P.P.; Bharathidasan, V.; Murugesan, P.; Selvaraj, P.; Punniyamoorthy, R. Seasonal carbonate system vis-à-vis pH and Salinity in selected tropical estuaries: Implications on polychaete diversity and composition towards predicting ecological health. Oceanologia 2022, 64, 346–362. [Google Scholar] [CrossRef]
  65. Amon, J.P. Thraustochytrids and Labyrinthulids of Terrestrial, Aquatic and Hypersaline Environments of the Great Salt Lake, USA. Mycologia 1978, 70, 1299. [Google Scholar] [CrossRef]
  66. Sun, X.M.; Ren, L.J.; Bi, Z.Q.; Ji, X.J.; Zhao, Q.Y.; Huang, H. Adaptive evolution of microalgae Schizochytrium sp. under high salinity stress to alleviate oxidative damage and improve lipid biosynthesis. Bioresour. Technol. 2018, 267, 438–444. [Google Scholar] [CrossRef]
  67. Zhu, L.; Zhang, X.; Ji, L.; Song, X.; Kuang, C. Changes of lipid content and fatty acid composition of Schizochytrium limacinum in response to different temperatures and salinities. Process Biochem. 2007, 42, 210–214. [Google Scholar] [CrossRef]
  68. Hu, F.; Clevenger, A.L.; Zheng, P.; Huang, Q.; Wang, Z. Low-temperature effects on docosahexaenoic acid biosynthesis in Schizochytrium sp. TIO01 and its proposed underlying mechanism. Biotechnol. Biofuels 2020. 13, 172. [CrossRef]
  69. Jiao, K.; Chang, J.; Zeng, X.; Ng, I.S.; Xiao, Z.; Sun, Y.; Tang, X.; Lin, L. 5-Aminolevulinic acid promotes arachidonic acid biosynthesis in the red microalga Porphyridium purpureum. Biotechnol. Biofuels 2017, 10, 168. [Google Scholar] [CrossRef]
  70. Xie, Y.; Wang, G. Mechanisms of fatty acid synthesis in marine fungus-like protists. Appl. Microbiol. Biotechnol. 2015, 99, 8363–8375. [Google Scholar] [CrossRef]
  71. Villarroel Hipp, M.P.; Silva Rodríguez, D. Bioremediation of piggery slaughterhouse wastewater using the marine protist, Thraustochytrium kinney VAL-B1. J. Adv. Res. 2018, 12, 21–26. [Google Scholar] [CrossRef]
  72. Shamzi Mohamed, M.; Zee Wei, L.; Ariff, A. Heterotrophic Cultivation of Microalgae for Production of Biodiesel. Recent Pat. Biotechnol. 2011, 5, 95–107. [Google Scholar] [CrossRef]
  73. Contreras, P.; Oviedo, C. Potential and Future Perspectives of Thraustochytrids in Bioremediation. Int. J. Environ. Sci. Technol. 2023; in press. [Google Scholar] [CrossRef]
  74. Kikukawa, H.; Watanabe, K.; Kishino, S.; Takeuchi, M.; Ando, A.; Izumi, Y.; Sakuradani, E. Recent trends in the field of lipid engineering. J. Biosci. Bioeng. 2022, 133, 405–413. [Google Scholar] [CrossRef]
  75. Soccol, C.R.; Colonia, B.S.O.; de Melo Pereira, G.V.; Mamani, L.D.; Karp, S.G.; Thomaz Soccol, V.; de Oliveira Penha, R.; Dalmas Neto, C.J.; César de Carvalho, J. Bioprospecting lipid-producing microorganisms: From metagenomic-assisted isolation techniques to industrial application and innovations. Bioresour. Technol. 2022, 346, 126455. [Google Scholar] [CrossRef]
Figure 1. Sampling sites. Map of diverse sampling sites (with GPS coordinates) at the Chilean coast for thraustochytrids isolation.
Figure 1. Sampling sites. Map of diverse sampling sites (with GPS coordinates) at the Chilean coast for thraustochytrids isolation.
Microorganisms 11 00559 g001
Figure 2. Light microscopy image of strain Lng2 isolated in Lenga, Chile. Mature sporangium with zoospores (z). Scale bar 1000×.
Figure 2. Light microscopy image of strain Lng2 isolated in Lenga, Chile. Mature sporangium with zoospores (z). Scale bar 1000×.
Microorganisms 11 00559 g002
Figure 3. Phylogenetic tree of strain Lng2, based in molecular analysis on complete alignment of the 18S rRNA gen.
Figure 3. Phylogenetic tree of strain Lng2, based in molecular analysis on complete alignment of the 18S rRNA gen.
Microorganisms 11 00559 g003
Figure 4. Growth curve and glucose consumption at 23 °C and 15 °C in Lng2 strain (U. visurgensis). The bars indicate ± standard error (n = 3).
Figure 4. Growth curve and glucose consumption at 23 °C and 15 °C in Lng2 strain (U. visurgensis). The bars indicate ± standard error (n = 3).
Microorganisms 11 00559 g004
Figure 5. Effect of different C/N treatments on cell biomass (A) and ARA yields in Lng2 (U. visurgensis) strain (B). The bars indicate ± standard error (n = 3). * Indicates significant differences between control and C/N treatments (p < 0.05).
Figure 5. Effect of different C/N treatments on cell biomass (A) and ARA yields in Lng2 (U. visurgensis) strain (B). The bars indicate ± standard error (n = 3). * Indicates significant differences between control and C/N treatments (p < 0.05).
Microorganisms 11 00559 g005
Figure 6. C/N ratio effect on Lng2 (U. visurgensis) strain; cultivated at 23 °C, for 5 d. Bar chart: Effect on the total lipid content (% calculated over dry weight biomass). Pie chart: Effect on the lipid profile (% of total lipids). TSFA: total saturated fatty acids, TMFA: total monosaturated fatty acids and TPUFA: total polyunsaturated fatty acids. The bars indicate + standard error (n = 3).
Figure 6. C/N ratio effect on Lng2 (U. visurgensis) strain; cultivated at 23 °C, for 5 d. Bar chart: Effect on the total lipid content (% calculated over dry weight biomass). Pie chart: Effect on the lipid profile (% of total lipids). TSFA: total saturated fatty acids, TMFA: total monosaturated fatty acids and TPUFA: total polyunsaturated fatty acids. The bars indicate + standard error (n = 3).
Microorganisms 11 00559 g006
Table 1. Carbon and nitrogen content of media used.
Table 1. Carbon and nitrogen content of media used.
ReagentsTotal Organic Carbon TOC (%)Total N (%)
Glucose (Gibco)40-
Peptone BactoTM (Gibco)4110
Yeast extract (Gibco)25.357.22
Table 2. Thraustochytrid strains isolated and identified in this study from different Chilean coastal environments.
Table 2. Thraustochytrid strains isolated and identified in this study from different Chilean coastal environments.
Sampling SiteSampling DateIsolationNumber of StrainsGenus Level Classification
Quintero
(Quint1)
January
2020
Water column1Ulkenia sp.
Pichilemu
(PiCh3-PiCh4)
September
2019
Water column2Thraustochytrium sp.
Lenga Estuario (Lng 1-Lng2-Lng3-Lng6) April 2019Water column 4Thraustochytrium sp.
Ulkenia visurgensis
Botryochytrium sp.
Puerto Montt (PtoM)April 2021Water column1Ulkenia sp.
Linao
(LNO)
April 2021Marine sediment1Ulkenia sp.
Table 3. Total yield of biomass, total lipids, and specific productivity of ARA, EPA, and DHA found in Chilean native thraustochytrid strains isolated in this study.
Table 3. Total yield of biomass, total lipids, and specific productivity of ARA, EPA, and DHA found in Chilean native thraustochytrid strains isolated in this study.
StrainPich3Pich4Quint1Lng1Lng2Lng3Lng6LNOPtoM
Biomass (g-DW/L)0.35 ± 0.250.54 + 0.030.55 + 0.800.55 ± 0.670.45 ± 0.131.12 ± 0.050.72 ± 0.340.11 ± 0.010.5 ± 0.17
* Total Lipids (%)8.35 ± 1.629.14 ± 0.997.16 ± 2.5410.66 ± 0.7510.68 ± 0.9816.35 ± 0.894.88 ± 2.963.89 ± 3.636.29 ± 0.93
ARA 1(%)2.59 ± 0.773.11 ± 0.975.13 ± 0.174.25 ± 1.425.44 ± 0.752.97 ± 1.898.24 ± 2.359.31 ± 1.284.46 ± 0.65
EPA 1 (%)11.66 ± 1.2012.1 ± 0.874.46 ± 0.328.66 ± 0.8616.26 ± 1.176.03 ± 0.4915.17 ± 0.5711.76 ± 2.183.63 ± 0.19
DHA 1(%)57.01 ± 1.1858.23 ± 1.1517.8 + 0.9631.46 ± 0.7344.78 ± 0.8422.16 ± 0.9128.42 ± 2.9932.58 ± 2.0114.28 ± 0.55
ARA mg/biomass g-DW2.16 ± 0.892.84 ± 1.023.67 ± 0.624.53 ± 0.905.81 ± 1.174.86 ± 0.954.02 ± 0.763.62 ± 0.912.8 ± 2.01
EPA mg/biomass g DW9.74 ± 1.0711.06 ± 0.753.19 ± 0.879.23 ± 0.5617.37 ± 0.959.86 ± 1.027.4 ± 0.894.57 ± 0.572.28 ± 0.83
DHA mg/biomass g DW47.61 ± 1.0853.22 ± 2.9112.74 ± 1.1933.54 ± 0.0347.83 ± 0.0536.23 ± 0.8213.87 ± 0.2312.66 ± 0.768.98 ± 0.79
* Total lipids: (%) of dry weight biomass. 1 ARA, EPA, DHA: abundance with respect to total lipids (%). ±Mean values and their respective standard deviations are presented, n = 3. Effect of temperature: Growth curve and glucose consumption at 23 °C and 15 °C.
Table 4. Fatty acid profile of Lng2 strain (U. visurgensis) cultivated at two temperatures at its exponential (72 h) and stationary (120 h) phase.
Table 4. Fatty acid profile of Lng2 strain (U. visurgensis) cultivated at two temperatures at its exponential (72 h) and stationary (120 h) phase.
Strain LNG215 °C23 °C
72 h120 h 72 h120 h
Biomass g-DW/L1.14 ± 0.231.24 ± 0.111.46 ± 0.451.09 ± 0.25
1 Total Lipids (%)8.52 ± 1.059.65 ± 1.797.79 ± 0.988.99 ± 1.45
1 C12:00.16 ± 0.040.21 ± 0.050.3 ± 0.170.28 ± 0.13
1 C14:01.58 ± 0.861.92 ± 1.262.29 ± 0.601.98 ± 0.09
1 C15:01.10 ± 0.191.57 ± 0.361.45 ± 0.421.37 ± 0.37
1 C16:033.79 ± 1.0939.98 ± 4.2843.36 ± 3.7938.78 ± 4.62
1 C17:00.61 ± 0.231.04 ± 0.440.76 ± 0.270.77 ± 0.34
1 C18:06.23 ± 1.098.40 ± 1.467.76 ± 3.157.86 ± 3.65
1 C18:3n30.03 ± 0.030.03 ± 0.020 ± 0.000.03 ± 0.02
1 C20:20.09 ± 0.040.11 ± 0.010.07 ± 0.060.1 ± 0.02
1 C20:4n6 ARA3.99 ± 1.493.10 ± 1.591.88 ± 1.123.07 ± 1.07
1 C20:5n34.67 ± 2.823.34 ± 1.764.44 ± 2.864.81 ± 3.17
1 C22:6n333.65 ± 0.8926.97 ± 1.1021.81 ± 0.1025.09 ± 2.14
2 ARA mg/biomass g-DW3.40 ± 0.892.99 ± 1.001.46 ± 0.982.79 ± 0.40
1 Total PUFAs44.00 ± 3.5329.48 ± 4.2134.87 ± 0.3034.45 ± 3.86
1 Total SFAs45.38 ± 2.2956.87 ± 1.8354.56 ± 7.4852.27 ± 4.30
1 Total MFAs10.63 ± 1.8013.65 ± 1.9710.56 ± 2.0113.28 ± 3.14
Note: ± Mean values and their respective standard deviations are presented, n = 3. 1 Indicator of Fatty acids expressed as percentage of total identified FAME. 2 The productivity of ARA was expressed in mg/dry biomass.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Vasquez-Sandoval, C.; Navarrete, J.; Herrera-Herrera, P.; Dantagnan, P.; Diaz-Navarrete, P.; Arancibia-Avila, P.; Oviedo, C. Screening and Identification of Coastal Chilean Thraustochytrids for Arachidonic Acid Production: Biotechnological Potential of Ulkenia visurgensis Lng2-Strain. Microorganisms 2023, 11, 559. https://doi.org/10.3390/microorganisms11030559

AMA Style

Vasquez-Sandoval C, Navarrete J, Herrera-Herrera P, Dantagnan P, Diaz-Navarrete P, Arancibia-Avila P, Oviedo C. Screening and Identification of Coastal Chilean Thraustochytrids for Arachidonic Acid Production: Biotechnological Potential of Ulkenia visurgensis Lng2-Strain. Microorganisms. 2023; 11(3):559. https://doi.org/10.3390/microorganisms11030559

Chicago/Turabian Style

Vasquez-Sandoval, Cinthia, José Navarrete, Paula Herrera-Herrera, Patricio Dantagnan, Paola Diaz-Navarrete, Patricia Arancibia-Avila, and Claudia Oviedo. 2023. "Screening and Identification of Coastal Chilean Thraustochytrids for Arachidonic Acid Production: Biotechnological Potential of Ulkenia visurgensis Lng2-Strain" Microorganisms 11, no. 3: 559. https://doi.org/10.3390/microorganisms11030559

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop