Limited Reliability of the Molecular Detection of Plasmodium spp. from Incubated Blood Culture Samples for Forensic Purposes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Type
2.2. Residual Sample Materials Applied for the Malaria Real-Time PCR Testing in This Study
2.3. Microscopic Assessment of Freshly Taken EDTA Blood Samples during the Studies in Ghana
2.4. Sample Preparation Prior to PCR Assessment
2.5. Applied Malaria Screening Real-Time PCR Assay
2.6. Confirmatory Malaria Real-Time PCR Assay and Conditions under Which This Confirmation Was Performed
2.7. Differentiation PCR Assay for the Discrimination of P. ovale wallikeri and P. ovale curtisi
Forward Primer Name | Forward Primer Sequence | Reverse Primer Name | Reverse Primer Sequence | Probe Name | Probe Sequence |
---|---|---|---|---|---|
SybrGreen-based generic Plasmodium spp.-specific real-time PCR targeting the 18S rRNA gene used for screening, according to Mangold et al. [32]. | |||||
PL1473F18 | 5′-TAACGAACGAGATCTTAA-3′ | L1679R18 | 5′-GTTCCTCTAAGAAGCTTT-3′ | n.a. | n.a. |
Dual hybridization probe real-time PCR for the discrimination of P. ovale curtisi and P. ovale wallikeri targeting the ssu rRNA, according to Bauffe et al. [34] | |||||
POF | 5′-ATAAACTATGCCGACTAGGTT-3′ | POR | 5′-ACTTTGATTTCTCATAAGGTACT-3′ | pPOC 1 | 5′-TTCCTTTCGGGGAAATTTCTTAGA-3′ |
pPOW 2 | 5′-AATTCCTTTTGGAAATTTCTTAGATTG-3′ |
2.8. Inclusion and Exclusion Criteria
2.9. Assessment Strategy for the Obtained Data
2.10. Ethics
3. Results
3.1. Overall Assessment
3.2. Agreement of Real-Time PCR and Routine Microscopy
3.3. Analysis of the Distribution of Ct-Values and Parasitemia
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Positive Control Insert Based on the P. falciparum Sequence according to the NCBI GenBank Accession Number JQ627151.1. |
---|
5′-TTCCGATAACGAACGAGATCTTAACCTGCTAATTAGCGGCGAGTACACTATATTCTTATTTGAAATTGAACATAGGTAACTATACATTTATTCAGTAATCAAATTAGGATATTTTTATTAAAATATCCTTTTCCCTGTTCTACTAATAATTTGTTTTTTACTCTATTTCTCTCTTCTTTTAAGAATGTACTTGCTTGATTGAAAAGCTTCTTAGAGGAACATTGTG-3′ |
Positive Control Insert Based on the P. malariae Sequence According to the NCBI GenBank Accession Number EF467831.1. |
5′-TTCCGATAACGAACGAGATCTTAACCTGCTAATTAGCGGTAAATACACTATATTCTTAAGTGAAATTAGAATATAGATAAATTGTGCTAATTTTGATTAAAATATTAGAATGTTTTTTTTAATAAAAACGTTCTTTTCCCTTTTTTTCTTAATTATGCATATTTATTTTTTTTCTTCTTTTGCATAAGAATGTATTTGCTTAATTGTAAAGCTTCTTAGAGGAACGATGTG-3′ |
Positive Control Insert Based on the P. vivax Sequence According to the NCBI GenBank Accession Number JQ627158.1. |
5′-TTCCGATAACGAACGAGATCTTAACCTGCTAATTAGCGGCAAATACGATATATTCTTACGTGGGACTGAATTCGGTTGATTTGCTTACTTCGAAGAAAATATTGGGATACGTAACAGTTTCCCTTTCCCTTTTCTACTTAGTTCGCTTTTCATACTGTTTCTTTTTCGCGTAAGAATGTATTTGCTTGATTGTAAAGCTTCTTAGAGGAACGATGTG-3′ |
Positive Control Insert Based on the P. ovale complex Sequence According to the NCBI GenBank Accession Number KF018659.1. |
5′-TTCCGATAACGAACGAGATCTTAACCTGCTAATTAGCGGCGAATACGTTATATTCCTACTTGAAATTGAATATAGCTGAATTTGCTTATTTTGAAGAATATATTAGGATACATTATAGTGTCCTTTTCCCTTTTCTACTTAATTCGCTATTCATGCTGTTTCTTTTTTGTGTAGGAATGTATTCGTTTGATTGTAAAGCTTCTTAGAGGAACGATGTG-3′ |
Positive Control Insert Based on the P. knowlesi Sequence According to the NCBI GenBank Accession Number KJ917904.1. |
5′-TTCCGATAACGAACGAGATCTTAACCTGCTAATTAGCGGCAAATACGATATATTCTTATGTAGAATTGAATATAGTGGATTTGTTAGATTTTGAAGAAAATATTGGAATTACGTTAAATGTGATTCCTTTCCCTTTTCTACTTAATTTACATTTCCATCTATTTCTTTTTTGCGTATGAATGTATTTGCTTGATTGTAAAGCTTCTTAGAGGAACGATGTG-3′ |
Positive Control Insert Based on the P. ovale curtisi Sequence according to the NCBI GenBank Accession Number KX672023.1. |
---|
5′-AATCTTAACCATAAACTATGCCGACTAGGTTTTGGATGAAACATTTTTAAATAAGAAAATTCCTTTCGGGGAAATTTCTTAGATTGCTTCTTTCAGTACCTTATGAGAAATCAAAGTCTTTGGGTTC-3′ |
Positive Control Insert Based on the P. ovale wallikeri Sequence According to the NCBI GenBank Accession Number MG241227.1. |
5′-AATCTTAACCATAAACTATGCCGACTAGGTTTTGGATGAAAGATTTTTAAATAAGAAAATTCCTTTTGGAAATTTCTTAGATTGCTTCCTTCAGTACCTTATGAGAAATCAAAGTCTTTGGGTTC-3′ |
Routine Microscopy | Plasmodium falciparum, n, Mean Ct (±SD), Parasitemia (±SD) | Plasmodium vivax, n | Plasmodium ovale Complex, n | Plasmodium malariae, n, Mean Ct (±SD), Parasitemia (±SD) | Plasmodium spp. (not Further Discriminated), n, Mean Ct (±SD), Parasitemia (±SD) | Not Performed, n, Mean Ct (±SD) | Negative, n, Mean Ct (±SD) | |
---|---|---|---|---|---|---|---|---|
Real-Time PCR | ||||||||
Plasmodium falciparum | 465; 26.42 (±3.9); 142,554.06 (±213,046.92) | 5; 25.34 (±2.04), 118,951.20 (± 96,214.95) | 44; 27.27 (±3.87) | 92; 28.64 (±3.29) | ||||
Plasmodium vivax | 0 | 0 | 1; 35.66 (±0) | 1; 32.35 (±0) | ||||
Plasmodium ovale complex | 0 | 2; 32.27 (±3.27), 8322.50 (±4573.50) | 1; 30.00 (±0) | 8; 33.13 (±1.86) | ||||
Plasmodium malariae | 3; 30.55 (±1.46); 665.33 (±645.43) | 2; 28.83 (±0.91), 2168.50 (±1350.50) | 12; 32.47 (±1.77) | 94; 31.78 (±2.10) | ||||
Negative | 248; 0 (±0); 51,460 (±116,560.22) | 0 | 0 | 4; 0 (±0); 23,964.50 (±39,550.28) | 5; 0 (±0); 2103.25 (±1482.74) | 149 | 1256 |
References
- Kotepui, M.; Masangkay, F.R.; Kotepui, K.U.; De Jesus Milanez, G. Misidentification of Plasmodium ovale as Plasmodium vivax malaria by a microscopic method: A meta-analysis of confirmed P. ovale cases. Sci. Rep. 2020, 10, 21807. [Google Scholar] [CrossRef] [PubMed]
- Frickmann, H.; Wegner, C.; Ruben, S.; Behrens, C.; Kollenda, H.; Hinz, R.; Rojak, S.; Schwarz, N.G.; Hagen, R.M.; Tannich, E. Evaluation of the multiplex real-time PCR assays RealStar malaria S & T PCR kit 1.0 and FTD malaria differentiation for the differentiation of Plasmodium species in clinical samples. Travel Med. Infect. Dis. 2019, 31, 101442. [Google Scholar]
- Frickmann, H.; Wegner, C.; Ruben, S.; Loderstädt, U.; Tannich, E. A comparison of two PCR protocols for the differentiation of Plasmodium ovale species and implications for clinical management in travellers returning to Germany: A 10-year cross-sectional study. Malar. J. 2019, 18, 272. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bourgeois, N.; Boutet, A.; Bousquet, P.J.; Basset, D.; Douard-Enault, C.; Charachon, S.; Lachaud, L. Comparison of three real-time PCR methods with blood smears and rapid diagnostic test in Plasmodium sp. infection. Clin. Microbiol. Infect. 2010, 16, 1305–1311. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dormond, L.; Jaton-Ogay, K.; de Vallière, S.; Genton, B.; Bille, J.; Greub, G. Multiplex real-time PCR for the diagnosis of malaria: Correlation with microscopy. Clin. Microbiol. Infect. 2011, 17, 469–475. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Picot, S.; Cucherat, M.; Bienvenu, A.L. Systematic review and meta-analysis of diagnostic accuracy of loop-mediated isothermal amplification (LAMP) methods compared with microscopy, polymerase chain reaction and rapid diagnostic tests for malaria diagnosis. Int. J. Infect. Dis. 2020, 98, 408–419. [Google Scholar] [CrossRef] [PubMed]
- Shokoples, S.E.; Ndao, M.; Kowalewska-Grochowska, K.; Yanow, S.K. Multiplexed real-time PCR assay for discrimination of Plasmodium species with improved sensitivity for mixed infections. J. Clin. Microbiol. 2009, 47, 975–980. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grossman, T.; Schwartz, E.; Vainer, J.; Agmon, V.; Glazer, Y.; Goldmann, D.; Marva, E. Contribution of real-time PCR to Plasmodium species identification and to clinical decisions: A nationwide study in a non-endemic setting. Eur. J. Clin. Microbiol. Infect. Dis. 2017, 36, 671–675. [Google Scholar] [CrossRef]
- Kotepui, M.; Kotepui, K.U.; De Jesus Milanez, G.; Masangkay, F.R. Summary of discordant results between rapid diagnosis tests, microscopy, and polymerase chain reaction for detecting Plasmodium mixed infection: A systematic review and meta-analysis. Sci. Rep. 2020, 10, 12765. [Google Scholar] [CrossRef]
- Danwang, C.; Kirakoya-Samadoulougou, F.; Samadoulougou, S. Assessing field performance of ultrasensitive rapid diagnostic tests for malaria: A systematic review and meta-analysis. Malar. J. 2021, 20, 245. [Google Scholar] [CrossRef]
- Zainabadi, K. Ultrasensitive Diagnostics for Low-Density Asymptomatic Plasmodium falciparum Infections in Low-Transmission Settings. J. Clin. Microbiol. 2021, 59, e01508-20. [Google Scholar] [CrossRef]
- Kamaliddin, C.; Sutherland, C.J.; Houze, S.; Cottrell, G.; Briand, V.; Mogollon, D.C.; Pillai, D.R. The role of ultra-sensitive molecular methods for detecting malaria—The broader perspective. Clin. Infect. Dis. 2021, 7, e1387–e1390. [Google Scholar] [CrossRef] [PubMed]
- Prusty, D.; Gupta, N.; Upadhyay, A.; Dar, A.; Naik, B.; Kumar, N.; Prajapati, V.K. Asymptomatic malaria infection prevailing risks for human health and malaria elimination. Infect. Genet. Evol. 2021, 93, 104987. [Google Scholar] [CrossRef] [PubMed]
- Mbanefo, A.; Kumar, N. Evaluation of Malaria Diagnostic Methods as a Key for Successful Control and Elimination Programs. Trop. Med. Infect. Dis. 2020, 5, 102. [Google Scholar] [CrossRef]
- Whittaker, C.; Slater, H.; Nash, R.; Bousema, T.; Drakeley, C.; Ghani, A.C.; Okell, L.C. Global patterns of submicroscopic Plasmodium falciparum malaria infection: Insights from a systematic review and meta-analysis of population surveys. Lancet Microbe 2021, 2, e366–e374. [Google Scholar] [CrossRef]
- Deen, J.; Mukaka, M.; von Seidlein, L. What is the yield of malaria reactive case detection in the Greater Mekong Sub-region? A review of published data and meta-analysis. Malar. J. 2021, 20, 131. [Google Scholar] [CrossRef]
- Mischlinger, J.; Pitzinger, P.; Veletzky, L.; Groger, M.; Zoleko-Manego, R.; Adegnika, A.A.; Agnandji, S.T.; Lell, B.; Kremsner, P.G.; Tannich, E.; et al. Use of Capillary Blood Samples Leads to Higher Parasitemia Estimates and Higher Diagnostic Sensitivity of Microscopic and Molecular Diagnostics of Malaria Than Venous Blood Samples. J. Infect. Dis. 2018, 218, 1296–1305. [Google Scholar] [CrossRef]
- Danwang, C.; Noubiap, J.J.; Souopgui, J.; Gaudart, J.; Yombi, J.C.; Robert, A. Accuracy of malaria diagnostic tests performed on non-invasively collected samples: A systematic review and meta-analysis. BMJ Glob. Health 2021, 6, e005634. [Google Scholar] [CrossRef]
- Mahittikorn, A.; Masangkay, F.R.; Kotepui, K.U.; De Jesus Milanez, G.; Kotepui, M. Comparative performance of PCR using DNA extracted from dried blood spots and whole blood samples for malaria diagnosis: A meta-analysis. Sci. Rep. 2021, 11, 4845. [Google Scholar] [CrossRef]
- Morris, U.; Aydin-Schmidt, B.; Shakely, D.; Mårtensson, A.; Jörnhagen, L.; Ali, A.S.; Msellem, M.I.; Petzold, M.; Gil, J.P.; Ferreira, P.E.; et al. Rapid diagnostic tests for molecular surveillance of Plasmodium falciparum malaria -assessment of DNA extraction methods and field applicability. Malar. J. 2013, 12, 106. [Google Scholar] [CrossRef] [Green Version]
- Cnops, L.; Van Esbroeck, M.; Bottieau, E.; Jacobs, J. Giemsa-stained thick blood films as a source of DNA for Plasmodium species-specific real-time PCR. Malar. J. 2010, 9, 370. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jirků, M.; Pomajbíková, K.; Petrželková, K.J.; Hůzová, Z.; Modrý, D.; Lukeš, J. Detection of Plasmodium spp. in human feces. Emerg. Inf. Dis. 2012, 18, 634–636. [Google Scholar] [CrossRef] [PubMed]
- Loderstädt, U.; Hagen, R.M.; Hahn, A.; Frickmann, H. New Developments in PCR-Based Diagnostics for Bacterial Pathogens Causing Gastrointestinal Infections-A Narrative Mini-Review on Challenges in the Tropics. Trop. Med. Infect. Dis. 2021, 6, 96. [Google Scholar] [CrossRef] [PubMed]
- Frickmann, H.; Dekker, D.; Boahen, K.; Acquah, S.; Sarpong, N.; Adu-Sarkodie, Y.; Schwarz, N.G.; May, J.; Marks, F.; Poppert, S.; et al. Increased detection of invasive enteropathogenic bacteria in pre-incubated blood culture materials by real-time PCR in comparison with automated incubation in Sub-Saharan Africa. Scand. J. Infect. Dis. 2013, 45, 616–622. [Google Scholar] [CrossRef] [PubMed]
- Frickmann, H.; Dekker, D.; Schwarz, N.G.; Hahn, A.; Boahen, K.; Sarpong, N.; Adu-Sarkodie, Y.; Halbgewachs, E.; Marks, F.; von Kalckreuth, V.; et al. 16S rRNA Gene Sequence-Based Identification of Bacteria in Automatically Incubated Blood Culture Materials from Tropical Sub-Saharan Africa. PLoS ONE 2015, 10, e0135923. [Google Scholar] [CrossRef] [Green Version]
- Nielsen, M.V.; Sarpong, N.; Krumkamp, R.; Dekker, D.; Loag, W.; Amemasor, S.; Agyekum, A.; Marks, F.; Huenger, F.; Krefis, A.C.; et al. Incidence and characteristics of bacteremia among children in rural Ghana. PLoS ONE 2012, 7, e44063. [Google Scholar] [CrossRef] [Green Version]
- Marks, F.; Adu-Sarkodie, Y.; Hünger, F.; Sarpong, N.; Ekuban, S.; Agyekum, A.; Nkrumah, B.; Schwarz, N.G.; Favorov, M.O.; Meyer, C.G.; et al. Typhoid fever among children, Ghana. Emerg. Infect. Dis. 2010, 16, 1796–1797. [Google Scholar] [CrossRef]
- Schwarz, N.G.; Sarpong, N.; Hünger, F.; Marks, F.; Acquah, S.E.; Agyekum, A.; Nkrumah, B.; Loag, W.; Hagen, R.M.; Evans, J.A.; et al. Systemic bacteraemia in children presenting with clinical pneumonia and the impact of non-typhoid salmonella (NTS). BMC Infect. Dis. 2010, 10, 319. [Google Scholar] [CrossRef] [Green Version]
- Giemsa, G. Eine Vereinfachung und Vervollkommnung meiner Methylenblau-Eosin-Färbemethode zur Erzielung der Romanowsky-Nocht’schen Chromatinfärbung. Cent. Für Bakteriol. 1904, 32, 307–313. [Google Scholar]
- Trape, J.F. Rapid evaluation of malaria parasite density and standardization of thick smear examination for epidemiological investigations. Trans. R. Soc. Trop. Med. Hyg. 1985, 79, 181–184. [Google Scholar] [CrossRef]
- Mangold, K.A.; Manson, R.U.; Koay, E.S.; Stephens, L.; Regner, M.; Thomson, R.B., Jr.; Peterson, L.R.; Kaul, K.L. Real-time PCR for detection and identification of Plasmodium spp. J. Clin. Microbiol. 2005, 43, 2435–2440. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Altangerel, E.; Frickmann, H. Meta-analysis of the diagnostic performance characteristics of three commercial and one in-house nucleic acid amplification tests for malaria screening. J. Lab. Med. 2020, 44, 47–53. [Google Scholar] [CrossRef] [Green Version]
- Bauffe, F.; Desplans, J.; Fraisier, C.; Parzy, D. Real-time PCR assay for discrimination of Plasmodium ovale curtisi and Plasmodium ovale wallikeri in the Ivory Coast and in the Comoros Islands. Malar. J. 2012, 11, 307. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Calderaro, A.; Piccolo, G.; Perandin, F.; Gorrini, C.; Peruzzi, S.; Zuelli, C.; Ricci, L.; Manca, N.; Dettori, G.; Chezzi, C.; et al. Genetic polymorphisms influence Plasmodium ovale PCR detection accuracy. J. Clin. Microbiol. 2007, 45, 1624–1627. [Google Scholar] [CrossRef] [Green Version]
- Calderaro, A.; Piccolo, G.; Gorrini, C.; Montecchini, S.; Rossi, S.; Medici, M.C.; Chezzi, C.; Snounou, G. A new real-time PCR for the detection of Plasmodium ovale wallikeri. PLoS ONE 2012, 7, e48033. [Google Scholar] [CrossRef] [PubMed]
- Bossuyt, P.M.; Reitsma, J.B.; Bruns, D.E.; Gatsonis, C.A.; Glasziou, P.P.; Irwig, L.; Lijmer, J.G.; Moher, D.; Rennie, D.; De Vet, H.C.W.; et al. STARD 2015: An updated list of essential items for reporting diagnostic accuracy studies. BMJ 2015, 351, h5527. [Google Scholar] [CrossRef] [Green Version]
- Abeje, G.; Gelaye, W.; Alemu, G. Comparison of capillary, venous and buffy coat blood samples in detecting Plasmodium species among malaria suspected patients attending at Hamusite health center. A cross-sectional study. BMC Infect. Dis. 2021, 21, 576. [Google Scholar] [CrossRef]
- Carlsson, A.M.; Ngasala, B.E.; Dahlstrom, S.; Membi, C.; Veiga, I.M.; Rombo, L.; Abdulla, S.; Premji, Z.; Gil, J.P.; Bjorkman, A.; et al. Plasmodium falciparum population dynamics during the early phase of anti-malarial drug treatment in Tanzanian children with acute uncomplicated malaria. Malar. J. 2011, 10, 380. [Google Scholar] [CrossRef] [Green Version]
- Hahn, A.; Podbielski, A.; Meyer, T.; Zautner, A.E.; Loderstädt, U.; Schwarz, N.G.; Krüger, A.; Cadar, D.; Frickmann, H. On detection thresholds-a review on diagnostic approaches in the infectious disease laboratory and the interpretation of their results. Acta Trop. 2020, 205, 105377. [Google Scholar] [CrossRef]
- Brown, C.A.; Pappoe-Ashong, P.J.; Duah, N.; Ghansah, A.; Asmah, H.; Afari, E.; Koram, K.A. High frequency of the Duffy-negative genotype and absence of Plasmodium vivax infections in Ghana. Malar. J. 2021, 20, 99. [Google Scholar] [CrossRef]
- Rogan, W.J.; Gladen, B. Estimating prevalence from the results of a screening test. Am. J. Epidemiol. 1978, 107, 71–76. [Google Scholar] [CrossRef] [PubMed]
2321 Blood Culture Samples from a Ghanaian Epidemiological Study Included, of Which 2114 Had Microscopical Results from Concomitantly Taken Whole-Blood Samples |
---|
↓ |
Assessment of all 2321 blood culture sample residual volumes by SybrGreen-based non-commercial malaria real-time PCR screening |
↓ |
Inclusion of 605/2321 (26.1%) blood culture sample residual volumes (comprising 122 samples without available microscopic result) into confirmatory commercial Altona Diagnostics real-time PCR testing, if the following conditions were met:
|
↓ |
Non-commercial duplex real-time PCR for the discrimination of P. ovale wallikeri and P. ovale curtisi in case of P. ovale complex detections by real-time PCR or by routine microscopy (n = 11) |
SybrGreen PCR-Based Screening Result | Result of Hybridization Probe-Based Confirmatory Testing Applying the Altona Diagnostics Assay | Diagnostic Interpretation Assumed as “True Result” Considering Both PCR Reactions | Number (n) |
---|---|---|---|
P. falciparum | P. falciparum | P. falciparum | 153 |
Negative | P. falciparum * | 12 | |
Negative | P. falciparum | P. falciparum | 63 |
P. malariae | P. malariae | 3 | |
P. ovale complex | P. ovale complex | 3 | |
Negative | Negative | 142 | |
Distorted melting curves within the expected temperature range | P. falciparum | P. falciparum | 210 |
P. falciparum/ P. malariae co-infection | P. falciparum/P. malariae co-infection | 4 | |
P. malariae | P. malariae | 1 | |
Negative | Negative | 14 |
Kind of Infection | Detected by Routine Microscopy, n/n (%) | Detected by Real-Time PCR, n/n (%) | Concordance of Routine Microscopy and PCR, n/n (%) | Detected in Total Combining Routine Microscopy and Real-Time PCR, n/n, % |
---|---|---|---|---|
Plasmodium falciparum | 711/2114 (33.6%) | 558/2114 (26.4%) | 1773/2114 (83.9%) | 806/2114 (38.1%) |
Plasmodium vivax | 0/2114 (0.0%) | 1/2114 (0.1%) | 2113/2114 (99.9%) | 1/2114 (0.1%) |
Plasmodium ovale complex | 0/2114 (0.0%) | 10/2114 (0.5%) | 2104/2114 (99.5%) | 10/2114 (0.5%) |
Plasmodium malariae | 7/2114 (0.3%) | 95/2114 (4.5%) | 2018/2114 (95.5%) | 99/2114 (4.7%) |
Plasmodium spp. (not further discriminated) | 1/2114 (0.1%) | 0/2114 (0.0%) | 2113/2114 (99.9%) | 1/2114 (0.1%) |
Infection with more than one Plasmodium spp. | 13/2114 (0.6%) 1 | 4/2114 (0.2%) 2 | 2097/2114 (99.20%) | 17/2114 (0.8%) |
Criterium | Real-Time PCR (with Routine Microscopy as the Reference) | Real-time PCR (with a Combined Reference of Routine Microscopy and Real-Time PCR) | Routine Microscopy (with a Combined Reference of Routine Microscopy and Real-Time PCR) |
---|---|---|---|
Agreement of positive results, n/n (%) | 542/732 (74.0%) | 668/858 (77.9%) | 732/858 (85.3%) |
Agreement of negative results, n/n (%) | 1256/1382 (90.9%) | n.a. | n.a. |
Predictive value for positive results in the chosen reference, n/n (%) | 542/668 (81.1%) | n.a. | n.a. |
Predictive value for negative results in the reference, n/n (%) | 1256/1446 (86.9%) | 1256/1446 (86.9%) | 1256/1382 (90.9%) |
Species | Recorded Ct-Values in Case of Concordance of Routine Microscopy and PCR, n; Mean (± SD); Median (Minimum, Maximum) | Recorded Ct-Values with Diagnosis Based on PCR only, n; Mean (±SD); Median (Minimum, Maximum) |
---|---|---|
P. falciparum | n = 465; 26,4 (±3.9); 26.5 (15.4, 37.0) | n = 562; 26.8 (±3.9); 27.0 (15.0, 37.0) |
P. vivax | n = 0; n.a. | n = 1; 32.4 (±0); 32.4 (32.4, 32.4) |
P. ovale complex | n = 0; n.a. | n = 10; 33.0 (±2.2); 33.2 (29.0, 35.7) |
P. malariae | n = 3; 30.6 (±1.5); 31.5 (28.5, 31.7) | n = 99; 31.7 (±2.1); 31.7 (24.8, 36.3) |
Species | Recorded Parasitemia in Case of Concordance of Routine Microscopy and PCR, n; Mean (±SD); Median (Minimum, Maximum) | Recorded Parasitemia with Diagnosis Based on Routine Microscopy only, n; Mean (±SD); Median (Minimum, Maximum) |
---|---|---|
P. falciparum | n = 463; 142,554.1 (±213,046.9); 63,800 (71, 1,859,200) | n = 722; 109,950.5 (±189,177.7); 31,304 (70, 1,859,200) |
P. vivax | n = 0; n.a. | n = 0; n.a. |
P. ovale complex | n = 0; n.a. | n = 0; n.a. |
P. malariae | n = 3; 665.3 (±645.4); 384 (54, 1558) | n = 20; 36,100.3 (±70,620.7); 3079.5 (54, 272,160) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Weinreich, F.; Hagen, R.M.; Loag, W.; Maïga-Ascofaré, O.; Dekker, D.; Frickmann, H.; Loderstädt, U. Limited Reliability of the Molecular Detection of Plasmodium spp. from Incubated Blood Culture Samples for Forensic Purposes. Microorganisms 2022, 10, 406. https://doi.org/10.3390/microorganisms10020406
Weinreich F, Hagen RM, Loag W, Maïga-Ascofaré O, Dekker D, Frickmann H, Loderstädt U. Limited Reliability of the Molecular Detection of Plasmodium spp. from Incubated Blood Culture Samples for Forensic Purposes. Microorganisms. 2022; 10(2):406. https://doi.org/10.3390/microorganisms10020406
Chicago/Turabian StyleWeinreich, Felix, Ralf Matthias Hagen, Wibke Loag, Oumou Maïga-Ascofaré, Denise Dekker, Hagen Frickmann, and Ulrike Loderstädt. 2022. "Limited Reliability of the Molecular Detection of Plasmodium spp. from Incubated Blood Culture Samples for Forensic Purposes" Microorganisms 10, no. 2: 406. https://doi.org/10.3390/microorganisms10020406