Molecular Detection of Theileria ovis, Anaplasma ovis, and Rickettsia spp. in Rhipicephalus turanicus and Hyalomma anatolicum Collected from Sheep in Southern Xinjiang, China
Abstract
1. Introduction
2. Materials and Methods
2.1. Tick Sample Collection
2.2. Tick Identification
2.3. DNA Extraction
2.4. Molecular Characterization of the Tick Species and Characterization of Tick-Borne Pathogens
3. Results
3.1. Rh. turanicus and H. anatolicum Are the Identified Tick Species Based on Morphology and Molecular Methods
3.2. Pathogens
3.3. Analyses of the Three Pathogens’ DNA Sequences
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
| Name | Gene | Fragment Size | Primers (5′-3′) Forward and Downward | References |
|---|---|---|---|---|
| Tick species | COI | 709 bp | GGTCAACAAATCATA AAGATATTGG | [5] |
| TAAACTTCAGGGTGA CCAAAAAATCA | ||||
| 16S rDNA | 461 bp | TCGTCTGTCTGAGGGTCGGA | ||
| ATCGTCTCGTGTAGCGTCG | ||||
| Theileria spp. | 18S rRNA | 1421 bp | GTCTTGTAATTGGAATGATGG | [12] |
| TAGTTTATGGTTAGGACTACG | ||||
| Rickettsia spp. | OmpA | 632 bp | ATGGCGAATATTTCTCCAAAA | [5] |
| GTTCCGTTAATGGCAGCATCT | ||||
| Anaplasma spp. | Msp4 | 852 bp | GGGAGCTCCTATGAATT ACAGAGAATTGTTTAC | [11] |
| CCGGATCCTTAGCTGA ACAGGAATCTTGC |
References
- de la Fuente, J.; Estrada-Peña, A.; Rafael, M.; Almazán, C.; Bermúdez, S.; Abdelbaset, A.E.; Kasaija, P.D.; Kabi, F.; Akande, F.A.; Ajagbe, D.O.; et al. Perception of Ticks and Tick-Borne Diseases Worldwide. Pathogens 2023, 12, 1258. [Google Scholar] [CrossRef] [PubMed]
- Hay, J.; Yeh, K.B.; Dasgupta, D.; Shapieva, Z.; Omasheva, G.; Deryabin, P.; Nurmakhanov, T.; Ayazbayev, T.; Andryushchenko, A.; Zhunushov, A.; et al. Biosurveillance in Central Asia: Successes and Challenges of Tick-Borne Disease Research in Kazakhstan and Kyrgyzstan. Front. Public Health 2016, 4, 4. [Google Scholar] [CrossRef] [PubMed]
- Kebzai, F.; Ashraf, K.; Rehman, M.U.; Akbar, H.; Avais, M.; Khan, M. Molecular detection and assessment of risk factors for Theileria lestoquardi in sheep from Balochistan, Pakistan. Parasitol. Res. 2023, 122, 2957–2965. [Google Scholar] [CrossRef] [PubMed]
- Arif, M.; Saeed, S.; Bashir, A.; Farooq, M.; Nasreen, N.; Khan, A.; Asif, M.; Khalil, M.A.; Ijaz, M.; Muqaddas, H.; et al. Molecular prevalence and phylogeny of Anaplasma marginale, Anaplasma ovis, and Theileria ovis in goats and sheep enrolled from a hill station in Punjab, Pakistan. PLoS ONE 2023, 18, e0291302. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Galon, E.M.; Guo, Q.; Rizk, M.A.; Moumouni, P.F.; Liu, M.; Li, J.; Ji, S.; Chahan, B.; Xuan, X. Molecular Detection and Identification of Babesia spp., Theileria spp., and Anaplasma spp. in Sheep From Border Regions, Northwestern China. Front. Vet. Sci. 2020, 7, 630. [Google Scholar] [CrossRef] [PubMed]
- Statistic Bureau of Xinjiang Uygur Autonomous Region. 2021. Available online: https://tjj.xinjiang.gov.cn/tjj/tjgn/202203/7ab304445f174a7eb1f5165be4f94041.shtml (accessed on 25 December 2023).
- Li, Y.; Wen, X.; Li, M.; Moumouni, P.F.A.; Galon, E.M.; Guo, Q.; Rizk, M.A.; Liu, M.; Li, J.; Ji, S.; et al. Molecular detection of tick-borne pathogens harbored by ticks collected from livestock in the Xinjiang Uygur Autonomous Region, China. Ticks Tick Borne Dis. 2020, 11, 101478. [Google Scholar] [CrossRef] [PubMed]
- Li, S.A.; Zhang, L.; Li, Z.; Song, H.N.; Que, Z.W.; Zhao, S.Y.; Li, Y.Y.; Guo, Y.L.; Wu, J.Y. Detection of Rickettsia spp. and Anaplasma ovis in Melophagus ovinus from southern Xinjiang, China. Med. Vet. Entomol. 2023, 37, 865–870. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.; Song, S.; Cao, S.; Sun, Z.; Zhou, Q.; Deng, X.; Zhao, T.; Chai, Y.; Zhu, D.; Chen, C.; et al. Molecular Detection of Zoonotic and Veterinary Pathogenic Bacteria in Pet Dogs and Their Parasitizing Ticks in Junggar Basin, North-Western China. Front. Vet. Sci. 2022, 9, 895140. [Google Scholar] [CrossRef] [PubMed]
- Casati, S.; Sager, H.; Gern, L.; Piffaretti, J.C. Presence of potentially pathogenic Babesia sp. for humans in Ixodes ricinus in Switzerland. Ann. Agric. Environ. Med. 2006, 13, 65–70. [Google Scholar] [CrossRef]
- de la Fuente, J.; Atkinson, M.W.; Naranjo, V.; Fernández de Mera, I.G.; Mangold, A.J.; Keating, K.A.; Kocan, K.M. Sequence analysis of the msp4 gene of Anaplasma ovis strains. Vet. Microbiol. 2007, 119, 375–381. [Google Scholar] [CrossRef]
- Zaeemi, M.; Haddadzadeh, H.; Khazraiinia, P.; Kazemi, B.; Bandehpour, M. Identification of different Theileria species (Theileria lestoquardi, Theileria ovis, and Theileria annulata) in naturally infected sheep using nested PCR-RFLP. Parasitol. Res. 2011, 108, 837–843. [Google Scholar] [CrossRef]
- Kumar, R.; Moudgil, P.; Gupta, R.; Jhandai, P.; Sharma, M.; Jindal, N. Molecular investigations on outbreaks of ovine theileriosis among sheep and goats in Haryana, India. Trop. Anim. Health Prod. 2022, 54, 368. [Google Scholar] [CrossRef]
- Liu, A.H.; Yin, H.; Guan, G.Q.; Schnittger, L.; Liu, Z.J.; Ma, M.L.; Dang, Z.S.; Liu, J.L.; Ren, Q.Y.; Bai, Q.; et al. At least two genetically distinct large Babesia species infective to sheep and goats in China. Vet. Parasitol. 2007, 147, 246–251. [Google Scholar] [CrossRef]
- Moudgil, P.; Grakh, K.; Kumar, R.; Sharma, M.; Gupta, R.; Jindal, N. First Molecular Confirmed Outbreak of Malignant Ovine Theileriosis in Sheep from North India. Acta Parasitol. 2023, 68, 527–534. [Google Scholar] [CrossRef]
- Nangru, A.; Maharana, B.R.; Vohra, S.; Kumar, B.; Ganguly, A.; Sahu, S.; Singh, H.; Ruhil, S.; Khichar, V. Identification, molecular characterization and risk factors of Theileria infection among sheep: A first comprehensive report from North India. Anim. Biotechnol. 2023, 68, 527–534. [Google Scholar] [CrossRef]
- Sang, C.; Yang, M.; Xu, B.; Liu, G.; Yang, Y.; Kairullayev, K.; Bauyrzhan, O.; Hazihan, W.; Hornok, S.; Wang, Y. Tick distribution and detection of Babesia and Theileria species in Eastern and Southern Kazakhstan. Ticks Tick Borne Dis. 2021, 12, 101817. [Google Scholar] [CrossRef]
- Sultankulova, K.T.; Shynybekova, G.O.; Issabek, A.U.; Mukhami, N.N.; Melisbek, A.M.; Chervyakova, O.V.; Kozhabergenov, N.S.; Barmak, S.M.; Bopi, A.K.; Omarova, Z.D.; et al. The Prevalence of Pathogens among Ticks Collected from Livestock in Kazakhstan. Pathogens 2022, 11, 1206. [Google Scholar] [CrossRef] [PubMed]
- Zeb, J.; Song, B.; Senbill, H.; Aziz, M.U.; Hussain, S.; Khan, M.A.; Qadri, I.; Cabezas-Cruz, A.; de la Fuente, J.; Sparagano, O.A. Ticks Infesting Dogs in Khyber Pakhtunkhwa, Pakistan: Detailed Epidemiological and Molecular Report. Pathogens 2023, 12, 98. [Google Scholar] [CrossRef]
- Khan, A.; Ahmed Muhammed, A.; Nasreen, N.; Iqbal, F.; Cossio-Bayugar, R.; Ali Sha, S.S.; Alanazi, A.D.; Zajac, Z. Tick-borne haemoparasitic diseases in small ruminants in Pakistan: Current knowledge and future perspectives. Saudi. J. Biol. Sci. 2022, 29, 2014–2025. [Google Scholar] [CrossRef]
- Chaorattanakawee, S.; Wofford, R.N.; Takhampunya, R.; Katherine Poole-Smith, B.; Boldbaatar, B.; Lkhagvatseren, S.; Altantogtokh, D.; Musih, E.; Nymadawa, P.; Davidson, S.; et al. Tracking tick-borne diseases in Mongolian livestock using next-generation sequencing (NGS). Ticks Tick Borne Dis. 2022, 13, 101845. [Google Scholar] [CrossRef]
- Taqadus, A.; Chiou, C.C.; Amaro-Estrada, I.; Asif, M.; Nasreen, N.; Ahmad, G.; Iqbal, J.; Ali, M.; Khan, A.; Iqbal, F.; et al. Epidemiology and Phylogeny of Anaplasma ovis with a Note on Hematological and Biochemical Changes in Asymptomatic Goats Enrolled from Four Districts in Punjab, Pakistan. Vector Borne Zoonotic Dis. 2023, 23, 495–506. [Google Scholar] [CrossRef] [PubMed]
- Enkhtaivan, B.; Narantsatsral, S.; Davaasuren, B.; Otgonsuren, D.; Amgalanbaatar, T.; Uuganbayar, E.; Zoljargal, M.; Myagmarsuren, P.; Suganuma, K.; Molefe, N.I.; et al. Molecular detection of Anaplasma ovis in small ruminants and ixodid ticks from Mongolia. Parasitol. Int. 2019, 69, 47–53. [Google Scholar] [CrossRef] [PubMed]
- Naeem, M.; Amaro-Estrada, I.; Taqadus, A.; Swelum, A.A.; Alqhtani, A.H.; Asif, M.; Sajid, M.; Khan, A.U.; Tariq, A.; Anjum, S.; et al. Molecular prevalence and associated risk factors of Anaplasma ovis in Pakistani sheep. Front. Vet. Sci. 2023, 10, 1096418. [Google Scholar] [CrossRef] [PubMed]
- Prajapati, A.; Prajapati, B.; Patel, A.; Chauhan, P.; Das, B.; Raval, S.; Suthar, A.; Sutaria, T.; Chaudhari, R.K.; Patel, P.; et al. Molecular identification and genetic characterization of Theileria and Anaplasma infection in sheep and goat of North Gujarat, India. Parasitol. Res. 2023, 122, 1427–1433. [Google Scholar] [CrossRef] [PubMed]
- Wei, Q.Q.; Guo, L.P.; Wang, A.D.; Mu, L.M.; Zhang, K.; Chen, C.F.; Zhang, W.J.; Wang, Y.Z. The first detection of Rickettsia aeschlimannii and Rickettsia massiliae in Rhipicephalus turanicus ticks, in northwest China. Parasit Vectors 2015, 8, 631. [Google Scholar] [CrossRef] [PubMed]
- Yu, P.; Liu, Z.; Niu, Q.; Yang, J.; Abdallah, M.O.; Chen, Z.; Liu, G.; Luo, J.; Yin, H. Molecular evidence of tick-borne pathogens in Hyalomma anatolicum ticks infesting cattle in Xinjiang Uygur Autonomous Region, Northwestern China. Exp. Appl. Acarol. 2017, 73, 269–281. [Google Scholar] [CrossRef] [PubMed]
- Candasamy, S.; Ayyanar, E.; Devaraju, P.; Kumar, A.; Zaman, K.; Bhaskar Mishra, B.; Srinivasan, L.; Purushothaman, J. Evidence on the prevalence of emerging and re-emerging tick- and flea-borne rickettsial agents in acute encephalitis syndrome endemic areas of northeast Uttar Pradesh, India. Med. Vet. Entomol. 2023, 38, 23–37. [Google Scholar] [CrossRef] [PubMed]
- Babu, N.N.; Jayaram, A.; Auti, A.M.; Bhandari, Y.; Shetty, U.; Arunkumar, G. Rickettsia africae and other unclassified Rickettsia species of the spotted fever group in ticks of the Western Ghats, India. Exp. Appl. Acarol. 2023, 90, 429–440. [Google Scholar] [CrossRef] [PubMed]
- Kebzai, F.; Ashraf, K.; Rehman, M.U.; Akbar, H.; Avais, M.; Khan, M. Molecular and seroepidemiological investigation of Coxiella burnetii and spotted fever group rickettsiae in the southern region of Kazakhstan. Ticks Tick Borne Dis. 2023, 14, 102240. [Google Scholar] [CrossRef]
- Ali, A.; Zahid, H.; Zeb, I.; Tufail, M.; Khan, S.; Haroon, M.; Tufail, M.; Bilal, M.; Hussain, M.; Alouffi, A.S.; et al. Risk factors associated with tick infestations on equids in Khyber Pakhtunkhwa, Pakistan, with notes on Rickettsia missile detection. Parasit Vectors 2021, 14, 363. [Google Scholar] [CrossRef] [PubMed]
- Shehla, S.; Ullah, F.; Alouffi, A.; Almutairi, M.M.; Khan, Z.; Tanaka, T.; Labruna, M.B.; Tsai, K.H.; Ali, A. Association of SFG Rickettsia massiliae and Rickettsia shennongii with Different Hard Ticks Infesting Livestock Hosts. Pathogens 2023, 12, 1080. [Google Scholar] [CrossRef] [PubMed]
- Kartashov, M.Y.; Kononova, Y.V.; Petrova, I.D.; Tupota, N.L.; Mikryukova, T.P.; Ternovoi, V.A.; Tishkova, F.H.; Loktev, V.B. Detection of Ehrlichia spp. and Theileria spp. in Hyalomma anatolicum ticks collected in Tajikistan. Vavilovskii Zhurnal Genet Selektsii 2020, 24, 55. [Google Scholar] [CrossRef] [PubMed]




| Sample | Number of Positive Tick Pool Pathogen Species (%) | ||||||
|---|---|---|---|---|---|---|---|
| Tick Species | Area | No. of Sheep | No. of Pool | A. ovis | Rickettsia spp. | T. ovis | |
| Rh. turanicus | Aksu | Village A | 24 | 55 | 5 (9.09) | 52 (94.54) | 6 (10.91) |
| Village B | 12 | 39 | 2 (5.13) | 5 (12.82) | 3 (7.69) | ||
| Farm C | 12 | 92 | 41 (44.57) | 65 (70.65) | 38 (41.30) | ||
| Wensu | Farm D | 20 | 7 | 4 (57.14) | 7 (100.00) | 1 (14.29) | |
| Farm E | 20 | 9 | 2 (22.22) | 3 (33.33) | 5 (55.56) | ||
| Shufu | Village F | 20 | - | - | - | - | |
| Akto | Village G | 20 | 6 | 3 (50.00) | 2 (33.33) | 2 (33.33) | |
| Subtotal | 128 | 208 | 57 (27.40) | 134 (64.42) | 55 (26.44) | ||
| H. anatolicum | Aksu | Village A | 24 | - | - | - | - |
| Village B | 12 | - | - | - | - | ||
| Farm C | 12 | 7 | 1 (14.29) | 1 (14.29) | 1 (14.29) | ||
| Wensu | Farm D | 20 | - | - | - | - | |
| Farm E | 20 | 57 | 2 (3.51) | 6 (10.53) | 19 (33.33) | ||
| Shufu | Village F | 20 | 26 | - | 1 (3.85) | 11 (42.31) | |
| Akto | Village G | 20 | - | - | - | - | |
| Subtotal | 128 | 90 | 3 (3.33) | 8 (8.89) | 31 (34.44) | ||
| Total | 128 | 298 | 60 (20.13) | 142 (47.65) | 86 (28.86) | ||
| Parameter | Hemoparasites | Number of Pools (%, 95%CI) | ||
|---|---|---|---|---|
| Rh. turanicus (N = 208) | H. anatolicum (N = 90) | Total (N = 298) | ||
| Single infection | A. ovis | 1 (0.48, 0–1.43) | 3 (3.33, 0–7.11) | 4 (1.34, 0.02–2.66) |
| Rickettsia spp. | 73 (35.10, 28.56–41.64) | 4 (4.44, 0.10–8.79) | 77 (25.84, 20.84–30.84) | |
| T. ovis | 21 (10.10, 5.97–14.22) | 27 (30.0, 20.35–39.65) | 48 (16.11, 11.91–20.09) | |
| Sub-total | 95 (45.67) | 34 (37.78) | 129 (43.29) | |
| Co-infection | A. ovis + Rickettsia spp. | 32 (15.38, 10.44–20.33) | - | 32 (10.74, 7.20–14.27) |
| A. ovis + T. ovis | 5 (2.40, 0.31–4.50) | - | 5 (1.68, 0.21–3.15) | |
| Rickettsia spp. + T. ovis | 10 (4.81, 1.88–7.74) | 4 (4.44, 0.10–8.79) | 14 (4.70, 2.28–7.11) | |
| A. ovis + Rickettsia spp. + T. ovis | 19 (9.14, 5.19–13.08) | - | 19 (6.38, 3.59–9.17) | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Y.; Li, J.; Xieripu, G.; Rizk, M.A.; Macalanda, A.M.C.; Gan, L.; Ren, J.; Mohanta, U.K.; El-Sayed, S.A.E.-S.; Chahan, B.; et al. Molecular Detection of Theileria ovis, Anaplasma ovis, and Rickettsia spp. in Rhipicephalus turanicus and Hyalomma anatolicum Collected from Sheep in Southern Xinjiang, China. Pathogens 2024, 13, 680. https://doi.org/10.3390/pathogens13080680
Li Y, Li J, Xieripu G, Rizk MA, Macalanda AMC, Gan L, Ren J, Mohanta UK, El-Sayed SAE-S, Chahan B, et al. Molecular Detection of Theileria ovis, Anaplasma ovis, and Rickettsia spp. in Rhipicephalus turanicus and Hyalomma anatolicum Collected from Sheep in Southern Xinjiang, China. Pathogens. 2024; 13(8):680. https://doi.org/10.3390/pathogens13080680
Chicago/Turabian StyleLi, Yongchang, Jianlong Li, Gulaimubaier Xieripu, Mohamed Abdo Rizk, Adrian Miki C. Macalanda, Lu Gan, Jichao Ren, Uday Kumar Mohanta, Shimaa Abd El-Salam El-Sayed, Bayin Chahan, and et al. 2024. "Molecular Detection of Theileria ovis, Anaplasma ovis, and Rickettsia spp. in Rhipicephalus turanicus and Hyalomma anatolicum Collected from Sheep in Southern Xinjiang, China" Pathogens 13, no. 8: 680. https://doi.org/10.3390/pathogens13080680
APA StyleLi, Y., Li, J., Xieripu, G., Rizk, M. A., Macalanda, A. M. C., Gan, L., Ren, J., Mohanta, U. K., El-Sayed, S. A. E.-S., Chahan, B., Xuan, X., & Guo, Q. (2024). Molecular Detection of Theileria ovis, Anaplasma ovis, and Rickettsia spp. in Rhipicephalus turanicus and Hyalomma anatolicum Collected from Sheep in Southern Xinjiang, China. Pathogens, 13(8), 680. https://doi.org/10.3390/pathogens13080680

