Next Article in Journal
Hepatitis C Elimination in Egypt: Story of Success
Previous Article in Journal
Conference Report: LPMHealthcare Emerging Viruses 2023 (EVOX23): Pandemics—Learning from the Past and Present to Prepare for the Future
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Detection of Theileria ovis, Anaplasma ovis, and Rickettsia spp. in Rhipicephalus turanicus and Hyalomma anatolicum Collected from Sheep in Southern Xinjiang, China

by
Yongchang Li
1,2,†,
Jianlong Li
1,†,
Gulaimubaier Xieripu
1,
Mohamed Abdo Rizk
2,3,
Adrian Miki C. Macalanda
2,4,
Lu Gan
1,
Jichao Ren
1,
Uday Kumar Mohanta
2,5,
Shimaa Abd El-Salam El-Sayed
2,6,
Bayin Chahan
1,
Xuenan Xuan
2,* and
Qingyong Guo
1,*
1
Parasitology Laboratory, Veterinary College, Xinjiang Agricultural University, Urumqi 830011, China
2
National Research Center for Protozoan Diseases, Obihiro University of Agriculture and Veterinary Medicine, Obihiro 080-8555, Japan
3
Department of Internal Medicine and Infectious Diseases, Faculty of Veterinary Medicine, Mansoura University, Mansoura 35516, Egypt
4
Department of Immunopathology and Microbiology, College of Veterinary Medicine and Biomedical Sciences, Cavite State University, Indang 4122, Philippines
5
Department of Microbiology and Parasitology, Sher–e–Bangla Agricultural University, Sher–e–Bangla Nagar, Dhaka 1207, Bangladesh
6
Department of Biochemistry and Chemistry of Nutrition, Faculty of Veterinary Medicine, Mansoura University, Mansoura 35516, Egypt
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Pathogens 2024, 13(8), 680; https://doi.org/10.3390/pathogens13080680
Submission received: 30 June 2024 / Revised: 9 August 2024 / Accepted: 10 August 2024 / Published: 11 August 2024
(This article belongs to the Topic Ticks and Tick-Borne Pathogens)

Abstract

The Xinjiang Uygur Autonomous Region (Xinjiang) borders eight countries and has a complex geographic environment. There are almost 45.696 million herded sheep in Xinjiang, which occupies 13.80% of China’s sheep farming industry. However, there is a scarcity of reports investigating the role of sheep or ticks in Xinjiang in transmitting tick-borne diseases (TBDs). A total of 894 ticks (298 tick pools) were collected from sheep in southern Xinjiang. Out of the 298 tick pools investigated in this study, Rhipicephalus turanicus (Rh. turanicus) and Hyalomma anatolicum (H. anatolicum) were identified through morphological and molecular sequencing. In the southern part of Xinjiang, 142 (47.65%), 86 (28.86%), and 60 (20.13%) tick pools were positive for Rickettsia spp., Theileria spp., and Anaplasma spp., respectively. Interestingly, the infection rate of Rickettsia spp. (73%, 35.10%, and 28.56–41.64%) was higher in Rh. turanicus pools than in H. anatolicum pools (4%, 4.44%, and 0.10–8.79%) in this study. Fifty-one tick pools were found to harbor two pathogens, while nineteen tick pools were detected to have the three pathogens. Our findings indicate the presence of Rickettsia spp., Theileria spp., and Anaplasma spp. potentially transmitted by H. anatolicum and Rh. turanicus in sheep in southern Xinjiang, China.

1. Introduction

Ticks and tick-borne diseases (TBDs) are a growing global problem that can have a detrimental impact on both human and animal health. As ticks are the second most common vectors worldwide, the biosurveillance of TBDs, such as piroplasmosis (babesiosis and theileriosis), anaplasmosis, and rickettsiosis, is crucial for protecting public and animal health. Ticks and TBDs negatively affect animal production, leading to pruritus, weight loss, reduced immunity, fever, anemia, and even death [1].
In Asia, tick-borne pathogens have become a concern in many countries in recent years, including China, Mongolia, India, Tajikistan, and Pakistan [2,3]. The identification and control of several tick-borne diseases are also a concern for sheep. Sheep can be affected by TBDs, such as Theileria spp., Anaplasma spp., and Rickettsia spp. Additionally, these pathogens were detected near the border of the Xinjiang Uygur Autonomous Region (Xinjiang). For example, the Theileria ovis (T. ovis), Anaplasma ovis (A. ovis), and Rickettsia species have been reported in Pakistan and Tajikistan [4].
Importantly, Xinjiang shares its borders with eight other countries and has a complex geographic environment that includes diverse features, such as mountains, plateaus, deserts, and basins. This region is typically divided into two distinct climatic zones: the north, with a temperate continental arid and semi-arid climate, and the south with a warm temperate continental arid climate. These two zones are separated by the Tianshan Mountains [5]. According to the Xinjiang Statistics Bureau (https://tjj.xinjiang.gov.cn/tjj/tjgn/202203/7ab304445f174a7eb1f5165be4f94041.shtml, accessed on 25 December 2023) [6], Xinjiang has approximately 45.696 million sheep, comprising 13.8% of China’s total sheep farming industry. However, despite the importance of the sheep industry in Xinjiang and China as a whole, there are few studies on ticks in sheep, which are known to transmit tick-borne diseases (TBDs) or tick-borne pathogens (TBPs).
A previous study identified 12 tick species on five animal species, including sheep, in northern Xinjiang counties [7]. However, information about the pathogens carried or transmitted by ticks in southern Xinjiang remains limited. Therefore, this study was conducted to identify and characterize the pathogens harbored or transmitted by tick species collected from sheep in southern Xinjiang.

2. Materials and Methods

2.1. Tick Sample Collection

A total of 894 partially engorged adult ticks (female and male) were randomly collected from three districts (Aksu, Kashgar, and Kizilsu Kirgizil) and seven locations in southern Xinjiang, China. Farms A, B, and C are located in Aksu-Aksu, while Farms D and E are in Aksu-Wensu. Additionally, ticks were also collected from Kashgar-Shufu and Kizilsu Kirgizil-Akto (Figure 1). These ticks were collected from the body surfaces of 128 asymptomatic sheep across four regions: Aksu (48 sheep), Wensu (40 sheep), Shufu (20 sheep), and Akto County (20 sheep). Briefly, the ticks were collected from the surface of the sheep, including the ear, perineum, perianal areas, and the base of the tail [7]. The ticks were initially washed with phosphate-buffered saline (PBS, pH 7.2) and subsequently sonicated using ultrasonic waves (80 kHz) for 30 min. All ticks were immersed in boiling water and individually preserved in labeled vials containing 70% ethanol. Before DNA extraction, the ticks were again washed with 70% ethanol and air-dried. The protocol for this study was approved by the Committee on the Ethics of Animal Experiments at the Obihiro University of Agriculture and Veterinary Medicine, Japan (Permit numbers: animal experiment, 230244; DNA experiment, AP0001299621; Pathogen, AP0001299622; Ethical approval numbers, 22–23 and 23–17).

2.2. Tick Identification

The collected ticks were identified morphologically using published identification keys [8,9]. Specifically, the genera of the ticks were classified based on features such as the basis capituli, scutum, and spiracular plates [8,9].

2.3. DNA Extraction

In each sampling county, tick specimens morphologically identified as the same tick species were randomly selected for pathogen detection. Three ticks from the same region and farm, morphologically identified as the same species, were pooled. This pool was washed three times with 1× PBS, ground in liquid nitrogen using a mortar and pestle, and resuspended in 200 μL of 1× PBS. Genomic DNA was extracted from this suspension using a resin-based DNA extraction kit (TIANGEN, Beijing, China) and stored at −20 °C according to the manufacturer’s instructions.

2.4. Molecular Characterization of the Tick Species and Characterization of Tick-Borne Pathogens

The molecular identification of the most common tick species was carried out using PCR assays. Target primers for partial sequences of Babesia spp. 18S rRNA, Theileria spp. 18S rRNA, Rickettsia spp. outer membrane protein (OmpA), and Anaplasma spp. major surface protein (Msp4) were employed [7,10,11,12]. In brief, all adult ticks (894) were screened via PCR using the primers listed in Table A1. PCR products were visualized on a 1.0% agarose gel stained with ethidium bromide under UV light [7].
All amplicons were extracted from the gels using a TIANquick Midi Purification Kit (TIANGEN, Beijing, China) and sequenced. The purified PCR products (pathogen DNA amplicons) were cloned using a pGEM-T Easy Vector (Promega, Madison, WI, USA). The plasmids were sent to Shanghai Sangon Company for sequencing [7].
The identities and similarities of the sequenced isolates were assessed using the BLASTn tool against the NCBI GenBank database and the Clustal X program. Phylogenetic trees were constructed using the maximum likelihood (ML) method with the Kimura 2-parameter model in MEGA version 7.0. Bootstrap support values (1000 replicates) were indicated at each node. Confidence intervals (95% CI) and one-way ANOVA analyses were conducted using GraphPad Prism 6.0.

3. Results

3.1. Rh. turanicus and H. anatolicum Are the Identified Tick Species Based on Morphology and Molecular Methods

The morphological and molecular observation identified adult ticks (894) belonging to two tick genera, 624 (208 pools) to Rhipicephalus turanicus (Rh. turanicus) and 270 (90 pools) to Hyalomma anatolicum (H. anatolicum), which were collected from sheep (Figure 1; Table 1).

3.2. Pathogens

Three pathogens were identified in the pools of Rh. turanicus and H. anatolicum. The total infection rates of Rickettsia spp., Anaplasma spp., and Theileria spp. were 47.65% (142/298), 20.13% (60/298), and 28.86% (86/298), respectively. Both ticks were investigated for Rickettsia spp. in Aksu and Wensu, Xinjiang (Table 1). Interestingly, the infection rate of Rickettsia spp. (35.10%, with a range of 28.56–41.64%) was higher and more easily identified in Rh. turanicus (73 samples) compared to H. anatolicum (4 samples, 4.44%, with a range of 0.10–8.79%). A total of 51 ticks had double infections, and 19 had triple infections. The most common co-infection was A. ovis + Rickettsia spp. (15.38%, 10.44–20.33), followed by Rickettsia spp. + T. ovis (4.70%, 2.28–7.11) and A. ovis + T. ovis (1.68%, 0.21–3.15) (Table 2). Nineteen Rh. turanicus pools (9.14%, 5.19–13.08) carried all three pathogens Rickettsia spp., A. ovis, and T. ovis, while only Rickettsia spp. and T. ovis were identified as co-infections in H. anatolicum.

3.3. Analyses of the Three Pathogens’ DNA Sequences

PCR amplicons from positive samples were cloned and sequenced. T. ovis 18S rDNA (GenBank Accession no. PP065759, PP065760) from Xinjiang shared a 99.61% sequence identity with T. ovis (MN712508). Interestingly, the T. ovis 18S rRNA sequences formed a distinct cluster and illustrated a close relationship with the sequences from Iraq (MT732332) and Thailand (OM802548) (Figure 2). Two A. ovis Msp4 sequences obtained in this study exhibited a 99.62% identity with A. ovis (MN198191). Two isolates (GenBank Accession no. PP104810-PP104811) shared a 99.62% nucleotide sequence identity with A. ovis obtained from goats (FJ460454) in Cyprus and sheep (MF002530) in Italy (Figure 3). Rickettsia spp. OmpA (GenBank Accession no. PP104812) from Xinjiang shared 99.68% and 99.68% sequence identity to Rickettsia massiliae (KR401143) and R. raoultii (NR043755), respectively. The phylogenetic analysis revealed two distinct Rickettsia spp. clades. One clade included the Xinjiang isolate and sequences from Spain (KR401146) and China (Xinjiang, MF098409). The other clade showed a close relationship between PP104813 (Candidatus Rickettsia barbariae) and an isolate from Israel (GU212860) (Figure 4).

4. Discussion

Xinjiang, a region in China with a complex geographic environment, has experienced a surge in the ruminant trade since the launch of the “Silk Road Economic Belt” initiative. Xinjiang shares extensive borders with eight countries, including India, Pakistan, Afghanistan, Tajikistan, Kyrgyzstan, Kazakhstan, Russia, and Mongolia. Due to this proximity, animal transport across these borders may also increase the likelihood of disease introduction into China. The risk of tick-borne pathogens (TBPs) entering China through animal transport is also increased. Such introductions pose a significant threat to both Xinjiang’s livestock industry and the nation as a whole, as animals carrying disease and tick vectors can be transported throughout China. Despite the importance of understanding TBPs in sheep from southern Xinjiang, knowledge gaps persist regarding their genetic diversity and transmission. This study aimed to identify and characterize the pathogens harbored by two tick species (Rh. turanicus and H. anatolicum) collected from sheep in southern Xinjiang.
Given the four outbreaks of theileriosis in small ruminants from 2020 to 2022 in other countries, with morbidity rates of 27.95% and mortality rates 17.46% lower than the 62.5% case fatality rate observed in India [13], theileriosis in sheep warrants more attention in Xinjiang. T. ovis and T. lestoquardi were identified and analyzed in these four outbreaks [13]. The first identified case of Theileria in sheep and goats from China dates back to 2007 [14], subsequently identified as T. ovis. In the present study, T. ovis identified in both Rh. turanicus and H. anatolicum were found on sheep from southern Xinjiang, China. Additionally, H. anatolicum was detected on one of the deceased sheep with a history of contact with the malignant ovine theileriosis outbreak, as reported by Moudgil et al. (2023) [15]. Further investigations in India reported T. ovis (29.1%), T. lestoquardi (12.69%), and T. luwenshuni (5.97%) in sheep [16]. An epidemiological investigation of T. lestoquardi was also conducted in Pakistan [3].
The Aksu (Aksu and Wensu) area in the southern part of Xinjiang, near Kazakhstan and Kyrgyzstan, shows the presence of T. ovis, which is aligned with findings by Sang (2021) [17] and Sultankulova (2022) [18]. This situation was similar to those in Kizilsu Kirgizil (Akto) and Kashgar (Shufu) regions, near Afghanistan and Pakistan. T. ovis has been reported only in Pakistan, where Rhipicephalus turanicus has also been identified [4,19]. Studies have also documented the molecular detection of Theileria spp. in ticks and ruminants in Kazakhstan, with Rh. turanicus identified as a potential vector of T. ovis in the southern part of Kazakhstan [17,18]. Our findings support this hypothesis, suggesting Rh. turanicus as potential vector for T. ovis transmission between Xinjiang, China, and Kazakhstan. Comparable infection rates were observed for A. marginale (11%), A. ovis (28%), and T. ovis (3%) in goats and sheep from Pakistan [4]. Additionally, Rh. turanicus and H. anatolicum were among over 15 tick species, including Hyalomma, Rhipicephalus, Dermacentor, and Amblyomma, identified as carrying these pathogens in Pakistan [20].
To date, limited research has been conducted on Anaplasma spp. While economic development has increased in Kazakhstan, Tajikistan, Kyrgyzstan, and Pakistan, studies on Anaplasma in these regions remain limited. An overall prevalence of 69.4% (59/85) and 80.5% (70/85) was reported in Mongolia for A. ovis in goats and sheep, respectively [21]. A. ovis prevalence in goats was 15% (185/1200), including cases reported in Punjab, Pakistan [22]. Although Rh. turanicus was not identified in Mongolia, according to Enkhtaivan et al. (2019) [23], H. asiaticum was the main vector in Mongolia; therefore, the outcome of their research was similar to that of our study. Our observed A. ovis infection rate of 12.5% and the phylogenetic analysis showed resemblance to the sequences found in China [24]. A comparison with studies from India revealed higher T. ovis (37.2%) but similar A. ovis (15.4%) infection rates in sheep [25]. Moudgil et al. also implicated that T. lestoquardi, which causes malignant ovine theileriosis, may also be transmitted by ticks. Moreover, a previous study detected R. massiliae and Candidatus R. barbariae in Rh. turanicus from dogs in Xinjiang, China [8].
Nine Rickettsia spp. from the spotted fever group (SFG) were identified, including R. massiliae and Candidatus R. barbariae [8]. These species were detected in H. anatolicum and Rh. turanicus [26,27]. Compared to those detected in India, where 29 samples were found to be R. massiliae [28]; other Rickettsia species included Rickettsia conorii, Rickettsia asembonensis, and Candidatus Rickettsia senegalensis [28,29]. Candidatus R. barbariae has also been identified in ticks from Kazakhstan [30], specifically in Rh. turanicus. Hay’s report on Kazakhstan included investigations of R. sibirica, R. conorii, R. slovaca, R. raoultii, and R. aeschlimannii-like [2]. In previous research, Candidatus R. barbariae was found in Melophagus ovinus parasitizing the red fox (Vulpes vulpes) and Rh. turanicus in pet dogs in Xinjiang [8]. Rh. turanicus (39.7%) and H. anatolicum (11.2%) were identified in equids from Pakistan, while R. massiliae was also detected [31]. Shehla et al. (2023) further confirmed R. massiliae harbored in H. anatolicum and Rh. turanicus in Pakistan [32]. Although Kartashov (2020) explored the infection of Rickettsia spp. in Tajikistan, no positive cases were reported [33].

5. Conclusions

While this study provides valuable insights into the population structures and epidemiological distribution of TBPs in ticks from sheep in southern Xinjiang, China, it did not determine the infection in sheep and is limited by its focus on the tick vector. Future research should investigate the prevalence of the identified pathogens in the blood DNA samples of local ruminants in China and its surroundings to assess the true impact on animal health. Additionally, identifying risk factors for TBDs in sheep at both the individual animal and farm levels is essential for effective disease control and prevention.
In conclusion, Rh. turanicus and H. anatolicum were the two identified tick species from sheep in southern Xinjiang. Rickettsia spp. was the most frequently detected TBP in both species, followed by Theileria spp., and Anaplasma spp. Co-infections with two or three TBPs were common among tick species in sheep from southern Xinjiang. The sequencing analysis showed that 99–100% of A. ovis Msp4 and Rickettsia spp. were present in T. ovis OmpA from southern Xinjiang. When compared to known isolates from other countries, the OmpA sequences displayed 99–100% identity. Our research indicates that Rickettsia, Theileria, and Anaplasma species are prevalent among H. anatolicum and Rh. turanicus ticks in sheep in southern Xinjiang. This study highlights several important aspects of TBP status in sheep in southern Xinjiang, China, which have serious economic implications for the sheep industry in Asian countries. These aspects should help in the development and implementation of effective prevention and control measures for veterinary practitioners and animal owners.

Author Contributions

Conceptualization, X.X. and Q.G.; methodology, Y.L. and J.L.; software, Y.L. and G.X.; validation, L.G. and J.R.; formal analysis, U.K.M. and S.A.E.-S.E.-S.; investigation, G.X., J.L. and J.R.; resources, G.X. and Q.G.; data curation, G.X. and J.L.; writing—original draft preparation, Y.L. and J.L.; writing—review and editing, M.A.R., A.M.C.M., B.C. and U.K.M.; visualization, Y.L.; supervision, X.X. and Q.G.; project administration, B.C., X.X. and Q.G.; funding acquisition, B.C., X.X. and Q.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the following projects Innovative research team on biological vectors and transmission of vector-borne zoonotic diseases in the Xinjiang Uygur Autonomous Region (No. 2023TSYCTD0008), National Key Research and Development Program of China (No. 2021YFD1600702-3), Shanghai Cooperation Organization of Xinjiang Uygur Autonomous Region (No. 2021E01001), Postdoctoral program of Xinjiang Agricultural University, Xinjiang Uygur Autonomous Region, the AMED project (Grant No. JP23WM02250317), and the Strategic International Collaborative Research Project (JP008837) promoted by the Ministry of Agriculture, Forestry, and Fisheries of Japan.

Institutional Review Board Statement

All protocols were carried out according to the ethical guidelines approved by the Obihiro University of Agriculture and Veterinary Medicine (Permit for the animal experiment: 18-40).

Informed Consent Statement

Not applicable.

Data Availability Statement

All data are disclosed in the paper.

Acknowledgments

We are grateful to the farmers for their cooperation and the state veterinarians for their assistance in tick sample collection in the field.

Conflicts of Interest

The authors declare no conflicts of interest.

Appendix A

Table A1. Sequence information of primers for the molecular biological identification and pathogen detection of ticks.
Table A1. Sequence information of primers for the molecular biological identification and pathogen detection of ticks.
NameGeneFragment SizePrimers (5′-3′)
Forward and Downward
References
Tick speciesCOI709 bpGGTCAACAAATCATA
AAGATATTGG
[5]
TAAACTTCAGGGTGA
CCAAAAAATCA
16S rDNA461 bpTCGTCTGTCTGAGGGTCGGA
ATCGTCTCGTGTAGCGTCG
Theileria spp.18S rRNA1421 bpGTCTTGTAATTGGAATGATGG[12]
TAGTTTATGGTTAGGACTACG
Rickettsia spp.OmpA632 bpATGGCGAATATTTCTCCAAAA[5]
GTTCCGTTAATGGCAGCATCT
Anaplasma spp.Msp4852 bpGGGAGCTCCTATGAATT
ACAGAGAATTGTTTAC
[11]
CCGGATCCTTAGCTGA
ACAGGAATCTTGC

References

  1. de la Fuente, J.; Estrada-Peña, A.; Rafael, M.; Almazán, C.; Bermúdez, S.; Abdelbaset, A.E.; Kasaija, P.D.; Kabi, F.; Akande, F.A.; Ajagbe, D.O.; et al. Perception of Ticks and Tick-Borne Diseases Worldwide. Pathogens 2023, 12, 1258. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Hay, J.; Yeh, K.B.; Dasgupta, D.; Shapieva, Z.; Omasheva, G.; Deryabin, P.; Nurmakhanov, T.; Ayazbayev, T.; Andryushchenko, A.; Zhunushov, A.; et al. Biosurveillance in Central Asia: Successes and Challenges of Tick-Borne Disease Research in Kazakhstan and Kyrgyzstan. Front. Public Health 2016, 4, 4. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Kebzai, F.; Ashraf, K.; Rehman, M.U.; Akbar, H.; Avais, M.; Khan, M. Molecular detection and assessment of risk factors for Theileria lestoquardi in sheep from Balochistan, Pakistan. Parasitol. Res. 2023, 122, 2957–2965. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Arif, M.; Saeed, S.; Bashir, A.; Farooq, M.; Nasreen, N.; Khan, A.; Asif, M.; Khalil, M.A.; Ijaz, M.; Muqaddas, H.; et al. Molecular prevalence and phylogeny of Anaplasma marginale, Anaplasma ovis, and Theileria ovis in goats and sheep enrolled from a hill station in Punjab, Pakistan. PLoS ONE 2023, 18, e0291302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Li, Y.; Galon, E.M.; Guo, Q.; Rizk, M.A.; Moumouni, P.F.; Liu, M.; Li, J.; Ji, S.; Chahan, B.; Xuan, X. Molecular Detection and Identification of Babesia spp., Theileria spp., and Anaplasma spp. in Sheep From Border Regions, Northwestern China. Front. Vet. Sci. 2020, 7, 630. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Statistic Bureau of Xinjiang Uygur Autonomous Region. 2021. Available online: https://tjj.xinjiang.gov.cn/tjj/tjgn/202203/7ab304445f174a7eb1f5165be4f94041.shtml (accessed on 25 December 2023).
  7. Li, Y.; Wen, X.; Li, M.; Moumouni, P.F.A.; Galon, E.M.; Guo, Q.; Rizk, M.A.; Liu, M.; Li, J.; Ji, S.; et al. Molecular detection of tick-borne pathogens harbored by ticks collected from livestock in the Xinjiang Uygur Autonomous Region, China. Ticks Tick Borne Dis. 2020, 11, 101478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Li, S.A.; Zhang, L.; Li, Z.; Song, H.N.; Que, Z.W.; Zhao, S.Y.; Li, Y.Y.; Guo, Y.L.; Wu, J.Y. Detection of Rickettsia spp. and Anaplasma ovis in Melophagus ovinus from southern Xinjiang, China. Med. Vet. Entomol. 2023, 37, 865–870. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Guo, J.; Song, S.; Cao, S.; Sun, Z.; Zhou, Q.; Deng, X.; Zhao, T.; Chai, Y.; Zhu, D.; Chen, C.; et al. Molecular Detection of Zoonotic and Veterinary Pathogenic Bacteria in Pet Dogs and Their Parasitizing Ticks in Junggar Basin, North-Western China. Front. Vet. Sci. 2022, 9, 895140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Casati, S.; Sager, H.; Gern, L.; Piffaretti, J.C. Presence of potentially pathogenic Babesia sp. for humans in Ixodes ricinus in Switzerland. Ann. Agric. Environ. Med. 2006, 13, 65–70. [Google Scholar] [CrossRef] [Scilit]
  11. de la Fuente, J.; Atkinson, M.W.; Naranjo, V.; Fernández de Mera, I.G.; Mangold, A.J.; Keating, K.A.; Kocan, K.M. Sequence analysis of the msp4 gene of Anaplasma ovis strains. Vet. Microbiol. 2007, 119, 375–381. [Google Scholar] [CrossRef] [Scilit]
  12. Zaeemi, M.; Haddadzadeh, H.; Khazraiinia, P.; Kazemi, B.; Bandehpour, M. Identification of different Theileria species (Theileria lestoquardi, Theileria ovis, and Theileria annulata) in naturally infected sheep using nested PCR-RFLP. Parasitol. Res. 2011, 108, 837–843. [Google Scholar] [CrossRef] [Scilit]
  13. Kumar, R.; Moudgil, P.; Gupta, R.; Jhandai, P.; Sharma, M.; Jindal, N. Molecular investigations on outbreaks of ovine theileriosis among sheep and goats in Haryana, India. Trop. Anim. Health Prod. 2022, 54, 368. [Google Scholar] [CrossRef] [Scilit]
  14. Liu, A.H.; Yin, H.; Guan, G.Q.; Schnittger, L.; Liu, Z.J.; Ma, M.L.; Dang, Z.S.; Liu, J.L.; Ren, Q.Y.; Bai, Q.; et al. At least two genetically distinct large Babesia species infective to sheep and goats in China. Vet. Parasitol. 2007, 147, 246–251. [Google Scholar] [CrossRef] [Scilit]
  15. Moudgil, P.; Grakh, K.; Kumar, R.; Sharma, M.; Gupta, R.; Jindal, N. First Molecular Confirmed Outbreak of Malignant Ovine Theileriosis in Sheep from North India. Acta Parasitol. 2023, 68, 527–534. [Google Scholar] [CrossRef] [Scilit]
  16. Nangru, A.; Maharana, B.R.; Vohra, S.; Kumar, B.; Ganguly, A.; Sahu, S.; Singh, H.; Ruhil, S.; Khichar, V. Identification, molecular characterization and risk factors of Theileria infection among sheep: A first comprehensive report from North India. Anim. Biotechnol. 2023, 68, 527–534. [Google Scholar] [CrossRef] [Scilit]
  17. Sang, C.; Yang, M.; Xu, B.; Liu, G.; Yang, Y.; Kairullayev, K.; Bauyrzhan, O.; Hazihan, W.; Hornok, S.; Wang, Y. Tick distribution and detection of Babesia and Theileria species in Eastern and Southern Kazakhstan. Ticks Tick Borne Dis. 2021, 12, 101817. [Google Scholar] [CrossRef] [Scilit]
  18. Sultankulova, K.T.; Shynybekova, G.O.; Issabek, A.U.; Mukhami, N.N.; Melisbek, A.M.; Chervyakova, O.V.; Kozhabergenov, N.S.; Barmak, S.M.; Bopi, A.K.; Omarova, Z.D.; et al. The Prevalence of Pathogens among Ticks Collected from Livestock in Kazakhstan. Pathogens 2022, 11, 1206. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Zeb, J.; Song, B.; Senbill, H.; Aziz, M.U.; Hussain, S.; Khan, M.A.; Qadri, I.; Cabezas-Cruz, A.; de la Fuente, J.; Sparagano, O.A. Ticks Infesting Dogs in Khyber Pakhtunkhwa, Pakistan: Detailed Epidemiological and Molecular Report. Pathogens 2023, 12, 98. [Google Scholar] [CrossRef] [Scilit]
  20. Khan, A.; Ahmed Muhammed, A.; Nasreen, N.; Iqbal, F.; Cossio-Bayugar, R.; Ali Sha, S.S.; Alanazi, A.D.; Zajac, Z. Tick-borne haemoparasitic diseases in small ruminants in Pakistan: Current knowledge and future perspectives. Saudi. J. Biol. Sci. 2022, 29, 2014–2025. [Google Scholar] [CrossRef] [Scilit]
  21. Chaorattanakawee, S.; Wofford, R.N.; Takhampunya, R.; Katherine Poole-Smith, B.; Boldbaatar, B.; Lkhagvatseren, S.; Altantogtokh, D.; Musih, E.; Nymadawa, P.; Davidson, S.; et al. Tracking tick-borne diseases in Mongolian livestock using next-generation sequencing (NGS). Ticks Tick Borne Dis. 2022, 13, 101845. [Google Scholar] [CrossRef] [Scilit]
  22. Taqadus, A.; Chiou, C.C.; Amaro-Estrada, I.; Asif, M.; Nasreen, N.; Ahmad, G.; Iqbal, J.; Ali, M.; Khan, A.; Iqbal, F.; et al. Epidemiology and Phylogeny of Anaplasma ovis with a Note on Hematological and Biochemical Changes in Asymptomatic Goats Enrolled from Four Districts in Punjab, Pakistan. Vector Borne Zoonotic Dis. 2023, 23, 495–506. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Enkhtaivan, B.; Narantsatsral, S.; Davaasuren, B.; Otgonsuren, D.; Amgalanbaatar, T.; Uuganbayar, E.; Zoljargal, M.; Myagmarsuren, P.; Suganuma, K.; Molefe, N.I.; et al. Molecular detection of Anaplasma ovis in small ruminants and ixodid ticks from Mongolia. Parasitol. Int. 2019, 69, 47–53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Naeem, M.; Amaro-Estrada, I.; Taqadus, A.; Swelum, A.A.; Alqhtani, A.H.; Asif, M.; Sajid, M.; Khan, A.U.; Tariq, A.; Anjum, S.; et al. Molecular prevalence and associated risk factors of Anaplasma ovis in Pakistani sheep. Front. Vet. Sci. 2023, 10, 1096418. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Prajapati, A.; Prajapati, B.; Patel, A.; Chauhan, P.; Das, B.; Raval, S.; Suthar, A.; Sutaria, T.; Chaudhari, R.K.; Patel, P.; et al. Molecular identification and genetic characterization of Theileria and Anaplasma infection in sheep and goat of North Gujarat, India. Parasitol. Res. 2023, 122, 1427–1433. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Wei, Q.Q.; Guo, L.P.; Wang, A.D.; Mu, L.M.; Zhang, K.; Chen, C.F.; Zhang, W.J.; Wang, Y.Z. The first detection of Rickettsia aeschlimannii and Rickettsia massiliae in Rhipicephalus turanicus ticks, in northwest China. Parasit Vectors 2015, 8, 631. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Yu, P.; Liu, Z.; Niu, Q.; Yang, J.; Abdallah, M.O.; Chen, Z.; Liu, G.; Luo, J.; Yin, H. Molecular evidence of tick-borne pathogens in Hyalomma anatolicum ticks infesting cattle in Xinjiang Uygur Autonomous Region, Northwestern China. Exp. Appl. Acarol. 2017, 73, 269–281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Candasamy, S.; Ayyanar, E.; Devaraju, P.; Kumar, A.; Zaman, K.; Bhaskar Mishra, B.; Srinivasan, L.; Purushothaman, J. Evidence on the prevalence of emerging and re-emerging tick- and flea-borne rickettsial agents in acute encephalitis syndrome endemic areas of northeast Uttar Pradesh, India. Med. Vet. Entomol. 2023, 38, 23–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Babu, N.N.; Jayaram, A.; Auti, A.M.; Bhandari, Y.; Shetty, U.; Arunkumar, G. Rickettsia africae and other unclassified Rickettsia species of the spotted fever group in ticks of the Western Ghats, India. Exp. Appl. Acarol. 2023, 90, 429–440. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Kebzai, F.; Ashraf, K.; Rehman, M.U.; Akbar, H.; Avais, M.; Khan, M. Molecular and seroepidemiological investigation of Coxiella burnetii and spotted fever group rickettsiae in the southern region of Kazakhstan. Ticks Tick Borne Dis. 2023, 14, 102240. [Google Scholar] [CrossRef] [Scilit]
  31. Ali, A.; Zahid, H.; Zeb, I.; Tufail, M.; Khan, S.; Haroon, M.; Tufail, M.; Bilal, M.; Hussain, M.; Alouffi, A.S.; et al. Risk factors associated with tick infestations on equids in Khyber Pakhtunkhwa, Pakistan, with notes on Rickettsia missile detection. Parasit Vectors 2021, 14, 363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Shehla, S.; Ullah, F.; Alouffi, A.; Almutairi, M.M.; Khan, Z.; Tanaka, T.; Labruna, M.B.; Tsai, K.H.; Ali, A. Association of SFG Rickettsia massiliae and Rickettsia shennongii with Different Hard Ticks Infesting Livestock Hosts. Pathogens 2023, 12, 1080. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Kartashov, M.Y.; Kononova, Y.V.; Petrova, I.D.; Tupota, N.L.; Mikryukova, T.P.; Ternovoi, V.A.; Tishkova, F.H.; Loktev, V.B. Detection of Ehrlichia spp. and Theileria spp. in Hyalomma anatolicum ticks collected in Tajikistan. Vavilovskii Zhurnal Genet Selektsii 2020, 24, 55. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Map of Aksu (Aksu and Wensu), Kashgar (Shufu), and Kizilsu Kirgizil (Akto) of Xinjiang, China, with the sampling sites included in the study.
Figure 1. Map of Aksu (Aksu and Wensu), Kashgar (Shufu), and Kizilsu Kirgizil (Akto) of Xinjiang, China, with the sampling sites included in the study.
Pathogens 13 00680 g001
Figure 2. The maximum likelihood method based on the Kimura 2-parameter model was used to investigate Theileria spp. Phylogenetic analysis of the 18S rRNA gene sequence was performed. The number marked at each node represents the percentage occurring in 1000 bootstrap repetitions. The sequences in this study are marked with black triangles.
Figure 2. The maximum likelihood method based on the Kimura 2-parameter model was used to investigate Theileria spp. Phylogenetic analysis of the 18S rRNA gene sequence was performed. The number marked at each node represents the percentage occurring in 1000 bootstrap repetitions. The sequences in this study are marked with black triangles.
Pathogens 13 00680 g002
Figure 3. Phylogenetic analysis of Anaplasma ovis Msp4 gene sequences was performed using the maximum likelihood method based on the Kimura 2-parameter model. The numbers at the nodes indicate the percentage support derived from 1000 bootstrap replicates. Sequences from this study are denoted by black triangles.
Figure 3. Phylogenetic analysis of Anaplasma ovis Msp4 gene sequences was performed using the maximum likelihood method based on the Kimura 2-parameter model. The numbers at the nodes indicate the percentage support derived from 1000 bootstrap replicates. Sequences from this study are denoted by black triangles.
Pathogens 13 00680 g003
Figure 4. Phylogenetic analysis of Rickettsia spp. OmpA gene sequences was conducted using the maximum likelihood method based on the Kimura 2-parameter model. The values at the nodes represent the percentage support from 1000 bootstrap replicates. Sequences from this study are indicated by black triangles.
Figure 4. Phylogenetic analysis of Rickettsia spp. OmpA gene sequences was conducted using the maximum likelihood method based on the Kimura 2-parameter model. The values at the nodes represent the percentage support from 1000 bootstrap replicates. Sequences from this study are indicated by black triangles.
Pathogens 13 00680 g004
Table 1. The tick-borne pathogens detected in the adult tick pools of Rh. turanicus and H. anatolicum.
Table 1. The tick-borne pathogens detected in the adult tick pools of Rh. turanicus and H. anatolicum.
SampleNumber of Positive Tick Pool Pathogen Species (%)
Tick SpeciesAreaNo. of SheepNo. of PoolA. ovisRickettsia spp.T. ovis
Rh. turanicusAksuVillage A24555 (9.09)52 (94.54)6 (10.91)
Village B12392 (5.13)5 (12.82)3 (7.69)
Farm C129241 (44.57)65 (70.65)38 (41.30)
WensuFarm D2074 (57.14)7 (100.00)1 (14.29)
Farm E2092 (22.22)3 (33.33)5 (55.56)
ShufuVillage F20----
AktoVillage G2063 (50.00)2 (33.33)2 (33.33)
Subtotal 12820857 (27.40)134 (64.42)55 (26.44)
H. anatolicumAksuVillage A24----
Village B12----
Farm C1271 (14.29)1 (14.29)1 (14.29)
WensuFarm D20----
Farm E20572 (3.51)6 (10.53)19 (33.33)
ShufuVillage F2026-1 (3.85)11 (42.31)
AktoVillage G20----
Subtotal 128903 (3.33)8 (8.89)31 (34.44)
Total 12829860 (20.13)142 (47.65)86 (28.86)
“-” means not detected; “No.” means the number of ticks tested per animal species.
Table 2. Co-infections in Rh.turanicus and H. anatolicum from southern Xinjiang, China.
Table 2. Co-infections in Rh.turanicus and H. anatolicum from southern Xinjiang, China.
ParameterHemoparasitesNumber of Pools (%, 95%CI)
Rh. turanicus
(N = 208)
H. anatolicum
(N = 90)
Total
(N = 298)
Single infectionA. ovis1 (0.48, 0–1.43)3 (3.33, 0–7.11)4 (1.34, 0.02–2.66)
Rickettsia spp.73 (35.10, 28.56–41.64)4 (4.44, 0.10–8.79)77 (25.84, 20.84–30.84)
T. ovis21 (10.10, 5.97–14.22)27 (30.0, 20.35–39.65)48 (16.11, 11.91–20.09)
Sub-total95 (45.67)34 (37.78)129 (43.29)
Co-infectionA. ovis + Rickettsia spp.32 (15.38, 10.44–20.33)-32 (10.74, 7.20–14.27)
A. ovis + T. ovis5 (2.40, 0.31–4.50)-5 (1.68, 0.21–3.15)
Rickettsia spp. + T. ovis10 (4.81, 1.88–7.74)4 (4.44, 0.10–8.79)14 (4.70, 2.28–7.11)
A. ovis + Rickettsia spp. + T. ovis19 (9.14, 5.19–13.08)-19 (6.38, 3.59–9.17)
“-” means not detected; “N” means the number of tick pools tested per animal species.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, Y.; Li, J.; Xieripu, G.; Rizk, M.A.; Macalanda, A.M.C.; Gan, L.; Ren, J.; Mohanta, U.K.; El-Sayed, S.A.E.-S.; Chahan, B.; et al. Molecular Detection of Theileria ovis, Anaplasma ovis, and Rickettsia spp. in Rhipicephalus turanicus and Hyalomma anatolicum Collected from Sheep in Southern Xinjiang, China. Pathogens 2024, 13, 680. https://doi.org/10.3390/pathogens13080680

AMA Style

Li Y, Li J, Xieripu G, Rizk MA, Macalanda AMC, Gan L, Ren J, Mohanta UK, El-Sayed SAE-S, Chahan B, et al. Molecular Detection of Theileria ovis, Anaplasma ovis, and Rickettsia spp. in Rhipicephalus turanicus and Hyalomma anatolicum Collected from Sheep in Southern Xinjiang, China. Pathogens. 2024; 13(8):680. https://doi.org/10.3390/pathogens13080680

Chicago/Turabian Style

Li, Yongchang, Jianlong Li, Gulaimubaier Xieripu, Mohamed Abdo Rizk, Adrian Miki C. Macalanda, Lu Gan, Jichao Ren, Uday Kumar Mohanta, Shimaa Abd El-Salam El-Sayed, Bayin Chahan, and et al. 2024. "Molecular Detection of Theileria ovis, Anaplasma ovis, and Rickettsia spp. in Rhipicephalus turanicus and Hyalomma anatolicum Collected from Sheep in Southern Xinjiang, China" Pathogens 13, no. 8: 680. https://doi.org/10.3390/pathogens13080680

APA Style

Li, Y., Li, J., Xieripu, G., Rizk, M. A., Macalanda, A. M. C., Gan, L., Ren, J., Mohanta, U. K., El-Sayed, S. A. E.-S., Chahan, B., Xuan, X., & Guo, Q. (2024). Molecular Detection of Theileria ovis, Anaplasma ovis, and Rickettsia spp. in Rhipicephalus turanicus and Hyalomma anatolicum Collected from Sheep in Southern Xinjiang, China. Pathogens, 13(8), 680. https://doi.org/10.3390/pathogens13080680

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop