Assessing the Occurrence of Host-Specific Faecal Indicator Markers in Water Systems as a Function of Water, Sanitation and Hygiene Practices: A Case Study in Rural Communities of Vhembe District Municipality, South Africa
Abstract
:1. Introduction
2. Materials and Methods
2.1. Science Ethics and Informed Consent
2.2. Site Description
2.3. Questionnaire Design
2.4. Study Survey on WASH
2.5. Water Sample Collection
2.6. Isolation of Bacteroides
2.7. Molecular Identification of Isolates
2.8. Statistical Analysis
3. Results
3.1. Survey Findings
3.1.1. Socio-Economic Status of the VDM
3.1.2. Water Systems
3.1.3. Sanitation, Hygiene and Health
3.1.4. Animals Found in Villages
3.1.5. Water Treatment Plants
3.2. Sources of Faecal Pollution
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ahmed, W.; Staley, C.; Sadowsky, M.J.; Gyawali, P.; Sidhu, J.P.; Palmer, A.; Beale, D.J.; Toze, S. Toolbox approaches using molecular markers and 16S rRNA gene amplicon data sets for identification of fecal pollution in surface water. Appl. Environ. Microbiol. 2015, 81, 7067–7077. [Google Scholar] [CrossRef] [PubMed]
- Waso, M.; Khan, S.; Khan, W. Microbial source tracking markers associated with domestic rainwater harvesting systems: Correlation to indicator organisms. Environ. Res. 2018, 161, 446–455. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, K.H.; Senay, C.; Young, S.; Nayak, B.; Lobos, A.; Conrad, J.; Harwood, V.J. Determination of wild animal sources of fecal indicator bacteria by microbial source tracking (MST) influences regulatory decisions. Water Res. 2018, 144, 424–434. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, W.; Hughes, B.; Harwood, V.J. Current status of marker genes of Bacteroides and related taxa for identifying sewage pollution in environmental waters. Water 2016, 8, 6. [Google Scholar] [CrossRef]
- Chaminuka, P.; McCrindle, C.M.; Udo, H.M. Cattle farming at the wildlife/livestock interface: Assessments of costs and benefits adjacent to Kruger National Park, South Africa. Soc. Nat. Resour. 2011, 25, 235–250. [Google Scholar] [CrossRef]
- Tober, A.V.; Govender, D.; Russo, I.R.M.; Cable, J. The microscopic five of the big five: Managing zoonotic diseases within and beyond African wildlife protected areas. Adv. Parasitol. 2022, 117, 1–46. [Google Scholar] [PubMed]
- Assimah-Reynolds, P.K. Zoonotic risks from domestic animals Ghana. Int. J. Pathog. Res. 2020, 4, 17–31. [Google Scholar] [CrossRef]
- Vhembe District Municipality. 2019/20 IDP Review. 2020, 421. South Africa, 2020. Available online: https://www.gov.za/about-government/contact-directory/lp-municipalities/vhembe-district-municipality (accessed on 5 December 2023).
- Traoré, A.N.; Mulaudzi, K.; Chari, G.J.E.; Foord, S.H.; Mudau, L.S.; Barnard, T.G.; Potgieter, N. The impact of human activities on microbial quality of rivers in the Vhembe District, South Africa. Int. J. Environ. Res. Public Health 2016, 13, 8. [Google Scholar] [CrossRef]
- Samie, A.; Guerrant, R.L.; Barrett, L.; Bessong, P.O.; Igumbor, E.O.; Obi, C.L. Prevalence of intestinal parasitic and bacterial pathogens in diarrhoeal and non-diarroeal human stools from Vhembe district, South Africa. J. Health Popul. Nutr. 2009, 27, 739. [Google Scholar] [CrossRef]
- Omona, S.; Malinga, G.M.; Opoke, R.; Openy, G.; Opiro, R. Prevalence of diarrhoea and associated risk factors among children under five years old in Pader District, northern Uganda. BMC Infect. Dis. 2020, 20, 37. [Google Scholar] [CrossRef]
- Penakalapati, G.; Swarthout, J.; Delahoy McAliley, L.; Wodnik, B.; Levy, K.; Freeman, M.C. Exposure to animal feces and human health: A systematic review and proposed research priorities. Environ. Sci. Technol. 2017, 51, 11537–11552. [Google Scholar] [CrossRef] [PubMed]
- Bulled, N.; Poppe, K.; Ramatsisti, K.; Sitsula, L.; Winegar, G.; Gumbo, J.; Dillingham, R.; Smith, J. Assessing the environmental context of hand washing among school children in Limpopo, South Africa. Water Int. 2017, 42, 568–584. [Google Scholar] [CrossRef] [PubMed]
- Cassivi, A.; Tilley, E.; Waygood, E.O.D.; Dorea, C. Household practices in accessing drinking water and post collection contamination: A seasonal cohort study in Malawi. Water Res. 2021, 189, 116607. [Google Scholar] [CrossRef] [PubMed]
- Eshcol, J.; Mahapatra, P.; Keshapagu, S. Is fecal contamination of drinking water after collection associated with household water handling and hygiene practices? A study of urban slum households in Hyderabad, India. J. Water Health 2009, 7, 145–154. [Google Scholar] [CrossRef] [PubMed]
- Hadaway, A. Handwashing: Clean hands save lives. J. Consum. Health Internet 2020, 24, 43–49. [Google Scholar] [CrossRef]
- Sibiya, J.; Gumbo, J. Knowledge, attitude and practices (KAP) survey on water, sanitation and hygiene in selected schools in Vhembe District, Limpopo, South Africa. Int. J. Environ. Res. Public Health 2013, 10, 2282–2295. [Google Scholar] [CrossRef] [PubMed]
- Phooko-Rabodiba, D.A.; Tambe, B.A.; Nesamvuni, C.N.; Mbhenyane, X.G. Socioeconomic determinants influencing nutritional status of children in Sekhukhune district of Limpopo province in South Africa. J. Nutri. Health 2019, 5, 7. [Google Scholar]
- Moropeng, R.C.; Budeli, P.; Mpenyana-Monyatsi, L.; Momba, M.N.B. Dramatic reduction in diarrhoeal diseases through implementation of cost-effective household drinking water treatment systems in Makwane Village, Limpopo Province, South Africa. Int. J. Environ. Res. Public Health 2018, 15, 410. [Google Scholar] [CrossRef]
- Moropeng, R.C.; Budeli, P.; Momba, M.N.B. An integrated approach to hygiene, sanitation, and storage practices for improving microbial quality of drinking water treated at point of use: A case study in Makwane Village, South Africa. Int. J. Environ. Res. Public Health 2021, 18, 6313. [Google Scholar] [CrossRef]
- Budeli, P.; Moropeng, R.C.; Mpenyana-Monyatsi, L.; Momba, M.N.B. Inhibition of biofilm formation on the surface of water storage containers using biosand zeolite silver-impregnated clay granular and silver impregnated porous pot filtration systems. PLoS ONE 2021, 13, e0194715. [Google Scholar] [CrossRef]
- Khabo-Mmekoa, C.M.; Genthe, B.; Momba, M.N.B. Enteric pathogens risk factors associated with household drinking water: A case study in Ugu District Kwa-Zulu Natal Province, South Africa. Int. J. Environ. Res. Public Health 2022, 19, 4431. [Google Scholar] [CrossRef]
- Fuhrmeister, E.R.; Ercumen, A.; Pickering, A.J.; Jeanis, K.M.; Crider, Y.; Ahmed, M.; Brown, S.; Alam, M.; Sen, D.; Islam, S.; et al. Effect of sanitation improvements on pathogens and microbial source tracking markers in the rural Bangladeshi household environment. Environ. Sci. Technol. 2020, 54, 4316–4326. [Google Scholar] [CrossRef] [PubMed]
- Yin, H.; Islam, M.S.; Ju, M. Urban river pollution in the densely populated city of Dhaka, Bangladesh: Big picture and rehabilitation experience from other developing countries. J. Clean. Prod. 2021, 321, 129040. [Google Scholar] [CrossRef]
- Makungo, R.; Odiyo, J.O.; Tshidzumba, N. Performance of small water treatment plants: The case study of Mutshedzi Water Treatment Plant. Phys. Chem. Earth Parts A/B/C 2011, 36, 1151–1158. [Google Scholar] [CrossRef]
- Momba, M.N.B.; Obi, C.L.; Thompson, P. Survey of disinfection efficiency of small drinking water treatment plants: Challenges facing small water treatment plants in South Africa. Water SA 2009, 35, 9. [Google Scholar] [CrossRef]
- Statistical Release P0301: Community Survey 2016; Statistics South Africa: Pretoria, South Africa, 2016; p. 107.
- Nhamo, G.; Nhemachena, C.; Nhamo, S. Is 2030 too soon for Africa to achieve the water and sanitation sustainable development goal? Sci. Tot. Environ. 2019, 669, 129–139. [Google Scholar] [CrossRef] [PubMed]
- Climate Risk Profile: South Africa 2021; The World Bank Group: Washington, DC, USA, 2021.
- Vhembe District Municipality. 34/52 Profile and Analysis District Development Model Vhembe District Municipality LP. 2020, 36. South Africa. Available online: https://www.cogta.gov.za/ddm/wp-content/uploads/2020/11/vhembe-october-2020.pdf (accessed on 5 December 2023).
- Department of the National Treasury, Integrated Development Plans, Local Municipalities, Thulamela Municipality. Thulamela IDP 2019/2020–2021/22. 2020, 419, South Africa. Available online: https://lg.treasury.gov.za/supportingdocs/LIM343/LIM343_Annual%20Report%20Final_2022_Y_20230725T143712Z_mulaudzin.pdf (accessed on 5 December 2023).
- Ryu, H.; Tran, H.; Ware, M.W.; Iker, B.; Griffin, S.; Egorov, A.; Edge, T.A.; Newmann, N.; Villegas, E.N.; Santo Domingo, J.W. Application of leftover sample material from waterborne protozoa monitoring for the molecular detection of Bacteroidales and fecal source tracking markers. J. Microbiol. Methods. 2011, 86, 337–343. [Google Scholar] [CrossRef] [PubMed]
- Malla, B.; Ghaju Shrestha, R.; Tandukar, S.; Bhandari, D.; Inoue, D.; Sei, K.; Tanaka, Y.; Sherchand, J.B.; Haramoto, E. Validation of host-specific Bacteroidales quantitative PCR assays and their application to microbial source tracking of drinking water sources in the Kathmandu Valley, Nepal. J. Appl. Microbiol. 2018, 125, 609–619. [Google Scholar] [CrossRef]
- Kildare, B.J.; Leutenegger, C.M.; McSwain, B.S.; Bambic, D.G.; Rajal, V.B.; Wuertz, S. 16S rRNA-based assays for quantitative detection of universal, human-, cow-, and dog-specific fecal Bacteroidales: A Bayesian approach. Water Res. 2007, 41, 3701–3715. [Google Scholar] [CrossRef]
- Bernhard, A.E.; Field, K.G. A PCR assay to discriminate human and ruminant feces on the basis of host differences in Bacteroides-Prevotella genes encoding 16S rRNA. Appl. Environ. Microbiol. 2000, 66, 4571–4574. [Google Scholar] [CrossRef]
- Mieszkin, S.; Furet, J.P.; Corthier, G.; Gourmelon, M. Estimation of pig fecal contamination in a river catchment by real-time PCR using two pig-specific Bacteroidales 16S rRNA genetic markers. Appl. Environ. Microbiol. 2009, 75, 3045–3054. [Google Scholar] [CrossRef] [PubMed]
- Zhuang, F.F.; Li, H.; Zhou, X.Y.; Zhu, Y.G.; Su, J.Q. Quantitative detection of fecal contamination with domestic poultry feces in environments in China. AMB Express 2017, 7, 80. [Google Scholar] [CrossRef] [PubMed]
- Mudau, M. Application of Microbial Source Tracking Markers for the Identification of Predominant Faecal Pollution Sources in Water-Stressed Rural, Communities of South Africa. Master’s Dissertation, Tshwane University of Technology, Pretoria, South Africa, 2023. [Google Scholar]
- Murei, A.; Mogane, B.; Mothiba, D.P.; Mochware, O.T.W.; Sekgobela, J.M.; Mudau, M.; Musumuvhi, N.; Khabo-Mmekoa, C.M.; Moropeng, R.C.; Momba, M.N.B. Barriers to water and sanitation safety plans in rural areas of South Africa—A case study in the Vhembe District, Limpopo Province. Water 2022, 14, 1244. [Google Scholar] [CrossRef]
- World Health Statistics Overview 2019: Monitoring Health for the SDGs, Sustainable Development Goals; World Health Organization: Geneva, Switzerland, 2018.
- Omarova, A.; Tussupova, K.; Berndtsson, R.; Kalishev, M.; Sharapatova, K. Protozoan parasites in drinking water: A system approach for improved water, sanitation and hygiene in developing countries. Int. J. Environ. Res. Public Health 2018, 15, 495. [Google Scholar] [CrossRef] [PubMed]
- WHO/UNICEF Progress on Sanitation and Drinking Water: Joint Monitoring Programme: 2015 Update and MDG Assessment; World Health Organization: New York, NY, USA; UNICEF: New York, NY, USA, 2015.
- Stecklove, G.; Menashe-Oren, A. The Demography of Rural Youth in Developing Countries; International Fund for Agricultural Development (IFAD): Rome, Italy, 2019; FAD 2019 Rural Development Report. [Google Scholar]
- Bitew, B.D.; Gete, Y.K.; Biks, G.A.; Adafrie, T.T. Knowledge, attitude, and practice of mothers/caregivers on household water treatment methods in Northwest Ethiopia: A community-based cross-sectional study. Am. J. Trop. Med. Hyg. 2017, 97, 914. [Google Scholar] [CrossRef] [PubMed]
- Momba, M.N.; Kaleni, P. Regrowth and survival of indicator microorganisms on the surfaces of household containers used for the storage of drinking water in rural communities of South Africa. Water Res. 2002, 36, 3023–3028. [Google Scholar] [CrossRef]
- Trevett, A.F.; Carter, R.C.; Tyrrel, S.F. Water quality deterioration: A study of household drinking water quality in rural Honduras. Int. J. Environ. Health Res. 2004, 14, 273–283. [Google Scholar] [CrossRef]
- Prüss-Ustün, A.; Bartram, J.; Clasen, T.; Colford, J.M., Jr.; Cumming, O.; Curtis, V.; Bonjour, S.; Dangour, A.D.; De France, J.; Fewtrell, L.; et al. Burden of disease from inadequate water, sanitation and hygiene in low- and middle-income settings: A retrospective analysis of data from 145 countries. Trop. Med. Int. Health 2014, 19, 894–905. [Google Scholar] [CrossRef]
- Abney, S.E.; Bright, K.R.; McKinney, J.; Ijaz, M.K.; Gerba, C.P. Toilet hygiene—Review and research needs. J. Appl. Microbiol. 2021, 131, 2705–2714. [Google Scholar] [CrossRef]
- Font-Palma, C. Methods for the treatment of cattle manure—A review. J. Carbon. Res. 2019, 5, 27. [Google Scholar] [CrossRef]
- Parihar, S.S.; Saini, K.P.S.; Lakhani, G.P.; Jain, A.; Roy, B.; Ghosh, S.; Aharwal, B. Livestock waste management: A review. J. Entomol. Zool. Stud. 2019, 7, 384–393. [Google Scholar]
- Cabral, J.P.S. Water microbiology. Bacterial pathogens and water. Int. J. Environ. Res. Public Health 2010, 7, 3657–3703. [Google Scholar] [CrossRef] [PubMed]
- Dunkin, N.; Alum, A.; Schwake, O.; Kraft, K.; Abbaszadegan, M. Bacteroides survival and growth in drinking water distribution systems. In Proceedings of the 2012 American Water Works Association (AWWA) Water Quality Technology Conference and Exposition, Toronto, ON, Canada, 4–8 November 2012. [Google Scholar]
- Flemming, H.C. Biofouling in water systems–cases, causes and countermeasures. Appl. Microbiol. Biotechnol. 2002, 59, 629–640. [Google Scholar] [CrossRef] [PubMed]
- Sinthumule, N.I.; Netshisaulu, K.H. Wetlands Resource use and conservation attitudes of rural vs. urban dwellers: A comparative analysis in Thohoyandou, Limpopo Province, South Africa. Water 2022, 1290, 16. [Google Scholar] [CrossRef]
- Sanitation Safety Planning: Manual for Safe Use and Disposal of Wastewater, Greywater and Excreta-a Step-by-Step Risk-Based Management tool for Sanitation Systems; World Health Organization: Geneva, Switzerland, 2016.
- Abrams, A.L.; Carden, K.; Teta, C.; Wågsæther, K. Water, sanitation, and hygiene vulnerability among rural areas and small towns in south Africa: Exploring the role of climate change, marginalization, and inequality. Water 2021, 13, 2810. [Google Scholar] [CrossRef]
- Davison, A.; Howard, G.; Stevens, M.; Callan, P.; Fewtrell, L.; Deere, D.; Bartram, J. Water Safety Plans: Managing Drinking-Water Quality from Catchment to Consumer; World Health Organization: Geneva, Switzerland, 2005. [Google Scholar]
- Available online: https://www.waterpathogens.org/about-the-book (accessed on 5 December 2023).
Local Municipality | Village | Water Sources | Number of Households | Total Number of Samples |
---|---|---|---|---|
Makhado | Ha-Mutsha | 5 | 10 | 111 |
Thulamela | Maniini | 8 | 10 | 137 |
Collins Chabane | Ka-Mhinga | 5 | 10 | 112 |
Total | 360 |
Marker | Name of Primers and Probe | Primer or Probe Sequence 5′-3′ | Reference |
---|---|---|---|
Human | BacHum160f BacHum241r BacHum193p | TGAGTTCACATGTCCGCATGA CGTTACCCCGCCTACTATCTAATG TCCGGTAGACGATGGGGATGCGTT | [34] |
Cow | BacCow-CF128F BacCow-305r BacCow-257p | CCAACYTTCCCGWTACTC GGACCGTGTCTCAGTTCCAGTG TAGGGGTTCTGAGAGGAAGGTCCCCC | [34,35] |
Pig | Pig2Bac41F Pig2Bac163Rm Pig2Bac113MGB | GCATGAATTTAGCTTGCTAAATTTGAT ACCTCATACGGTATTAATCCGC TCCACGGGATAGCC | [36] |
Poultry | Chicken Cytb F Chicken Cytb R Chicken Cytb P | AAATCCCACCCCCTACTAAAAATAAT CAGATGAAGAAGAATGAGGCG ACAACTCCCTAATCGACCT | [37] |
Dog | BacCan545f1 BacUni690r1 BacUni656p | GGAGCGCAGACGGGTTTT CAATCGGAGTTCTTCGTGATATCTA TGGTGTAGCGGTGAAA | [34] |
Variable | Maniini | Ka-Mhinga | Ha-Mutsha | Total | |
---|---|---|---|---|---|
Enough water n = 133 | Yes | 14 | 8 | 39 | 61 |
No | 28 | 43 | 1 | 72 | |
Reason n = 72 | Cut off | 21 | - | 1 | 22 |
Other | 7 | 43 | - | 50 | |
Male/female fetching water n = 98 | Male | 3 | - | - | 3 |
Female | 38 | 47 | 5 | 90 | |
Both | - | 4 | 1 | 5 | |
Agriculture around water sources n = 133 | None | 14 | 21 | 12 | 47 |
Maize | 14 | 6 | 5 | 25 | |
Tomato | 2 | 3 | 1 | 6 | |
Beetroot | 6 | 2 | 3 | 11 | |
Onion | 6 | 2 | 3 | 11 | |
Spinach | - | 1 | 4 | 5 | |
Other | - | 9 | 6 | 15 | |
Mixed | - | 7 | 6 | 13 | |
Duration of water storage n = 133 | Do not store | 1 | 1 | 14 | 15 |
1 day | 5 | 5 | - | 6 | |
2 days | 9 | 2 | 1 | 8 | |
3 days | 4 | 14 | 1 | 24 | |
4 days | 9 | 7 | 1 | 12 | |
5 days | 12 | 11 | - | 20 | |
6 days and longer | 2 | 11 | 23 | 48 | |
Household water disinfection n = 133 | Yes | 1 | 5 | 1 | 7 |
No | 41 | 46 | 39 | 126 | |
Household water disinfection methods known n = 133 | None | 13 | 25 | 12 | 49 |
Bleach | 11 | 8 | 7 | 26 | |
Boil | - | 18 | 18 | 51 | |
Salt | 16 | - | - | 2 | |
Other | 2 | - | 3 | 5 |
Variable | Response | |
---|---|---|
Use of sanitation facility by children < 5 years | Yes | 12 |
No | 121 | |
Cost of cleaning agents * | Nothing | 44 |
Under ZAR 50 | 16 | |
Under ZAR 100 | 19 | |
Over ZAR 10 | 54 | |
Toilet with basin | Yes | 26 |
No | 107 | |
Washing of hands | With soap | 120 |
No soap | 9 | |
Sometimes | 4 | |
Disposal of household grey water | Veld | 91 |
Garden | 2 | |
Building | 1 | |
Other | 39 | |
Disposal of baby stools | None | 115 |
Dropped into toilet | 3 | |
Disposed of outside premises | 2 | |
Buried | 1 | |
Disposed of into household waste | 12 | |
Frequently occurring illness | None | 103 |
Diarrhoea | 19 | |
Trachoma | 2 | |
Body lice | 0 | |
Rash | 6 | |
Other | 3 |
Water Treatment Plant | Chlorine Used | State of Equipment | Plant Efficiency |
---|---|---|---|
DWTP 1 Nandoni | Gas chlorine | Good | Good |
DWTP 2 Vondo | Gas and liquid calcium hypochlorite | Good | Good |
DWTP 3 Mhinga | Gas and liquid calcium hypochlorite | Needs replacement | Pipeline often blocked or pump broken |
WWTP Thohoyandou | Granular chlorine | Needs repair | Problems during floods |
Sampling Site | Marker Occurrence in the Three Villages | ||||||
---|---|---|---|---|---|---|---|
Cow | Dog | Pig | Human | Chicken | |||
River (n = 8) | |||||||
Mvudi | upstream WWTP | ND | 2 | ND | 2 | ND | |
downstream WWTP | 2 | 3 | 2 | 5 | 1 | ||
Luvuvhu | upstream Nandoni DWTP | ND | 7 | 3 | 4 | 2 | |
downstream Nandoni DWTP | 7 | 2 | 2 | 2 | ND | ||
Luvuvhu | upstream Ka-Mhinga DWTP | 4 | 5 | 3 | 6 | 5 | |
downstream Ka-Mhinga DWTP | 5 | 3 | 3 | 4 | 2 | ||
Mutshundudi | upstream Vondo DWTP | 2 | 2 | 1 | 3 | 2 | |
downstream Vondo DWTP | ND | 3 | ND | 3 | 1 | ||
Dam (n = 8) | |||||||
Nandoni | 6 | 5 | 7 | 3 | 3 | ||
Vondo | 1 | 1 | ND | 2 | 1 | ||
Water at the point of treatment (n = 8) | |||||||
Nandoni WTP | raw | ND | ND | ND | 2 | ND | |
chlorinated | ND | ND | ND | ND | ND | ||
Vondo WTP | raw | 1 | 1 | 1 | 3 | 1 | |
chlorinated | ND | ND | ND | ND | ND | ||
Mhinga WTP | raw | 3 | 1 | 1 | 2 | 2 | |
chlorinated | ND | ND | ND | 2 | ND | ||
Thohoyandou WWTP effluent | 2 | 4 | 1 | 2 | ND | ||
Water at the point of use (n = 80) | |||||||
Maniini households supplied by Nandoni DWTP | 8 | 14 | 4 | 10 | 6 | ||
Ha-Mutsha households supplied by Vondo DWTP | ND | 7 | 1 | 5 | 12 | ||
Ka-Mhinga households supplied by the Mhinga DWTP | 9 | 27 | 4 | 6 | 25 | ||
Communal tap in Ka-Mhinga | 1 | ND | ND | 2 | 1 |
MST Marker | Cow | Dog | Human | Pig | Chicken | |||||
---|---|---|---|---|---|---|---|---|---|---|
WASH Variables | R2 | p | R2 | p | R2 | p | R2 | p | R2 | p |
(a) Crops around water source | 0.199 | 0.014 | 0.297 | 0.002 | 0.114 | 0.063 | 0.091 | 0.099 | 0.000 | 0.003 |
(b) Household animals | 0.100 | 0.083 | 0.067 | 0.161 | 0.180 | 0.017 | 0.133 | 0.043 | 0.129 | 0.048 |
(c) Duration of water storage | 0.195 | 0.013 | 0.314 | 0.001 | 0.233 | 0.006 | 0.157 | 0.027 | 0.397 | 0.000 |
(d) Method of drawing water | 0.174 | 0.020 | 0.261 | 0.003 | 0.313 | 0.001 | 0.130 | 0.046 | 0.398 | 0.000 |
(e) Water treatment in household | 0.147 | 0.033 | 0.272 | 0.003 | 0.245 | 0.005 | 0.155 | 0.029 | 0.414 | 0.000 |
(f) Presence of wash basin | 0.306 | 0.001 | 0.376 | 0.000 | 0.320 | 0.001 | 0.133 | 0.043 | 0.413 | 0.000 |
(g) Hand washing | 0.107 | 0.072 | 0.127 | 0.049 | 0.172 | 0.020 | 0.143 | 0.036 | 0.310 | 0.001 |
(h) Hand washing with soap | 0.107 | 0.073 | 0.144 | 0.035 | 0.115 | 0.062 | 0.089 | 0.103 | 0.257 | 0.004 |
(i) Illnesses occurring in household | 0.367 | 0.000 | 0.435 | 0.000 | 0.345 | 0.001 | 0.122 | 0.054 | 0.421 | 0.000 |
(j) Frequent diarrhoea | 0.004 | 0.730 | 0.002 | 0.778 | 0.163 | 0.024 | 0.200 | 0.012 | 0.002 | 0.794 |
(k) Family total members | 0.042 | 0.271 | 0.000 | 1.000 | 0.133 | 0.043 | 0.000 | 1.000 | 0.095 | 0.091 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mothiba, D.P.; Khabo-Mmekoa, C.M.; Ngobeni-Nyambi, R.; Momba, M.N.B. Assessing the Occurrence of Host-Specific Faecal Indicator Markers in Water Systems as a Function of Water, Sanitation and Hygiene Practices: A Case Study in Rural Communities of Vhembe District Municipality, South Africa. Pathogens 2024, 13, 16. https://doi.org/10.3390/pathogens13010016
Mothiba DP, Khabo-Mmekoa CM, Ngobeni-Nyambi R, Momba MNB. Assessing the Occurrence of Host-Specific Faecal Indicator Markers in Water Systems as a Function of Water, Sanitation and Hygiene Practices: A Case Study in Rural Communities of Vhembe District Municipality, South Africa. Pathogens. 2024; 13(1):16. https://doi.org/10.3390/pathogens13010016
Chicago/Turabian StyleMothiba, Dikeledi Prudence, Colette Mmapenya Khabo-Mmekoa, Renay Ngobeni-Nyambi, and Maggy Ndombo Benteke Momba. 2024. "Assessing the Occurrence of Host-Specific Faecal Indicator Markers in Water Systems as a Function of Water, Sanitation and Hygiene Practices: A Case Study in Rural Communities of Vhembe District Municipality, South Africa" Pathogens 13, no. 1: 16. https://doi.org/10.3390/pathogens13010016
APA StyleMothiba, D. P., Khabo-Mmekoa, C. M., Ngobeni-Nyambi, R., & Momba, M. N. B. (2024). Assessing the Occurrence of Host-Specific Faecal Indicator Markers in Water Systems as a Function of Water, Sanitation and Hygiene Practices: A Case Study in Rural Communities of Vhembe District Municipality, South Africa. Pathogens, 13(1), 16. https://doi.org/10.3390/pathogens13010016