Serological Evidence of Exposure to Spotted Fever Group and Typhus Group Rickettsiae in Australian Wildlife Rehabilitators
Abstract
1. Introduction
2. Results
2.1. Responses and Demographics of Australian Wildlife Rehabilitators
2.2. Wildlife Rehabilitating Demographics and Practices
2.3. Serology
2.3.1. Rickettsia Screening
2.3.2. Rickettsia Species Titration
2.4. Rickettsia spp. Serostatus and Investigated Potential Risk Factors
2.5. Real-Time PCR (qPCR)
Whole Blood and Serum
3. Discussion
4. Methods
4.1. Study Design and Participant Recruitment
4.2. Sample Size Calculation
4.3. Questionnaire
4.4. Laboratory Methods
4.4.1. Blood Sample Collection
4.4.2. Serology
Screening of Sera for Rickettsia spp.
Titration of Sera against R. australis, R. honei, R. felis and R. typhi Antigens
4.4.3. DNA Extraction
4.4.4. Real-Time PCR (qPCR)
4.5. Statistical Analysis
4.5.1. Data Management
4.5.2. Variables and Risk Factors
4.5.3. Modelling
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Walker, D.H. Rickettsiae. In Medical Microbiology; Baron, S., Ed.; University of Texas: Austin, TX, USA, 1996. [Google Scholar]
- Blanton, L.S. The Rickettsioses: A practical update. Infect. Dis. Clin. N. Am. 2019, 33, 213–229. [Google Scholar] [CrossRef]
- Luce-Fedrow, A.; Mullins, K.; Kostik, A.P.; John, H.K.S.; Jiang, J.; Richards, A.L. Strategies for detecting rickettsiae and diagnosing rickettsial diseases. Futur. Microbiol. 2015, 10, 537–564. [Google Scholar] [CrossRef]
- Azad, A.F.; Beard, C.B. Rickettsial pathogens and their arthropod vectors. Emerging Infect. Dis. 1998, 4, 179–186. [Google Scholar] [CrossRef]
- Izzard, L.; Fuller, A.; Blacksell, S.; Paris, D.H.; Richards, A.L.; Aukkanit, N.; Nguyen, C.; Jiang, J.; Fenwick, S.; Day, N.P.J.; et al. Isolation of a Novel Orientia Species (O. chutosp. nov.) from a Patient Infected in Dubai. J. Clin. Microbiol. 2010, 48, 4404. [Google Scholar] [CrossRef]
- NSW Department of Health. Typhus (Epidemic, Murine and Other Rickettsial Diseases) Fact Sheet. Available online: https://www.health.nsw.gov.au/Infectious/factsheets/Pages/Typhus.aspx# (accessed on 4 February 2019).
- McBride, W.J.; Hanson, J.P.; Miller, R.; Wenck, D. Severe Spotted Fever Group Rickettsiosis, Australia. Emerg. Infect. Dis. 2007, 13, 1742–1744. [Google Scholar] [CrossRef]
- Xu, G.; Walker, D.H.; Jupiter, D.; Melby, P.C.; Arcari, C.M. A review of the global epidemiology of scrub typhus. PLoS Negl. Trop. Dis. 2017, 11, e0006062. [Google Scholar] [CrossRef] [PubMed]
- Stewart, A.; Smith, S.; Binotto, E.; McBride, W.J.H.; Hanson, J. The epidemiology and clinical features of rickettsial diseases in North Queensland, Australia: Implications for patient identification and management. PLoS Negl. Trop. Dis. 2019, 13, e0007583. [Google Scholar] [CrossRef]
- Sexton, D.J.; King, G. Fatal queensland tick typhus. J. Infect. Dis. 1990, 162, 779–780. [Google Scholar] [CrossRef] [PubMed]
- Biggs, H.M.; Behravesh, C.B.; Bradley, K.K.; Dahlgren, F.S.; Drexler, N.A.; Dumler, J.S.; Folk, S.M.; Kato, C.Y.; Lash, R.R.; Levin, M.L.; et al. Diagnosis and Management of Tickborne Rickettsial Diseases: Rocky Mountain Spotted Fever and Other Spotted Fever Group Rickettsioses, Ehrlichioses, and Anaplasmosis. MMWR. Recomm. Rep. 2016, 65, 1. [Google Scholar] [CrossRef] [PubMed]
- National Notifiable Diseases Surveillance System. Disease notification Rates, Australia, 1991 to 2020 and Year-to-Date Notifications for 2021. Commun. Dis. Intell. 2021. Available online: http://www9.health.gov.au/cda/source/rpt_3.cfm (accessed on 15 March 2021).
- Graves, S.; Stenos, J. Rickettsioses in Australia. Ann. N. Y. Acad. Sci. 2009, 1166, 151–155. [Google Scholar] [CrossRef] [PubMed]
- Faa, A.G.; McBride, W.J.; Garstone, G.; Thompson, R.E.; Holt, P. Scrub Typhus in the Torres Strait Islands of North Queensland, Australia. Emerg. Infect. Dis. 2003, 9, 480–482. [Google Scholar] [CrossRef]
- Whelan, P.I.; Ralph, A.; Currie, B.J.; Raines, M. Scrub typhus in the Northern Territory: Exceeding the boundaries of Litchfield National Park. Commun. Dis. Intell. Q. Rep. 2004, 28, 267–269. [Google Scholar]
- Graves, S.; Nack, Z.; Jones, S.; Wang, L. Rickettsia serosurvey in Kimberley, Western Australia. Am. J. Trop. Med. Hyg. 1999, 60, 786–789. [Google Scholar] [CrossRef]
- Mullen, G.R.; O’Connor, B.M. Mites (Acari). In Medical and Veterinary Entomology, 3rd ed.; Mullen, G.R., Durden, L.A., Eds.; Academic Press: Cambridge, MA, USA, 2019; pp. 533–602. [Google Scholar]
- Graves, S.R.; Stenos, J. Tick-borne infectious diseases in Australia. Med. J. Aust. 2017, 206, 320. [Google Scholar] [CrossRef] [PubMed]
- Raby, E.; Pearn, T.; Marangou, A.G.; Merritt, A.J.; Murray, R.J.; Dyer, J.R.; Graves, S.R. New Foci of Spotted Fever Group Rickettsiae Including Rickettsia honei in Western Australia. Trop. Med. Infect. Dis. 2016, 1, 5. [Google Scholar] [CrossRef] [PubMed]
- Unsworth, N.B.; Stenos, J.; McGregor, A.R.; Dyer, J.R.; Graves, S.R. Not only ’Flinders Island’ spotted fever. Pathology 2005, 37, 242–245. [Google Scholar] [CrossRef] [PubMed]
- Barker, S.C.; Walker, A.R. Ticks of Australia. The species that infest domestic animals and humans. Zootaxa 2014, 3816, 1–144. [Google Scholar] [CrossRef]
- Williams, M.; Izzard, L.; Graves, S.R.; Stenos, J.; Kelly, J.J. First probable Australian cases of human infection with Rickettsia felis (cat-flea typhus). Med. J. Aust. 2011, 194, 41–43. [Google Scholar] [CrossRef]
- Hii, S.F.; Kopp, S.R.; Abdad, M.Y.; Thompson, M.F.; O’Leary, C.A.; Rees, R.L.; Traub, R.J. Molecular Evidence Supports the Role of Dogs as Potential Reservoirs for Rickettsia felis. Vector Borne Zoonotic Dis. 2011, 11, 1007–1012. [Google Scholar] [CrossRef]
- Ng-Nguyen, D.; Hii, S.-F.; Hoang, M.-T.T.; Nguyen, V.-A.T.; Rees, R.; Stenos, J.; Traub, R.J. Domestic dogs are mammalian reservoirs for the emerging zoonosis flea-borne spotted fever, caused by Rickettsia felis. Sci. Rep. 2020, 10, 4151. [Google Scholar] [CrossRef]
- Beaman, M.H.; Marlnovltch, N. Murlne typhus in metropolitan Perth. Med. J. Aust. 1999, 170, 93–94. [Google Scholar] [CrossRef]
- Graves, S.R.; Dwyer, B.; Banks, J.; King, G.K. A case of murine typhus in Queensland. Med. J. Aust. 1992, 156, 650–651. [Google Scholar] [CrossRef] [PubMed]
- Jones, S.L.; Athan, E.; O’Brien, D.; Graves, S.R.; Nguyen, C.; Stenos, J. Murine typhus: The first reported case from Victoria. Med. J. Aust. 2004, 180, 482. [Google Scholar] [CrossRef] [PubMed]
- Parola, P.; Paddock, C.D.; Socolovschi, C.; Labruna, M.B.; Mediannikov, O.; Kernif, T.; Abdad, M.Y.; Stenos, J.; Bitam, I.; Fournier, P.-E.; et al. Update on Tick-Borne Rickettsioses around the World: A Geographic Approach. Clin. Microbiol. Rev. 2013, 26, 657–702. [Google Scholar] [CrossRef] [PubMed]
- Unsworth, N.B.; Stenos, J.; Graves, S.R.; Faa, A.G.; Cox, G.E.; Dyer, J.R.; Boutlis, C.S.; Lane, A.M.; Shaw, M.D.; Robson, J.; et al. Flinders Island Spotted Fever Rickettsioses Caused by “marmionii” Strain of Rickettsia honei, Eastern Australia. Emerg. Infect. Dis. 2007, 13, 566–573. [Google Scholar] [CrossRef]
- Unsworth, N.; Graves, S.; Nguyen, C.; Kemp, G.; Graham, J.; Stenos, J. Markers of exposure to spotted fever rickettsiae in patients with chronic illness, including fatigue, in two Australian populations. Q. J. Med. 2008, 101, 269–274. [Google Scholar] [CrossRef]
- Owen, H.; Clark, P.; Stenos, J.; Robertson, I.; Fenwick, S. Potentially pathogenic spotted fever group rickettsiae present in Western Australia. Aust. J. Rural. Health 2006, 14, 284–285. [Google Scholar] [CrossRef] [PubMed]
- Vilcins, I.E.; Old, J.M.; Deane, E.M. Detection of a spotted fever group Rickettsia in the tick Ixodes tasmani collected from koalas in Port Macquarie, Australia. J. Med. Entomol. 2008, 45, 745–750. [Google Scholar] [CrossRef]
- Izzard, L.; Graves, S.; Cox, E.; Fenwick, S.; Unsworth, N.; Stenos, J. Novel Rickettsia in Ticks, Tasmania, Australia. Emerg. Infect. Dis. 2009, 15, 1654–1656. [Google Scholar] [CrossRef]
- Teoh, Y.T.; Hii, S.F.; Stevenson, M.A.; Graves, S.; Rees, R.; Stenos, J.; Traub, R.J. Serological evidence of exposure to Rickettsia felis and Rickettsia typhi in Australian veterinarians. Parasites Vectors 2017, 10, 129. [Google Scholar] [CrossRef] [PubMed]
- Abdad, M.Y.; Stenos, J.; Fenwick, S.G.; Cook, A.; Dyer, J. Seroepidemiological Study of Outdoor Recreationists’ Exposure to Spotted Fever Group Rickettsia in Western Australia. Am. J. Trop. Med. Hyg. 2014, 91, 584–588. [Google Scholar] [CrossRef] [PubMed]
- Mathews, K.O.; Toribio, J.-A.; Norris, J.M.; Phalen, D.; Wood, N.; Graves, S.R.; Sheehy, P.A.; Bosward, K.L. Coxiella burnetii seroprevalence and Q fever in Australian wildlife rehabilitators. One Health 2021, 12, 100197. [Google Scholar] [CrossRef]
- National Rural Health Alliance. The Little Book of Rural Health Numbers. Available online: https://www.ruralhealth.org.au/book/demography (accessed on 17 February 2020).
- Australian Veterinary Association. Guidelines for Veterinary Personal Biosecurity. Available online: https://www.ava.com.au/library-resources/other-resources/veterinary-personal-biosecurity/ (accessed on 31 July 2019).
- Wildlife Health Australia. National Wildlife Biosecurity Guidelines. Version 1.0. 2018. Available online: https://www.wildlifehealthaustralia.com.au/Portals/0/Documents/ProgramProjects/National_Wildlife_Biosecurity_Guidelines.PDF (accessed on 31 July 2019).
- Graves, S.R.; Dwyer, B.; McColl, D.; McDade, J. Flinders Island spotted fever: A newly recognised endemic focus of tick typhus in Bass Strait: Part 2. Serological investigations. Med. J. Aust. 1991, 154, 99–104. [Google Scholar] [CrossRef]
- Vilcins, I.-M.E.; Old, J.M.; Deane, E.M. Molecular detection of Rickettsia, Coxiella and Rickettsiella DNA in three native Australian tick species. Exp. Appl. Acarol. 2009, 49, 229–242. [Google Scholar] [CrossRef] [PubMed]
- Dyer, J.R.; Einsiedel, L.; Ferguson, P.E.; Lee, A.S.; Gordon, D.L.; Unsworth, N.B.; Graves, S.R. A new focus of Rickettsia honei spotted fever in South Australia. Med. J. Aust. 2005, 182, 231–234. [Google Scholar] [CrossRef]
- Dwyer, B.W.; Graves, S.R.; Yung, A.P.; Doherty, R.R.; McDonald, M.I.; McDonald, J.K. Spotted fever in East Gippsland, Victoria: A previously unrecognised focus of rickettsial infection. Med. J. Aust. 1991, 154, 121–125. [Google Scholar] [CrossRef] [PubMed]
- Barrs, V.; Beatty, J.; Wilson, B.; Evans, N.; Gowan, R.; Baral, R.; Lingard, A.; Perkovic, G.; Hawley, J. Lappin Prevalence of Bartonella species, Rickettsia felis, haemoplasmas and the Ehrlichia group in the blood of cats and fleas in eastern Australia. Aust. Vet. J. 2010, 88, 160–165. [Google Scholar] [CrossRef] [PubMed]
- Schloderer, D.; Owen, H.; Clark, P.; Stenos, J.; Fenwick, S.G. Rickettsia felis in fleas, Western Australia. Emerg. Infect. Dis. 2006, 12, 841–843. [Google Scholar] [CrossRef]
- Paris, D.H.; Dumler, J.S. State of the art of diagnosis of rickettsial diseases: The use of blood specimens for diagnosis of scrub typhus, spotted fever group rickettsiosis, and murine typhus. Curr. Opin. Infect. Dis. 2016, 29, 433–439. [Google Scholar] [CrossRef] [PubMed]
- Stenos, J.; Unsworth, N.B.; Graves, S.R. A Highly Sensitive and Specific Real-Time Pcr Assay for the Detection of Spotted Fever and Typhus Group Rickettsiae. Am. J. Trop. Med. Hyg. 2005, 73, 1083–1085. [Google Scholar] [CrossRef]
- Parola, P.; Paddock, C.D.; Raoult, D. Tick-Borne Rickettsioses around the World: Emerging Diseases Challenging Old Concepts. Clin. Microbiol. Rev. 2005, 18, 719. [Google Scholar] [CrossRef]
- Kaplowitz, L.G.; Lange, J.V.; Fischer, J.J.; Walker, D.H. Correlation of Rickettsial Titers, Circulating Endotoxin, and Clinical Features in Rocky Mountain Spotted Fever. Arch. Intern. Med. 1983, 143, 1149–1151. [Google Scholar] [CrossRef]
- Gal, S.; Fidler, C.; Lo, Y.; Taylor, M.; Han, C.; Moore, J.; Harris, A.; Wainscoat, J. Quantitation of circulating DNA in the serum of breast cancer patients by real-time PCR. Br. J. Cancer 2004, 90, 1211–1215. [Google Scholar] [CrossRef] [PubMed]
- Kato, C.; Chung, I.; Paddock, C. Estimation of Rickettsia rickettsii copy number in the blood of patients with Rocky Mountain spotted fever suggests cyclic diurnal trends in bacteraemia. Clin. Microbiol. Infect. 2016, 22, 394–396. [Google Scholar] [CrossRef] [PubMed]
- Willis, G.; Lodo, K.; McGregor, A.; Howes, F.; Williams, S.; Veitch, M. New and old hotspots for rickettsial spotted fever acquired in Tasmania, 2012–2017. Aust. N. Z. J. Public Health 2019, 43, 389–394. [Google Scholar] [CrossRef] [PubMed]
- Reháçek, J. Ecological relationships between ticks and rickettsiae. Eur. J. Epidemiol. 1989, 5, 407–413. [Google Scholar] [CrossRef]
- O’Connor, L.F.; Kelly, H.A.; Lubich, J.M.; Lindsey, R.J.; McComish, M.J. A cluster of murine typhus cases in Western Australia. Med. J. Aust. 1996, 165, 24–26. [Google Scholar] [CrossRef]
- Kenyon, R.H.; Kishimoto, R.A.; Hall, W.C. Exposure of guinea pigs to Rickettsia rickettsii by aerosol, nasal, conjunctival, gastric, and subcutaneous routes and protection afforded by an experimental vaccine. Infect. Immun. 1979, 25, 580–582. [Google Scholar] [CrossRef]
- Saslaw, S.; Carlisle, H.N. Aerosol infection of monkeys with Rickettsia rickettsii. Bacteriol. Rev. 1966, 30, 636–645. [Google Scholar] [CrossRef]
- Wolf, G.L.; Cole, C.R.; Carlisle, H.N.; Saslaw, S. The pathogenesis of Rocky Mountain spotted fever in monkeys, infected by inhalation. Arch. Pathol. 1967, 84, 486–494. [Google Scholar]
- Calia, F.M.; Bartelloni, P.J.; McKinney, R.W. Rocky Mountain Spotted Fever: Laboratory infection in a vaccinated individual. JAMA 1970, 211, 2012–2014. [Google Scholar] [CrossRef][Green Version]
- Johnson, J.E.; Kadull, P.J. Rocky Mountain Spotted Fever Acquired in a Laboratory. N. Engl. J. Med. 1967, 277, 842–847. [Google Scholar] [CrossRef]
- Oster, C.N.; Burke, D.S.; Kenyon, R.H.; Ascher, M.S.; Harber, P.; Pedersen, C.E. Laboratory-Acquired Rocky Mountain Spotted Fever: The hazard of aerosol transmission. N. Engl. J. Med. 1977, 297, 859–863. [Google Scholar] [CrossRef] [PubMed]
- Saint, E.G.; Drummond, A.F.; Thorburn, I.O. Murine typhus in Western Australia. Med. J. Aust. 1954, 2, 731–737. [Google Scholar] [CrossRef] [PubMed]
- La Scola, B.; Raoult, D. Laboratory diagnosis of rickettsioses: Current approaches to diagnosis of old and new rickettsial diseases. J.Clin. Microbio. 1997, 35, 2715–2727. [Google Scholar] [CrossRef] [PubMed]
- Hechemy, K.E.; Raoult, D.; Fox, J.; Han, Y.; Elliott, L.B.; Rawlings, J. Cross-reaction of immune sera from patients with rickettsial diseases. J. Med. Microbiol. 1989, 29, 199–202. [Google Scholar] [CrossRef] [PubMed]
- La Scola, B.; Rydkina, L.; Ndihokubwayo, J.-B.; Vene, S.; Raoult, D. Serological Differentiation of Murine Typhus and Epidemic Typhus Using Cross-Adsorption and Western Blotting. Clin. Diagn. Lab. Immunol. 2000, 7, 612–616. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Teoh, Y.T.; Hii, S.F.; Graves, S.; Rees, R.; Stenos, J.; Traub, R.J. Evidence of exposure to Rickettsia felis in Australian patients. One Health 2016, 2, 95–98. [Google Scholar] [CrossRef]
- Delisle, J.; Moncayo, A.C.; Bouyer, D.H.; Mendell, N.L.; Bloch, K.C.; Stull-Lane, A. Human Infections by Multiple Spotted Fever Group Rickettsiae in Tennessee. Am. J. Trop. Med. Hyg. 2016, 94, 1212–1217. [Google Scholar] [CrossRef]
- Baird, R.W.; Lloyd, M.; Stenos, J.; Ross, B.C.; Stewart, R.S.; Dwyer, B. Characterization and comparison of Australian human spotted fever group rickettsiae. J. Clin. Microbiol. 1992, 30, 2896–2902. [Google Scholar] [CrossRef]
- Ricketts, H.T. A micro-organism which apparently has a specific relationship to Rocky Mountain spotted fever: A preliminary report. J. Am. Med. Assoc. 1909, 52, 379–380. [Google Scholar] [CrossRef][Green Version]
- Abdad, M.Y.; Abdallah, R.A.; Karkouri, K.E.; Beye, M.; Stenos, J.; Owen, H.; Fournier, P.-E. Rickettsia gravesii sp. nov.: A novel spotted fever group rickettsia in Western Australian Amblyomma triguttatum triguttatum ticks. Int. J. Syst. Evol. Microbiol. 2017, 67, 3156–3161. [Google Scholar] [CrossRef] [PubMed]
- Stenos, J.; Roux, V.; Walker, D.; Raoult, D. Rickettsia honei sp. nov., the aetiological agent of Flinders Island spotted fever in Australia. Int. J. Syst. Bacteriol. 1998, 48, 1399–1404. [Google Scholar] [CrossRef] [PubMed]
- Harris, P.A.; Taylor, R.; Thielke, R.; Payne, J.; Gonzalez, N.; Conde, J.G. Research electronic data capture (REDCap)—A metadata-driven methodology and workflow process for providing translational research informatics support. J. Biomed. Inform. 2009, 42, 377–381. [Google Scholar] [CrossRef] [PubMed]
- Harris, P.A.; Taylor, R.; Minor, B.L.; Elliott, V.; Fernandez, M.; O’Neal, L.; McLeod, L.; Delacqua, G.; Delacqua, F.; Kirby, J.; et al. The REDCap consortium: Building an international community of software platform partners. J. Biomed. Inform. 2019, 95, 103208. [Google Scholar] [CrossRef]
- Dhand, N.K.; Khatkar, M.S. Statulator: An Online Statistical Calculator. Sample Size Calculator for Estimating a Single Propor-tion. Available online: http://statulator.com/SampleSize/ss1P.html (accessed on 7 May 2019).
- Sellens, E.; Bosward, K.L.; Norris, J.M.; Wood, N.; Heller, J.; Graves, S.; Gidding, H.F. Coxiella burnetii seroprevalence in unvaccinated veterinary workers in Australia: Evidence to support Q fever vaccination. Zoonoses Public Health 2020, 67, 79–88. [Google Scholar] [CrossRef]
- Mediannikov, O.; Fenollar, F.; Socolovschi, C.; Diatta, G.; Bassene, H.; Molez, J.-F.; Sokhna, C.; Trape, J.-F.; Raoult, D. Coxiella burnetii in Humans and Ticks in Rural Senegal. PLoS Negl. Trop. Dis. 2010, 4, e654. [Google Scholar] [CrossRef]
- R Core Team. R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing. Available online: http://www.R-project.org/ (accessed on 18 December 2018).

| Biosecurity Practice | Number (%) of Participants When Handling Animals | Number (%) of Participants When Cleaning Enclosures |
|---|---|---|
| Participant report of practice | ||
| No PPE | 4 (3.3) | 4 (3.3) |
| Prompt hand washing | 116 (96.7) | 117 (97.5) |
| Overalls/protective outerwear | 16 (13.3) | 25 (20.8) |
| Disposable gloves | 28 (23.3) | 47 (39.2) |
| Safety glasses | 5 (4.2) | 10 (8.3) |
| Face mask | 3 (2.5) | 7(5.8) |
| Level of biosecurity practice * | ||
| Inadequate | 104 (86.7) | 102 (85.0) |
| Adequate | 9 (7.5) | 15 (12.5) |
| Enhanced | 7 (5.8) | 3 (2.5) |
| Spotted Fever Group | Typhus Group | Sample Classification | |||||
|---|---|---|---|---|---|---|---|
| (SFG) | (TG) | ||||||
| Participant | R. australis | R. honei | R. felis | R. typhi | Antigenic Group | Species | State of Residence |
| 96 | ≥2048 | 256 | - | - | SFG | R. australis | VIC |
| 117 + | 1024 | 256 | - | - | SFG | R. australis | NSW |
| 147 | 512 | - | - | - | SFG | R. australis | NSW |
| 161 + | ≥2048 | 512 | - | 256 | SFG | R. australis | NSW |
| 110 + | 512 | ≥2048 | 512 | 256 | SFG | R. honei | NSW |
| 148 | - | - | 256 | - | SFG | R. felis | QLD |
| 6 + | ≥2048 | ≥2048 | 256 | - | SFG | R. australis/R. honei * | NSW |
| 13 | 1024 | 1024 | - | - | SFG | R. australis/R. honei * | VIC |
| 19 | 1024 | 1024 | - | - | SFG | R. australis/R. honei * | VIC |
| 20 + | ≥2048 | ≥2048 | - | - | SFG | R. australis/R. honei * | QLD |
| 27 + | 1024 | 1024 | - | - | SFG | R. australis/R. honei * | NSW |
| 34 | ≥2048 | 1024 | - | - | SFG | R. australis/R. honei * | SA |
| 36 + | 512 | 512 | - | - | SFG | R. australis/R. honei * | QLD |
| 36 + | ≥2048 | ≥2048 | - | 256 | SFG | R. australis/R. honei * | NSW |
| 62 | 256 | 512 | - | - | SFG | R. australis/R. honei * | VIC |
| 83 + | 1024 | 1024 | - | - | SFG | R. australis/R. honei * | NSW |
| 86 + | ≥2048 | ≥2048 | 256 | - | SFG | R. australis/R. honei * | NSW |
| 87 | 512 | 512 | - | - | SFG | R. australis/R. honei * | NSW |
| 94 | 512 | 256 | - | - | SFG | R. australis/R. honei * | VIC |
| 113 | 256 | 256 | - | - | SFG | R. australis/R. honei * | SA |
| 115 | 512 | 512 | - | - | SFG | R. australis/R. honei * | WA |
| 138 + | 256 | 256 | - | - | SFG | R. australis/R. honei * | NSW |
| 158 | 512 | 512 | - | - | SFG | R. australis/R. honei * | VIC |
| 164 | 1024 | 512 | - | - | SFG | R. australis/R. honei * | VIC |
| 40 + | 512 | 1024 | 256 | - | SFG | R. australis/R. honei/R. felis * | NSW |
| 127 + | 512 | 256 | 256 | 256 | SFG/TG | R. australis/R. honei/R. felis/R. typhi * | NSW |
| 172 | 512 | 512 | - | 256 | SFG/TG | R. australis/R. honei/R. typhi * | TAS |
| Variable Name and Description | Total Number | Seropositive | Seronegative | Odds Ratio | 95% Confidence Intervals | p-Value |
|---|---|---|---|---|---|---|
| State of residence | 122 | 0.365 | ||||
| South West (WA + SA) | 3 | 17 | 1 | |||
| Southeast (VIC + TAS) | 8 | 14 | 3.24 | 0.77–16.99 | 0.125 | |
| Northeast (QLD + NT) | 3 | 11 | 1.55 | 0.25–9.74 | 0.63 | |
| East (NSW + ACT) | 13 | 53 | 1.39 | 0.39–6.58 | 0.637 | |
| Age | 120 | 0.184 * | ||||
| ≤50 | 6 | 33 | 1 | |||
| >50 | 21 | 60 | 1.93 | 0.74–5.67 | ||
| Number of people in household rehabilitating wildlife | 121 | 0.145 * | ||||
| 1 | 13 | 60 | 1 | |||
| >1 | 14 | 34 | 1.90 | 0.80–4.56 | ||
| Total number of animals per year cared for per year | 119 | 0.226 * | ||||
| 0–100 | 18 | 75 | 1 | |||
| >100 | 8 | 18 | 1.85 | 0.67–4.85 | ||
| Occupational animal contact | 122 | 0.140 * | ||||
| No | 8 | 43 | 1 | |||
| Yes | 19 | 52 | 1.96 | 0.81–5.17 | ||
| Tick Bite | 122 | 0.577 | ||||
| No | 14 | 55 | 1 | |||
| Yes | 13 | 40 | 1.27 | 0.56–3.43 | ||
| Association with reptiles | 122 | 0.443 | ||||
| No | 23 | 86 | 1 | |||
| Yes | 4 | 9 | 1.66 | 0.42–5.62 | ||
| Biosecurity practices when handling animals | 120 | 0.220 * | ||||
| None/handwash only | 21 | 61 | 1 | |||
| Handwash and other | 6 | 32 | 0.55 | 0.18–1.42 | ||
| Biosecurity practices when cleaning enclosures | 120 | 0.973 | ||||
| None/handwash only | 15 | 52 | 1 | |||
| Handwash and other | 12 | 41 | 1.02 | 0.42–2.40 |
| Variable Name and Description | Total Number | Seropositive | Seronegative | Adjusted Odds Ratio | 95% Confidence Intervals | p-Value |
|---|---|---|---|---|---|---|
| Age | 120 | 0.087 | ||||
| ≤50 | 6 | 33 | 1 | |||
| >50 | 21 | 60 | 2.4 | 0.89–7.32 | ||
| Number of people in household rehabilitating wildlife | 121 | 0.066 | ||||
| 1 | 12 | 60 | 1 | |||
| >1 | 15 | 34 | 2.3 | 0.95–5.90 | ||
| Occupational animal contact | 122 | 0.092 | ||||
| No | 8 | 43 | 1 | |||
| Yes | 19 | 52 | 2.2 | 0.88–6.16 |
| Target Gene and Primers | Primer Sequences (5′-3′) | Product Length (bp) | Final Concentration (nM) | Reference/ Primer Source |
|---|---|---|---|---|
| Citrate synthase Forward primer Reverse primer Probe | TCGCAAATGTTCACGGTACTTT TCGTGCATTTCTTTCCATTGTG FAM a- TGCAATAGCAAGAACCGTAGGCTGGATG -BHQ1 b | 74 | 300 300 200 | Adapted from [47] |
| Human β-actin Forward primer Reverse primer Probe | CATGCCATCCTGCGTCTGGA CCGTGGCCATCTCTTGCTCG FAM a- CGGGAAATCGTGCGTGACATTAAG-BHQ1 b | 172 | 300 300 200 | Adapted From [75] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mathews, K.O.; Phalen, D.; Norris, J.M.; Stenos, J.; Toribio, J.-A.; Wood, N.; Graves, S.; Sheehy, P.A.; Nguyen, C.; Bosward, K.L. Serological Evidence of Exposure to Spotted Fever Group and Typhus Group Rickettsiae in Australian Wildlife Rehabilitators. Pathogens 2021, 10, 745. https://doi.org/10.3390/pathogens10060745
Mathews KO, Phalen D, Norris JM, Stenos J, Toribio J-A, Wood N, Graves S, Sheehy PA, Nguyen C, Bosward KL. Serological Evidence of Exposure to Spotted Fever Group and Typhus Group Rickettsiae in Australian Wildlife Rehabilitators. Pathogens. 2021; 10(6):745. https://doi.org/10.3390/pathogens10060745
Chicago/Turabian StyleMathews, Karen O., David Phalen, Jacqueline M. Norris, John Stenos, Jenny-Ann Toribio, Nicholas Wood, Stephen Graves, Paul A. Sheehy, Chelsea Nguyen, and Katrina L. Bosward. 2021. "Serological Evidence of Exposure to Spotted Fever Group and Typhus Group Rickettsiae in Australian Wildlife Rehabilitators" Pathogens 10, no. 6: 745. https://doi.org/10.3390/pathogens10060745
APA StyleMathews, K. O., Phalen, D., Norris, J. M., Stenos, J., Toribio, J.-A., Wood, N., Graves, S., Sheehy, P. A., Nguyen, C., & Bosward, K. L. (2021). Serological Evidence of Exposure to Spotted Fever Group and Typhus Group Rickettsiae in Australian Wildlife Rehabilitators. Pathogens, 10(6), 745. https://doi.org/10.3390/pathogens10060745

