New Insight on the Sublethal Effect of Bt-Cry1Ab in Spodoptera litura (Fabricius): Tissular Distribution of Cry1Ab, Ultrastructural Alterations and the Lysosomal Response
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insect Rearing and Bioassay of S. litura Larvae on Transgenic Cry1Ab Maize
2.2. Enzyme-Linked Immunosorbent Assay (ELISA)
2.3. Transmission Electron Microscopy (TEM)
2.4. Acid Phosphatase (ACP) Enzymatic Activity Assay of the Cry1Ab-Treated Midgut
2.5. RNA Extraction and Quantitative Real-Time Reverse Transcription PCR (qPCR) Analysis
2.6. Red Lysotracker Staining of Cells
2.7. Data Analysis
3. Results
3.1. S. litura Bioassay
3.2. ELISA Analysis of Cry1Ab Protein Content in Cry1Ab Feeding Larvae
3.3. Ultrastructural Changes in the Midgut of S. litura Larvae After Cry1Ab Exposure
3.4. Lysosome Activity and Localization
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Bravo, A.; Gómez, I.; Porta, H.; García-Gómez, B.I.; Rodriguez-Almazan, C.; Pardo, L.; Soberón, M. Evolution of Bacillus thuringiensis Cry toxins insecticidal activity. Microb. Biotechnol. 2013, 6, 17–26. [Google Scholar] [CrossRef] [PubMed]
- Frankenhuyzen, K.V. Insecticidal activity of Bacillus thuringiensis crystal proteins. J. Invertebr. Pathol. 2009, 101, 1–16. [Google Scholar] [CrossRef]
- Koch, M.S.; Ward, J.M.; Levine, S.L.; Baum, J.A.; Vicini, J.L.; Hammond, B.G. The food and environmental safety of Bt crops. Front. Plant Sci. 2015, 6, 283. [Google Scholar] [CrossRef]
- Romeis, J.; Meissle, M.; Raybould, A.; Hellmich, R.L. Impact of Insect-Resistant Transgenic Crops on Aboveground Non-Target Arthropods; CABI: Wallingford, UK, 2009. [Google Scholar] [CrossRef]
- Martineau, B. First Fruit: The Creation of the Flavr Savr Tomato and the bIrth of Biotech Foods; McGraw-Hill: New York, NY, USA, 2001; p. 269. [Google Scholar]
- Li, Y.; Peng, Y.; Hallerman, E.M.; Wu, K. Biosafety management and commercial use of genetically modified crops in China. Plant Cell Rep. 2014, 33, 565–573. [Google Scholar] [CrossRef] [PubMed]
- Sun, G.Q.; Zhang, D.L.; Zhang, R. Bt protein expression in the transgenic insect-resistant cotton in China. Sci. Bull. 2016, 61, 1555–1557. [Google Scholar] [CrossRef][Green Version]
- Li, Y.; Hallerman, E.M.; Liu, Q.; Wu, K.; Peng, Y. The development and status of Bt rice in China. Plant Biotechnol. J. 2016, 14, 839–848. [Google Scholar] [CrossRef] [PubMed]
- Li, G.; Ji, T.; Zhao, S.; Feng, H.; Wu, K. High-Dose Assessment of Transgenic Insect-Resistant Maize Events against Major Lepidopteran Pests in China. Plants 2022, 11, 3125. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Zhao, S.; Liu, B.; Gao, Y.; Hu, C.; Li, W.; Yang, Y.; Li, G.; Wang, L.; Yang, X.; et al. Bt maize can provide non-chemical pest control and enhance food safety in China. Plant Biotechnol. J. 2022, 21, 391–404. [Google Scholar] [CrossRef]
- Yang, F.; Zheng, K.L.; Yao, Y. China’s regulatory change toward genome-edited crops. Trends Biotechnol. 2024, 42, 801–806. [Google Scholar] [CrossRef]
- Liu, F.; Xu, Z.; Zhu, Y.C.; Huang, F.; Wang, Y.; Li, H.; Li, H.; Gao, C.; Zhou, W.; Shen, J. Evidence of field evolved resistance to Cry1Ac expressing Bt cotton in Helicoverpa armigera in northern China. Pest Manag. Sci. 2010, 66, 155–161. [Google Scholar] [CrossRef] [PubMed]
- Dangal, V.; Huang, F. Fitness costs of Cry1F resistance in two populations of fall armyworm, Spodoptera frugiperda (J.E. Smith), collected from Puerto Rico and Florida. J. Invertebr. Pathol. 2015, 127, 81–86. [Google Scholar] [CrossRef] [PubMed]
- Bagla, P. Hardy cotton-munching pests are latest blow to GM crops. Science 2010, 327, 1439. [Google Scholar] [CrossRef] [PubMed]
- Dhurua, S.; Gujar, G.T. Field-evolved resistance to Bt toxin Cry1Ac in the pink bollworm, Pectinophora gossypiella (Saunders) (Lepidoptera: Gelechiidae), from India. Pest Manag. Sci. 2011, 67, 898–903. [Google Scholar] [CrossRef] [PubMed]
- Ferré, J.; Real, M.D.; Van Rie, J.; Jansens, S.; Peferoen, M. Resistance to the Bacillus thuringiensis bioinsecticide in a field population of Plutella xylostella is due to a change in a midgut membrane receptor. Proc. Natl. Acad. Sci. USA 1991, 88, 5119–5123. [Google Scholar] [CrossRef] [PubMed]
- Reay-Jones FP, F.; Bilbo, T.R.; Reisig, D.D. Decline in sublethal effects of Bt corn on Corn Earworm (Lepidoptera: Noctuidae) linked to increasing levels of resistance. J. Econ. Entomol. 2020, 113, 2241–2249. [Google Scholar] [CrossRef]
- Pezzini, D.; Taylor, K.L.; Reisig, D.D.; Fritz, M.L. Cross-pollination in seed-blended refuge and selection for Vip3A resistance in a Lepidopteran pest as detected by genomic monitoring. Proc. Natl. Acad. Sci. USA 2024, 121, e2319838121. [Google Scholar] [CrossRef] [PubMed]
- Gaétan, M.; Éric, B. Developmental Polymorphism: A major factor for understanding sublethal effects of Bacillus Thuringiensis. Entomol. Exp. Appl. 2001, 98, 133–140. [Google Scholar] [CrossRef][Green Version]
- Sedaratian, A.; Fathipour, Y.; Talaei-Hassanloui, R.; Jurat-Fuentes, J.L. Fitness costs of sublethal exposure to Bacillus thuringiensis in Helicoverpa armigera: A carryover study on offspring. J. Appl. Entomol. 2013, 137, 540–549. [Google Scholar] [CrossRef]
- Elkins, B.H.; Portilla, M.; Allen, K.C.; Little, N.S.; Mullen, R.M.; Paulk, R.T.; Read, Q.D. Sublethal effects of a commercial Bt product and Bt cotton flowers on the bollworm (Helicoverpa zea) with impacts to predation from a lady beetle (Hippodamia convergens). PLoS ONE 2024, 19, e0302941. [Google Scholar] [CrossRef] [PubMed]
- Chauhan, V.K.; Dhania, N.K.; Chaitanya, R.K.; Senthilkumaran, B.; Dutta-Gupta, A. Larval mid-gut responses to sub-lethal dose of Cry toxin in Lepidopteran pest Achaea janata. Front. Physiol. 2017, 8, 662. [Google Scholar] [CrossRef]
- Hernández-Martínez, P.; Gomis-Cebolla, J.; Ferré, J.; Escriche, B. Changes in gene expression and apoptotic response in Spodoptera exigua larvae exposed to sublethal concentrations of Vip3 insecticidal proteins. Sci. Rep. 2017, 7, 16245. [Google Scholar] [CrossRef]
- Chauhan, V.K.; Dhania, N.K.; Lokya, V.; Bhuvanachandra, B.; Padmasree, K.; Dutta-Gupta, A. Midgut aminopeptidase N. expression profile in Castor semilooper (Achaea janata) during sublethal Cry toxin exposure. J. Biosci. 2021, 46, 29. [Google Scholar] [CrossRef]
- Van Munster, M.; Prefontaine, G.; Meunier, L.; Elias, M.; Mazza, A.; Brousseau, R.; Masson, L. Altered gene expression in Choristoneura fumiferana and Manduca sexta in response to sublethal intoxication by Bacillus thuringiensis Cry1Ab toxin. Insect Mol. Biol. 2007, 16, 25–35. [Google Scholar] [CrossRef]
- Cheng, T.; Wu, J.; Wu, Y.; Chilukuri, R.V.; Huang, L.; Yamamoto, K.; Feng, L.I.; Li, W.; Chen, Z.; Guo, H.; et al. Genomic adaptation to polyphagy and insecticides in a major East Asian noctuid pest. Nat. Ecol. Evol. 2017, 1, 1747–1756. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.J.; Zhang, Y.N.; Hao, S.P.; Wang, Y.J.; Yang, X.X.; Shen, Y.Q.; Su, Q.; Xiao, Y.D.; Liu, J.Q.; Li, W.S.; et al. Proteotranscriptomic analyses of the midgut and Malpighian tubules after a sublethal concentration of Cry1Ab exposure on Spodoptera litura. Pest Manag. Sci. 2024, 80, 2587–2595. [Google Scholar] [CrossRef]
- Shu, B.; Zhang, J.; Cui, G.; Sun, R.; Sethuraman, V.; Yi, X.; Zhong, G. Evaluation of reference genes for real-time quantitative PCR analysis in larvae of Spodoptera litura exposed to azadirachtin stress conditions. Front. Physiol. 2018, 9, 372. [Google Scholar] [CrossRef] [PubMed]
- Reisig, D.D.; Reay-Jones FP, F. Inhibition of Helicoverpa zea (Lepidoptera: Noctuidae) Growth by Transgenic Corn Expressing Bt Toxins and Development of Resistance to Cry1Ab. Environ. Entomol. 2015, 44, 1275–1285. [Google Scholar] [CrossRef]
- Bilbo, T.R.; Reay-Jones, F.P.; Reisig, D.D.; Musser, F.R.; Greene, J.K. Effects of Bt corn on the development and fecundity of Corn Earworm (Lepidoptera: Noctuidae). J. Econ. Entomol. 2018, 111, 2233–2241. [Google Scholar] [CrossRef] [PubMed]
- Lone, S.A.; Malik, A.; Padaria, J.C. Selection and characterization of Bacillus thuringiensis strains from northwestern Himalayas toxic against Helicoverpa armigera. Microbiologyopen 2017, 6, e00484. [Google Scholar] [CrossRef] [PubMed]
- Botha, A.S.; Erasmus, A.; du Plessis, H.; Van den Berg, J. Efficacy of Bt Maize for Control of Spodoptera frugiperda (Lepidoptera: Noctuidae) in South Africa. J. Econ. Entomol. 2019, 112, 1260–1266. [Google Scholar] [CrossRef]
- Costa, S.D.; Barbercheck, M.E.; Kennedy, G.G. Sublethal acute and chronic exposure of colorado potato beetle (Coleoptera: Chrysomelidae) to the δ-Endotoxin of Bacillus thuringiensis. J. Econ. Entomol. 2000, 93, 680–689. [Google Scholar] [CrossRef]
- Amichot, M.; Curty, C.; Benguettat-Magliano, O. Side effects of Bacillus thuringiensis var. kurstaki on the hymenopterous parasitic wasp Trichogramma chilonis. Environ. Sci. Pollut. Res. 2016, 23, 3097–3103. [Google Scholar] [CrossRef] [PubMed]
- Tavares, C.S.; Santos-Amaya, O.F.; Oliveira, E.E.; Paula-Moraes, S.V.; Pereira, E.J.G. Facing Bt toxins growing up: Developmental changes of susceptibility to Bt corn hybrids in fall armyworm populations and the implications for resistance management. Crop Prot. 2021, 146, 105664. [Google Scholar] [CrossRef]
- Bauce, E.; Kumbasli, M.; Van Frankenhuyzen, K.; Carisey, N. Interactions Among White Spruce Tannins, Bacillus thuringiensis subsp. kurstaki, and Spruce Budworm (Lepidoptera: Tortricidae), on larval survival, growth, and Development. J. Econ. Entomol. 2006, 99, 2038–2047. [Google Scholar] [CrossRef] [PubMed]
- Nishida, R. Sequestration of defensive substances from plants by Lepidoptera. Annu. Rev. Entomol. 2002, 47, 57–92. [Google Scholar] [CrossRef] [PubMed]
- Van Broekhoven, S.; Gutierrez, J.M.; De Rijk, T.C.; De Nijs, W.C.M.; Van Loon, J.J.A. Degradation and excretion of the Fusarium toxin deoxynivalenol by an edible insect, the Yellow mealworm (Tenebrio molitor L.). World Mycotoxin J. 2017, 10, 163–169. [Google Scholar] [CrossRef]
- Hagele, B.F.; Rowell-Rahier, M. Dietary mixing in three generalist herbivores: Nutrient complementation or toxin dilution? Oecologia 1999, 119, 521. [Google Scholar] [CrossRef]
- Raps, A.; Kehr, J.; Gugerli, P.; Moar, W.J.; Bigler, F.; Hilbeck, A. Immunological analysis of phloem sap of Bacillus thuringiensis corn and of the nontarget herbivore Rhopalosiphum padi (Homoptera: Aphididae) for the presence of Cry1Ab. Mol. Ecol. 2001, 10, 525–533. [Google Scholar] [CrossRef] [PubMed]
- Kshatriya, K.; Gershenzon, J. Disarming the defenses: Insect detoxification of plant defense-related specialized metabolites. Curr. Opin. Plant Biol. 2024, 81, 102577. [Google Scholar] [CrossRef] [PubMed]
- Boeckler, G.A.; Paetz, C.; Feibicke, P.; Gershenzon, J.; Unsicker, S.B. Metabolism of poplar salicinoids by the generalist herbivore Lymantria dispar (Lepidoptera). Insect Biochem. Mol. Biol. 2016, 78, 39–49. [Google Scholar] [CrossRef] [PubMed]
- Raessler, M.; Rothe, J.; Hilke, I. Accurate determination of Cd, Cr, Cu and Ni in woodlice and their skins--is moulting a means of detoxification? Sci. Total Environ. 2005, 337, 83–90. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Peng, Y.; Xiao, K.; Wei, B.; Hu, J.; Wang, Z.; Song, Q.; Zhou, X. Transcriptomic response of wolf spider, Pardosa pseudoannulata, to transgenic rice expressing Bacillus thuringiensis Cry1Ab protein. BMC Biotechnol. 2017, 17, 7. [Google Scholar] [CrossRef] [PubMed]
- Pezenti, L.F.; Sosa-Gómez, D.R.; de Souza, R.F.; Vilas-Boas, L.A.; Gonçalves, K.B.; da Silva, C.R.M.; Vilas-Bôas, G.T.; Baranoski, A.; Mantovani, M.S.; da Rosa, R. Transcriptional profiling analysis of susceptible and resistant strains of Anticarsia gemmatalis and their response to Bacillus thuringiensis. Genomics 2021, 113, 2264–2275. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Z.; Li, Y.; Xiao, Y.; Ali, A.; Dhiloo, K.H.; Chen, W.; Wu, K. Distribution and metabolism of Bt-Cry1Ac toxin in tissues and organs of the cotton bollworm, Helicoverpa armigera. Toxins 2016, 8, 212. [Google Scholar] [CrossRef]
- Manachini, B.; Arizza, V.; Parrinello, D.; Parrinello, N. Hemocytes of Rhynchophorus ferrugineus (Olivier) (Coleoptera: Curculionidae) and their response to Saccharomyces cerevisiae and Bacillus thuringiensis. J. Invertebr. Pathol. 2011, 106, 360–365. [Google Scholar] [CrossRef] [PubMed]
- El-Aziz, N.M.; Awad, H.H. Changes in the haemocytes of Agrotis ipsilon larvae (Lepidoptera: Noctuidae) in relation to dimilin and Bacillus thuringiensis infections. Micron 2010, 41, 203–209. [Google Scholar] [CrossRef]
- Denecke, S.; Swevers, L.; Douris, V.; Vontas, J. How do oral insecticidal compounds cross the insect midgut epithelium? Insect Biochem. Mol. Biol. 2018, 103, 22–35. [Google Scholar] [CrossRef] [PubMed]
- Castro, B.M.D.C.E.; Martinez, L.C.; Barbosa, S.G.; Serrão, J.E.; Wilcken, C.F.; Soares, M.A.; da Silva, A.A.; de Carvalho, A.G.; Zanuncio, J.C. Toxicity and cytopathology mediated by Bacillus thuringiensis in the midgut of Anticarsia gemmatalis (Lepidoptera: Noctuidae). Sci. Rep. 2019, 9, 6667. [Google Scholar] [CrossRef] [PubMed]
- Silva, V.C.; Pinheiro, N.L.; Scherer, P.O.; Falcão, S.S.; Ribeiro, V.R.; Mendes, R.M.M.; Chagas, R.; Cardozo-De-Almeida, M.; Dos Santos-Mallet, J.R. Histology and ultrastructure of Aedes albopictus larval midgut infected with Bacillus thuringiensis var. israelensis. Microsc. Res. Tech. 2008, 71, 663–668. [Google Scholar] [CrossRef] [PubMed]
- Daquila, B.V.; Scudeler, E.L.; Dossi, F.C.A.; Moreira, D.R.; Pamphile, J.A.; Conte, H. Action of Bacillus thuringiensis (Bacillales: Bacillaceae) in the midgut of the sugarcane borer Diatraea saccharalis (Fabricius, 1794) (Lepidoptera: Crambidae). Ecotoxicol. Environ. Saf. 2019, 30, 109642. [Google Scholar] [CrossRef] [PubMed]




| Gene | Gene Accession Number | Primer Name | Primer Sequences (5′→3′) |
|---|---|---|---|
| Reference gene (RPL7A) | XM_022970499.1 | F | CGCCCTTTGCCGTAAGAT |
| R | TTGTTGCCGAGGACACCAC | ||
| V-ATPase-D | XM_022979936.1 | F | CAATGCGAGACCCTGGAAGA |
| R | CCAAGAAGGTCGAGAGAGGC | ||
| V-ATPase-C | XM_022970793.1 | F | ACGAGTGAAGTGCTTGGGTA |
| R | TGCTGTAGGAGATGAGCCAG | ||
| V-ATPase-B | XM_022971637.1 | F | ATGAAATTGCCGCCCAGATC |
| R | ATAGTGGGGTCATTGGCCAA | ||
| V-ATPase-A | XM_022969645.1 | F | ACCAACAAGTTCACGTCTGC |
| R | TTGGCTTGCAGTGGTTTCTC | ||
| V-ATPase-E | XM_022959471.1 | F | CTGGCTGAAGTACCCAAGGA |
| R | AGTCACTCTGGGCCTTTGAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.-J.; Shen, Y.-Q.; Xiao, Y.-D.; Yang, X.; Hao, S.-P.; Liu, J.-Q.; Yang, X.-X.; Mita, K.; Xu, Y.-J. New Insight on the Sublethal Effect of Bt-Cry1Ab in Spodoptera litura (Fabricius): Tissular Distribution of Cry1Ab, Ultrastructural Alterations and the Lysosomal Response. Insects 2025, 16, 10. https://doi.org/10.3390/insects16010010
Wang Y-J, Shen Y-Q, Xiao Y-D, Yang X, Hao S-P, Liu J-Q, Yang X-X, Mita K, Xu Y-J. New Insight on the Sublethal Effect of Bt-Cry1Ab in Spodoptera litura (Fabricius): Tissular Distribution of Cry1Ab, Ultrastructural Alterations and the Lysosomal Response. Insects. 2025; 16(1):10. https://doi.org/10.3390/insects16010010
Chicago/Turabian StyleWang, Yan-Jue, Ya-Qin Shen, Ying-Dan Xiao, Xue Yang, Shao-Peng Hao, Jian-Qiu Liu, Xiao-Xue Yang, Kazuei Mita, and Ya-Jing Xu. 2025. "New Insight on the Sublethal Effect of Bt-Cry1Ab in Spodoptera litura (Fabricius): Tissular Distribution of Cry1Ab, Ultrastructural Alterations and the Lysosomal Response" Insects 16, no. 1: 10. https://doi.org/10.3390/insects16010010
APA StyleWang, Y.-J., Shen, Y.-Q., Xiao, Y.-D., Yang, X., Hao, S.-P., Liu, J.-Q., Yang, X.-X., Mita, K., & Xu, Y.-J. (2025). New Insight on the Sublethal Effect of Bt-Cry1Ab in Spodoptera litura (Fabricius): Tissular Distribution of Cry1Ab, Ultrastructural Alterations and the Lysosomal Response. Insects, 16(1), 10. https://doi.org/10.3390/insects16010010

