Genome-Wide Identification and Analysis of Family Members with Juvenile Hormone Binding Protein Domains in Spodoptera frugiperda
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Identification and Chromosomal Localization of the JHBP Gene Family in S. frugiperda
2.2. SfJHBP Gene Duplication and Ka/Ks Value Analysis
2.3. Structure and Conserved Motif Analysis of SfJHBP Genes
2.4. Phylogenetic and Synteny Analysis of the SfJHBP Gene Family
2.5. Analysis of Expression Patterns of the SfJHBP Gene Family in Diverse Developmental Stages and Tissues of S. frugiperda
2.6. qPCR Expression Characteristics of Some SfJHBP Genes in Different Developmental Stages and Different Tissues of S. frugiperda
Insect Rearing
3. Results
3.1. Identification of SfJHBP Gene Family and Chromosomal Localization Analysis
3.2. SfJHBP Protein Structure Analysis
3.2.1. Examination of the Physicochemical Characteristics and Subcellular Localization of the Proteins
3.2.2. Secondary Protein Structure
3.3. Examination of SfJHBP Gene Duplication and Ka/Ks Ratios
3.4. Structure and Conserved Motif Analysis of SfJHBP Gene
3.5. Cross-Species Evolutionary Analysis
3.6. Cross-Species Covariance Analysis
3.7. SfJHBP Gene Family Expression at Various Developmental Stages
3.8. Expression Analysis of SfJHBP Gene Family in Different Tissues of S. frugiperda
3.9. qPCR Expression Analysis of Some SfJHBP Genes in Different Developmental Stages and Different Tissues of S. frugiperda
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Overton, K.; Maino, J.L.; Day, R.; Umina, P.A.; Bett, B.; Carnovale, D.; Ekesi, S.; Meagher, R.; Reynolds, O.L. Global crop impacts, yield losses and action thresholds for fall armyworm (Spodoptera frugiperda): A review. Crop Prot. 2021, 145, 105641. [Google Scholar] [CrossRef]
- Montezano, D.G.; Sosa-Gómez, D.; Specht, A.; Roque-Specht, V.F.; Sousa-Silva, J.C.; Paula-Moraes, S.d.; Peterson, J.A.; Hunt, T. Host plants of Spodoptera frugiperda (Lepidoptera: Noctuidae) in the Americas. Afr. Entomol. 2018, 26, 286–300. [Google Scholar] [CrossRef]
- Liu, B.; Li, Z.G. Overview of the invasion mechanism of fall armyworm Spodoptera frugiperda. J. Plant Prot. 2022, 49, 1313–1328. [Google Scholar]
- Day, R.; Abrahams, P.; Bateman, M.; Beale, T.; Clottey, V.; Cock, M.; Colmenarez, Y.; Corniani, N.; Early, R.; Godwin, J. Fall armyworm: Impacts and implications for Africa. Outlooks Pest Manag. 2017, 28, 196–201. [Google Scholar] [CrossRef]
- Jia, H.-R.; Guo, J.-L.; Wu, Q.-L.; Hu, C.-X.; Li, X.-K.; Zhou, X.-Y.; Wu, K.-M. Migration of invasive Spodoptera frugiperda (Lepidoptera: Noctuidae) across the Bohai Sea in northern China. J. Integr. Agric. 2021, 20, 685–693. [Google Scholar] [CrossRef]
- Truman, J.W.; Riddiford, L.M. The origins of insect metamorphosis. Nature 1999, 401, 447–452. [Google Scholar] [CrossRef] [PubMed]
- Gilbert, L.I.; Granger, N.A.; Roe, R.M. The juvenile hormones: Historical facts and speculations on future research directions. Insect Biochem. Mol. Biol. 2000, 30, 617–644. [Google Scholar] [CrossRef] [PubMed]
- Riddiford, L.M. Hormonal regulation of sequential larval cuticular gene expression. Arch. Insect Biochem. Physiol. 1986, 3, 75–86. [Google Scholar] [CrossRef]
- Kramer, K.; Dunn, P.; Peterson, R.; Seballos, H.; Sanburg, L.; Law, J. Purification and characterization of the carrier protein for juvenile hormone from the hemolymph of the tobacco hornworm Manduca sexta Johannson (Lepidoptera: Sphingidae). J. Biol. Chem. 1976, 251, 4979–4985. [Google Scholar] [CrossRef]
- De Kort, C.; Koopmanschap, A. High molecular transport proteins for JH-III in insect hemolymph. Experientia 1986, 42, 834–836. [Google Scholar] [CrossRef]
- Wiśniewski, J.R.; Muszyńska-Pytel, M.; Grzelak, K.; Kochman, M. Biosynthesis and degradation of juvenile hormone in corpora allata and imaginal wing discs of Galleria mellonella (L.). Insect Biochem. 1987, 17, 249–254. [Google Scholar] [CrossRef]
- Trowell, S.C. High affinity juvenile hormone carrier proteins in the haemolymph of insects. Comp. Biochem. Physiol. Part B Comp. Biochem. 1992, 103, 795–807. [Google Scholar] [CrossRef]
- Kochman, M.; Wieczorek, E. Proteins involved in juvenile hormone signal transmission. In Insects: Chemical, Physiological and Environmental Aspects; Konopinska, D., Goldsworthy, G., Nachman, R.J., Nawrot, J., Orchard, I., Rosinski, G., Sobótka, W., Eds.; University of Wrocław Press: Wrocław, Poland, 1995; pp. 92–118. [Google Scholar]
- Sok, A.J.; Andruszewska, G.; Niewiadomska-Cimicka, A.; Grad, I.; Rymarczyk, G.; Pajdzik, D.; Orłowski, M.; Schmidt, M.T.; Grajek, W.; Ożyhar, A. Regulatory elements in the juvenile hormone binding protein gene from Galleria mellonella—Topography of binding sites for Usp and EcRDBD. Biochim. Biophys. Acta (BBA)-Gene Regul. Mech. 2008, 1779, 390–401. [Google Scholar] [CrossRef]
- Dębski, J.; Wysłouch-Cieszyńska, A.; Dadlez, M.; Grzelak, K.; Kłudkiewicz, B.; Kołodziejczyk, R.; Lalik, A.; Ożyhar, A.; Kochman, M. Positions of disulfide bonds and N-glycosylation site in juvenile hormone binding protein. Arch. Biochem. Biophys. 2004, 421, 260–266. [Google Scholar] [CrossRef]
- Sarov-Blat, L.; So, W.V.; Liu, L.; Rosbash, M. The Drosophila takeout gene is a novel molecular link between circadian rhythms and feeding behavior. Cell 2000, 101, 647–656. [Google Scholar] [CrossRef] [PubMed]
- Saito, K.; Su, Z.H.; Emi, A.; Mita, K.; Takeda, M.; Fujiwara, Y. Cloning and expression analysis of takeout/JHBP family genes of silkworm, Bombyx mori. Insect Mol. Biol. 2006, 15, 245–251. [Google Scholar] [CrossRef]
- Dauwalder, B.; Tsujimoto, S.; Moss, J.; Mattox, W. The Drosophila takeout gene is regulated by the somatic sex-determination pathway and affects male courtship behavior. Genes Dev. 2002, 16, 2879–2892. [Google Scholar] [CrossRef] [PubMed]
- Ghanim, M.; Dombrovsky, A.; Raccah, B.; Sherman, A. A microarray approach identifies ANT, OS-D and takeout-like genes as differentially regulated in alate and apterous morphs of the green peach aphid Myzus persicae (Sulzer). Insect Biochem. Mol. Biol. 2006, 36, 857–868. [Google Scholar] [CrossRef] [PubMed]
- Jindra, M.; Palli, S.R.; Riddiford, L.M. The juvenile hormone signaling pathway in insect development. Annu. Rev. Entomol. 2013, 58, 181–204. [Google Scholar] [CrossRef]
- Orth, A.P.; Lan, Q.; Goodman, W.G. Ligand regulation of juvenile hormone binding protein mRNA in mutant Manduca sexta. Mol. Cell. Endocrinol. 1999, 149, 61–69. [Google Scholar] [CrossRef]
- Orth, A.P.; Tauchman, S.J.; Doll, S.C.; Goodman, W.G. Embryonic expression of juvenile hormone binding protein and its relationship to the toxic effects of juvenile hormone in Manduca sexta. Insect Biochem. Mol. Biol. 2003, 33, 1275–1284. [Google Scholar] [CrossRef] [PubMed]
- Minakuchi, C.; Riddiford, L.M. Insect juvenile hormone action as a potential target of pest management. J. Pestic. Sci. 2006, 31, 77–84. [Google Scholar] [CrossRef]
- Watanabe, M.; Tanaka, K. Hormonal control of diapause and overwintering traits in a leaf beetle, Aulacophora nigripennis. Physiol. Entomol. 2000, 25, 337–345. [Google Scholar] [CrossRef]
- Cho, J.R.; Lee, M.; Kim, H.S.; Boo, K.S. Effect of the juvenile hormone analog, fenoxycarb on termination of reproductive diapause in Scotinophara lurida (Burmeister) (Heteroptera: Pentatomidae). J. Asia-Pac. Entomol. 2007, 10, 145–150. [Google Scholar] [CrossRef]
- Orth, A.; Doll, S.; Goodman, W. Sequence, structure and expression of the hemolymph juvenile hormone binding protein gene in the tobacco hornworm, Manduca sexta. Insect Biochem. Mol. Biol. 2003, 33, 93–102. [Google Scholar] [CrossRef] [PubMed]
- He, X. The DNA Cloning and RNA Interference of Some Functional Genes in Laodelphax striatellus (Fallen). Master’s Thesis, Nanjing Agricultural University, Nanjing, China, 2011. [Google Scholar]
- Ritdachyeng, E.; Manaboon, M.; Tobe, S.S.; Singtripop, T. Molecular characterization and gene expression of juvenile hormone binding protein in the bamboo borer, Omphisa fuscidentalis. J. Insect Physiol. 2012, 58, 1493–1501. [Google Scholar] [CrossRef]
- Parkitna, J.R.; Ozyhar, A.; Wisniewski, J.R.; Kochman, M. Cloning and Sequence Analysis of Galleria mellonella Juvenile Hormone Binding Protein A Search for Ancestors and Relatives. Biol. Chem. 2002, 383, 1343–1355. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Zhou, X.; Tan, Y.; Pang, B.; Xin, B. Cloning and Expression Profiling of the JHBP Gene, GdJHBP, in Galeruca daurica. Chin. J. Appl. Entomol. 2020, 57, 623–631. [Google Scholar]
- Zhang, W.; Liang, G.; Ma, L.; Jiang, T.; Xiao, H. Dissecting the role of juvenile hormone binding protein in response to hormone and starvation in the cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae). J. Econ. Entomol. 2019, 112, 1411–1417. [Google Scholar] [CrossRef]
- He, X.; Zhang, Y.; Li, F.; Li, G.; Dong, S. Cloning and Expression Dynamics of Juvenile Hormone Binding Protein Gene in Laodelphax striatellus. J. Nanjing Agric. Univ. 2012, 35, 59–64. [Google Scholar]
- Fujimoto, Z.; Suzuki, R.; Shiotsuki, T.; Tsuchiya, W.; Tase, A.; Momma, M.; Yamazaki, T. Crystal structure of silkworm Bombyx mori JHBP in complex with 2-methyl-2, 4-pentanediol: Plasticity of JH-binding pocket and ligand-induced conformational change of the second cavity in JHBP. PLoS ONE 2013, 8, e56261. [Google Scholar] [CrossRef]
- Mistry, J.; Chuguransky, S.; Williams, L.; Qureshi, M.; Salazar, G.A.; Sonnhammer, E.L.; Tosatto, S.C.; Paladin, L.; Raj, S.; Richardson, L.J. Pfam: The protein families database in 2021. Nucleic Acids Res. 2021, 49, D412–D419. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [PubMed]
- Finn, R.D.; Clements, J.; Eddy, S.R. HMMER web server: Interactive sequence similarity searching. Nucleic Acids Res. 2011, 39, W29–W37. [Google Scholar] [CrossRef]
- Letunic, I.; Khedkar, S.; Bork, P. SMART: Recent updates, new developments and status in 2020. Nucleic Acids Res. 2021, 49, D458–D460. [Google Scholar] [CrossRef]
- Gasteiger, E.; Gattiker, A.; Hoogland, C.; Ivanyi, I.; Appel, R.D.; Bairoch, A. ExPASy: The proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res. 2003, 31, 3784–3788. [Google Scholar] [CrossRef]
- Horton, P.; Park, K.-J.; Obayashi, T.; Fujita, N.; Harada, H.; Adams-Collier, C.; Nakai, K. WoLF PSORT: Protein localization predictor. Nucleic Acids Res. 2007, 35, W585–W587. [Google Scholar] [CrossRef]
- Geourjon, C.; Deleage, G. SOPMA: Significant improvements in protein secondary structure prediction by consensus prediction from multiple alignments. Bioinformatics 1995, 11, 681–684. [Google Scholar] [CrossRef] [PubMed]
- Yadav, C.B.; Bonthala, V.S.; Muthamilarasan, M.; Pandey, G.; Khan, Y.; Prasad, M. Genome-wide development of transposable elements-based markers in foxtail millet and construction of an integrated database. DNA Res. 2015, 22, 79–90. [Google Scholar] [CrossRef]
- Yu, J.; Wang, J.; Lin, W.; Li, S.; Li, H.; Zhou, J.; Ni, P.; Dong, W.; Hu, S.; Zeng, C. The genomes of Oryza sativa: A history of duplications. PLoS Biol. 2005, 3, e38. [Google Scholar] [CrossRef]
- Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Tamura, K.; Nei, M. MEGA: Molecular evolutionary genetics analysis software for microcomputers. Bioinformatics 1994, 10, 189–191. [Google Scholar] [CrossRef] [PubMed]
- Letunic, I.; Bork, P. Interactive Tree Of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef] [PubMed]
- Xiao, H.; Ye, X.; Xu, H.; Mei, Y.; Yang, Y.; Chen, X.; Yang, Y.; Liu, T.; Yu, Y.; Yang, W. The genetic adaptations of fall armyworm Spodoptera frugiperda facilitated its rapid global dispersal and invasion. Mol. Ecol. Resour. 2020, 20, 1050–1068. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Zhao, R.; Gao, J.; Xiao, X.; Yin, X.; Hu, S.; Zhang, Y.; Liang, P.; Gu, S. Two cuticle-enriched chemosensory proteins confer multi-insecticide resistance in Spodoptera frugiperda. Int. J. Biol. Macromol. 2024, 266, 130941. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Meng, J.Y.; Ruan, H.Y.; Yang, C.L.; Zhang, C.Y. Expression stability of candidate RT-qPCR housekeeping genes in Spodoptera frugiperda (Lepidoptera: Noctuidae). Arch. Insect Biochem. Physiol. 2021, 108, e21831. [Google Scholar] [CrossRef] [PubMed]
- Thornton, B.; Basu, C. Real-time PCR (qPCR) primer design using free online software. Biochem. Mol. Biol. Educ. 2011, 39, 145–154. [Google Scholar] [CrossRef] [PubMed]
- Jin, Y.; Liu, F.; Huang, W.; Sun, Q.; Huang, X. Identification of reliable reference genes for qRT-PCR in the ephemeral plant Arabidopsis pumila based on full-length transcriptome data. Sci. Rep. 2019, 9, 8408. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Hinton, P.R.; McMurray, I.; Brownlow, C. SPSS Explained; Routledge: Oxfordshire, UK, 2014. [Google Scholar]
- Swift, M.L. GraphPad prism, data analysis, and scientific graphing. J. Chem. Inf. Comput. Sci. 1997, 37, 411–412. [Google Scholar] [CrossRef]
- Ye, S.; Chen, Z.; Zhao, Z.; He, H.; Lin, X.; Liang, G. Identification and biological analysis of JHBP gene family members within Dendrolimus houi. J. For. Environ. 2024, 44, 95–104. [Google Scholar]
- Li, W.; Cheng, T.; Hu, W.; Peng, Z.; Liu, C.; Xia, Q. Genome-wide identification and analysis of JHBP-domain family members in the silkworm Bombyx mori. Mol. Genet. Genom. 2016, 291, 2159–2171. [Google Scholar] [CrossRef] [PubMed]
- Innan, H.; Kondrashov, F. The evolution of gene duplications: Classifying and distinguishing between models. Nat. Rev. Genet. 2010, 11, 97–108. [Google Scholar] [CrossRef] [PubMed]
- Freeling, M. Bias in plant gene content following different sorts of duplication: Tandem, whole-genome, segmental, or by transposition. Annu. Rev. Plant Biol. 2009, 60, 433–453. [Google Scholar] [CrossRef] [PubMed]
- Yan, L.-Q.; Tang, F.; Gong, S.-Q.; Luo, J.-Y.; Yuan, R.; Cao, C.-W. Cloning of juvenile hormone binding protein genes in Lymantria dispar and its response to CO2 stresses. J. Environ. Entomol. 2019, 41, 1339–1347. [Google Scholar]
- Li, Y.; Peng, M.; Chen, M.; Li, Y.; Zhang, Q.; Jiang, X.; Liu, Y. Characterization of insect cytosolic juvenile hormone binding protein gene: Highly homology with vertebrate glyoxalase domain containing protein 4. Biochem. Syst. Ecol. 2015, 58, 227–234. [Google Scholar] [CrossRef]
- Qian, J. Study on the Cloning and Expression Patterns of JH-Related Enzyme Genes in Ulomoides Dermestoides. Ph.D. Thesis, Northeast Forestry University, Harbin, China, 2016. [Google Scholar]
- Su, Q.; Lv, J.; Li, W.-X.; Sun, J.-W.; Li, S.-H.; Zhang, W.-Q. Identification of putative abdominal vibration-related genes through transcriptome analyses in the brown planthopper (Nilaparvata lugens). Comp. Biochem. Physiol. Part D Genom. Proteom. 2021, 39, 100856. [Google Scholar] [CrossRef]
- Hagai, T.; Cohen, M.; Bloch, G. Genes encoding putative Takeout/juvenile hormone binding proteins in the honeybee (Apis mellifera) and modulation by age and juvenile hormone of the takeout-like gene GB19811. Insect Biochem. Mol. Biol. 2007, 37, 689–701. [Google Scholar] [CrossRef]
Primer Name | Sequence of Primers (5′-3′) |
---|---|
GADPH-F | CGGTGTCTTCACAACCACAG |
GADPH-R | TTGACACCAACGACGAACAT |
SfJHBP8-F | CTGCTGAGGCTAAGAACTACGA |
SfJHBP8-R | CATTACTGGTTGTGATGCTGTAGA |
SfJHBP14-F | ACGCCAGTGGATGTCTCAA |
SfJHBP14-R | ATCATTAGAGCCTGTCACCATATC |
SfJHBP18-F | ACTGAAGAGTCCAAAGCTAGATTG |
SfJHBP18-R | ACCTTACAAACGACGTTGATGA |
SfJHBP19-F | TCTTCCATCTACCTGACCAACTT |
SfJHBP19-R | GTCCGCAAGGCTCTTCTCTA |
SfJHBP20-F | CTGAACGCTGATGCTGTGAA |
SfJHBP20-R | CTCTGTAGTCCTTGATGCTGATG |
SfJHBP25-F | GCGTCGTGAAGTCCATAGAAG |
SfJHBP25-R | ATGAGCGTGTTGTCTGATGTC |
SfJHBP40-F | AGATTACTTCGCAACCAGCATT |
SfJHBP40-R | GTACGCCAGTAGAAGAATCACAA |
SfJHBP47-F | AGTAACTTGTTCAACGGTGACA |
SfJHBP47-R | AATGCTTGTGACGCCTTCC |
SfJHBP50-F | TGCTCAGAACGGTAATGATGTG |
SfJHBP50-R | TTATTGGTACTGCGAGGAAGAAG |
SfJHBP60-F | GGAGAACCAGTTATATCGCTTGA |
SfJHBP60-R | AAGGCACGGCACGGATAA |
SfJHBP66-F | TGACTTCACGGACGATGAGT |
SfJHBP66-R | TGCCATTGTCTGTTGCTTCTT |
SfJHBP69-F | ATGTCGGCGGTTGAAGGT |
SfJHBP69-R | GGCGGTTGTACTACTGTATCG |
SfJHBP76-F | ATACGCTTAGAGGTGGTGGAA |
SfJHBP76-R | TCTGATGAGGTTGGTGAGGTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Y.; Zou, K.; Wang, T.; Guan, M.; Duan, H.; Yu, H.; Wu, D.; Du, J. Genome-Wide Identification and Analysis of Family Members with Juvenile Hormone Binding Protein Domains in Spodoptera frugiperda. Insects 2024, 15, 573. https://doi.org/10.3390/insects15080573
Liu Y, Zou K, Wang T, Guan M, Duan H, Yu H, Wu D, Du J. Genome-Wide Identification and Analysis of Family Members with Juvenile Hormone Binding Protein Domains in Spodoptera frugiperda. Insects. 2024; 15(8):573. https://doi.org/10.3390/insects15080573
Chicago/Turabian StyleLiu, Yang, Kunliang Zou, Tonghan Wang, Minghui Guan, Haiming Duan, Haibing Yu, Degong Wu, and Junli Du. 2024. "Genome-Wide Identification and Analysis of Family Members with Juvenile Hormone Binding Protein Domains in Spodoptera frugiperda" Insects 15, no. 8: 573. https://doi.org/10.3390/insects15080573
APA StyleLiu, Y., Zou, K., Wang, T., Guan, M., Duan, H., Yu, H., Wu, D., & Du, J. (2024). Genome-Wide Identification and Analysis of Family Members with Juvenile Hormone Binding Protein Domains in Spodoptera frugiperda. Insects, 15(8), 573. https://doi.org/10.3390/insects15080573