Association of Sheep Tail Type with the T Gene Single Nucleotide Polymorphisms Loci
Abstract
1. Introduction
2. Materials and Methods
2.1. Material
2.2. Observation of Tail Morphology in Hulun Buir Short-Tailed Sheep and Hu Sheep
Measurement of Tail Morphology, Length, and Width in Hulun Buir Short-Tailed Sheep and Hu Sheep
2.3. T Gene Sequencing and Tail Type Identification by TaqMan Probe
2.3.1. T Gene Amplification and Identification
2.3.2. TaqMan Probe Genotyping and System Establishment
3. Results
3.1. Observation Results of Tail Morphology in Hulun Buir Short-Tailed Sheep and Hu Sheep
3.2. Results of T Gene Sequencing and Tail Type Identification by TaqMan Probe
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Guillomot, M.; Turbe, A.; Hue, I.; Renard, J.P. Staging of ovine embryos and expression of the T-box genes Brachyury and Eomeso-dermin around gastrulation. Reproduction 2004, 127, 491–501. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Pennimpede, T.; Proske, J.; König, A.; Vidigal, J.A.; Morkel, M.; Bramsen, J.B.; Herrmann, B.G.; Wittler, L. In vivo knockdown of Brachyury results in skeletal defects and urorectal malfor-mations resembling caudal regression syndrome. Dev. Biol. 2012, 372, 55–67. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.; Gao, H.; Sahana, G.; Zan, Y.; Fan, H.; Liu, J.; Shi, L.; Wang, H.; Du, L.; Wang, L.; et al. Genome-wide association studies revealed candidate genes for tail fat deposition and body size in the Hulun Buir sheep. J. Anim. Breed. Genet. 2019, 136, 362–370. [Google Scholar] [CrossRef]
- Chongwen, X.; Fang, C.G. The Histogenesis of the Nerves and Sensory Organs in the Early Embryos of Mongolian Sheep. J. Inn. Mong. Agric. Anim. Husb. Coll. 1998, 47–51. [Google Scholar]
- Cao, G.; Yang, Y.; Zhi, D.; Su, H.; Liu, M. Research on the Short-Tail Characteristic Gene (Brachyury Gene) of Hulun Buir Short-tailed Sheep and Its Application in the Breeding of Hulun Buir Short-Tailed Sheep; Inner Mongolia Agricultural University: Hohhot, China, 2023. [Google Scholar]
- Zhao, Y.; Zhang, D.; Zhang, X.; Li, F.; Xu, D.; Zhao, L.; Li, X.; Zhang, Y.; Wang, J.; Yang, X.; et al. Expression features of the ovine FTO gene and association between FTO polymorphism and tail fat deposition related-traits in Hu sheep. Gene 2022, 826, 146451. [Google Scholar] [CrossRef]
- Li, J.; Wang, R.; Zhao, Y.; Si, R.; Quan, S.; Han, G. Correlation and Regression Analysis of Body Size and Body Weight Traits of Hulunbuir Short-tailed Sheep. Acta Ecol. Anim. Domastici 2016, 37, 18–22. [Google Scholar]
- Zhi, D.F. Study on Resequencing and Short-Tail Phenotypic Related Gene T/Brachyury in Hulunbuir Short-Tail Sheep. Ph.D. Thesis, Inner Mongolia Agricultural University, Hohhot, China, 2018. [Google Scholar]
- Dou, A. Establishment of Single Nucleotide Site Mutation Detection Method and Protein Structure Analysis of Brachyury Gene. Ph.D. Thesis, Inner Mongolia Agricultural University, Hohhot, China, 2022. [Google Scholar]
- Gao, H. Detection of Hereditary Deafness Genes by TaqMan Probe Melting Curve Technique. Ph.D. Thesis, Jinan University, Guangzhou, China, 2016. [Google Scholar]
- Ullah, S.; Notsu, K.; Saito, A.; Okabayashi, T.; Mekata, H.; Isoda, N.; Sekiguchi, S. Direct TaqMan assay for the detection and genotyping of bovine viral diarrhea virus types 1 and 2. Arch Virol. 2024, 170, 15. [Google Scholar] [CrossRef] [PubMed]
- Pu, P.; Li, C.; Zhang, Q.; Wu, F.; Xu, X. Establishment and Application of a TaqMan Fluorescent Quantitative PCR Detection Method for Bovine Coronavirus. Prog. Vet. Med. 2024, 45, 7–10. [Google Scholar]
- Xue, Z.; You, M.; Peng, P.; Tong, H.; He, W.; Li, A.; Mao, P.; Xu, T.; Xu, F.; Yao, C. Taqman-MGB nanoPCR for Highly Specific Detection of Single-Base Mutations. Int. J. Nanomed. 2021, 16, 3695–3705. [Google Scholar] [CrossRef]
- Watson, D.E.; Li, B. TaqMan applications in genetic and molecular toxicology. Int. J. Toxicol. 2005, 24, 139–145. [Google Scholar] [CrossRef] [PubMed]
- Cao, X.; Zhang, L.; Wentao, A.; Xin, J.; Mingyang, Z.; Fumei, Z.; Linbo, H.; Shaojie, C.; Huining, L.; Gutian, Y.; et al. Comparison of Production Performance, Slaughter Performance, Meat Quality and Fatty Acid Composition of Sheep with Different Tail Types. Acta Agric. Boreali-Occident. Sin. 2020, 29, 1–10. [Google Scholar]
- Larsson, M.N.A.; Morell, M.P.; Pan, L.; Başak Vural, K.; Kaptan, D.; Rodrigues Soares, A.E.; Kivikero, H.; Kantanen, J.; Somel, M.; Özer, F.; et al. Ancient Sheep Genomes Reveal Four Millennia of North European Short-Tailed Sheep in the Baltic Sea Region. Genome Biol. Evol. 2024, 16, evae114. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Zhi, D.; Da, L.; Liu, M.; Cheng, C.; Zhang, Y.; Wang, X.; Li, X.; Tian, Z.; Yang, Y.; He, T.; et al. Whole Genome Sequencing of Hulunbuir Short-Tailed Sheep for Identifying Candidate Genes Related to the Short-Tail Phenotype. Genes Genomes Genet. 2018, 8, 377–383. [Google Scholar] [CrossRef] [PubMed]
- Chen, L. Screening of Genes Related to Short Tail Formation in Mongolian Sheep Based on RNA-Seq Data. Ph.D. Thesis, Inner Mongolia Agricultural University, Hohhot, China, 2023. [Google Scholar]
- Xu, S.S.; Ren, X.; Yang, G.L.; Xie, X.L.; Zhao, Y.X.; Zhang, M.; Shen, Z.-Q.; Ren, Y.-L.; Gao, L.; Shen, M.; et al. Genome-wide association analysis identifies the genetic basis of fat deposition in the tails of sheep (Ovis aries). Anim. Genet. 2017, 48, 560–569. [Google Scholar] [CrossRef]
- Kokity, L.; Czimmerer, Z.; Benyhe-Kis, B.; Poscher, A.; Belai, E.; Steinbach, G.; Lipinszki, Z.; Pirity, M.K. Brachyury co-operates with polycomb protein RYBP to regulate gastrulation and axial elongation in vitro. Front. Cell Dev. Biol. 2024, 12, 1498346. [Google Scholar] [CrossRef] [PubMed]
- Yang, G.; Wang, C.; Su, H.; Wang, D.; Dou, A.; Chen, L.; Ma, T.; Liu, M.; Su, J.; Xu, X.; et al. Development and Application of a High-Resolution Melting Analysis with Unlabeled Probes for the Screening of Short-Tailed Sheep TBXT Heterozygotes. Animals 2022, 12, 792. [Google Scholar] [CrossRef] [PubMed]
- Han, J.; Yang, M.; Guo, T.; Niu, C.; Liu, J.; Yue, Y.; Yuan, C.; Yang, B. Two linked TBXT (brachyury) gene polymorphisms are associated with the tailless phenotype in fat-rumped sheep. Anim. Genet. 2019, 50, 772–777. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Primer Sequence (5′→3′) | Product Length |
---|---|---|
SNP-F | ACGCGGGGAAGGAAAAGTC | 513 bp |
SNP-R | CCCCCTCAGCCCCACCTACATC |
Primer Name | Primer Sequence (5′→3′) | Amplification Product Length | Detection Site |
---|---|---|---|
T-HEX | HEX-ACCGAACGGGGGGCCGA-BHQ1 | 95880385 | |
T-FAM | FAM-CGAACGGGGTCCCGTGGGA-BHQ1 | ||
T SNP-F T SNP-R | TGCGCCCCTTCCTTTTCAG GGGGGAGTCGGGGTGGATGTAG | 203 bp | |
Tail Morphology | Large-Tailed Sheep | Mid-Tailed Sheep | Bob-Tailed Sheep |
---|---|---|---|
The tail type contains the flock | Large-tailed Hulun Buir short-tailed sheep/Hu sheep | Fat-rump Hulun Buir short-tailed sheep/medium-tailed Hulun Buir short-tailed sheep | Short-tailed Hulun Buir short-tailed sheep |
Genotype detection by Taqman probe (locus 333/334) | GG/GG | CT/GG | CT/CT OR CT/GG |
Sanger sequencing genotype (locus 333/334) | GG/GG | CT/GG | CT/CT OR CT/GG |
Sequencing Quantity Statistics (Number) | 70 | 42 | 38 |
Morphological quantity Statistics (Number) | 91 | 60 | 41 |
Anastomosis rate of Taqman probe typing (%) | 77 ± 2.4 | 70 ± 3.2 | 93 ± 1.8 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, D.; Zhao, Y.; Fang, W.; Liang, J.; Li, K.; Wang, C.; Cao, G. Association of Sheep Tail Type with the T Gene Single Nucleotide Polymorphisms Loci. Life 2025, 15, 342. https://doi.org/10.3390/life15030342
Wang D, Zhao Y, Fang W, Liang J, Li K, Wang C, Cao G. Association of Sheep Tail Type with the T Gene Single Nucleotide Polymorphisms Loci. Life. 2025; 15(3):342. https://doi.org/10.3390/life15030342
Chicago/Turabian StyleWang, Daqing, Yifan Zhao, Wenjing Fang, Junxi Liang, Kuo Li, Caiyun Wang, and Guifang Cao. 2025. "Association of Sheep Tail Type with the T Gene Single Nucleotide Polymorphisms Loci" Life 15, no. 3: 342. https://doi.org/10.3390/life15030342
APA StyleWang, D., Zhao, Y., Fang, W., Liang, J., Li, K., Wang, C., & Cao, G. (2025). Association of Sheep Tail Type with the T Gene Single Nucleotide Polymorphisms Loci. Life, 15(3), 342. https://doi.org/10.3390/life15030342