Biofilm Formation Capacity and Presence of Virulence Determinants among Enterococcus Species from Milk and Raw Milk Cheeses
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Identification of Enterococci Strains
2.2. Congo Red Agar (CRA) Assay
2.3. Biofilm Production by Microtiter Plate Assay (MTP)
2.4. Detection of Biofilm-Associated Genes and Virulence Factors
2.5. Statistical Analysis
3. Results
3.1. Identification of Enterococci Strains
3.2. Biofilm and Slime-Forming Ability
3.3. Presence of Biofilm-Associated and Virulence Genes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Moreno, M.R.F.; Sarantinopoulos, P.; Tsakalidou, E.; De Vuyst, L. The role and application of enterococci in food and health. Int. J. Food Microbiol. 2006, 106, 1–24. [Google Scholar] [CrossRef] [PubMed]
- Giraffa, G. Enterococci from foods. FEMS Microbiol. Rev. 2002, 26, 163–171. [Google Scholar] [CrossRef] [PubMed]
- Rozanska, H.; Lewtak-Pilat, A.; Osek, J. Enterokoki—Bakterie o wielu obliczach. Życie Weter. 2013, 88, 562–564. [Google Scholar]
- de Lurdes Enes Dapkevicius, M.; Sgardioli, B.; Câmara, S.P.A.; Poeta, P.; Malcata, F.X. Current trends of enterococci in dairy products: A comprehensive review of their multiple roles. Foods 2021, 10, 821. [Google Scholar] [CrossRef]
- Van Den Berghe, E.; De Winter, T.; De Vuyst, L. Enterocin A production by Enterococcus faecium FAIR-E 406 is characterised by a temperature- and pH-dependent switch-off mechanism when growth is limited due to nutrient depletion. Int. J. Food Microbiol. 2006, 107, 159–170. [Google Scholar] [CrossRef]
- Lee, Y. Biofilm formation and antimicrobial resistance in Enterococcus. Infect. Chemother. 2017, 49, 236–237. [Google Scholar] [CrossRef]
- El-Zamkan, M.A.; Mohamed, H.M.A. Antimicrobial resistance, virulence genes and biofilm formation in Enterococcus species isolated from milk of sheep and goat with subclinical mastitis. PLoS ONE 2021, 16, e0259584. [Google Scholar] [CrossRef] [PubMed]
- Sieńko, A.; Wieczorek, P.; Majewski, P.; Ojdana, D.; Wieczorek, A.; Olszańska, D.; Tryniszewska, E. Comparison of antibiotic resistance and virulence between biofilm-producing and non-producing clinical isolates of Enterococcus faecium. Acta Biochim. Pol. 2015, 62, 859–866. [Google Scholar] [CrossRef]
- Prazmo, E.; Godlewska, R.; Kwasny, M.; Mielczarek, A. Udział czynników wirulencji Enterococcus faecalis w rozwoju chorób miazgi i tkanek okołowierzchołkowych. Postępy Mikrobiol. 2016, 55, 247–254. [Google Scholar]
- Duprè, I.; Zanetti, S.; Schito, A.M.; Fadda, G.; Sechi, L.A. Incidence of virulence determinants in clinical Enterococcus faecium and Enterococcus faecalis isolates collected in Sardinia (Italy). J. Med. Microbiol. 2003, 52, 491–498. [Google Scholar] [CrossRef]
- Sandoe, J.A.T.; Witherden, I.R.; Cove, J.H.; Heritage, J.; Wilcox, M.H. Correlation between enterococcal biofilm formation in vitro and medical-device-related infection potential in vivo. J. Med. Microbiol. 2003, 52, 547–550. [Google Scholar] [CrossRef]
- Shin, Y.P.; Kyoung, M.K.; Joon, H.L.; Sook, J.S.; In, H.L. Extracellular gelatinase of Enterococcus faecalis destroys a defense system in insect hemolymph and human serum. Infect. Immun. 2007, 75, 1861–1869. [Google Scholar]
- Mohamed, J.A.; Murray, B.E. Lack of correlation of gelatinase production and biofilm formation in a large collection of Enterococcus faecalis isolates. J. Clin. Microbiol. 2005, 43, 5405–5407. [Google Scholar] [CrossRef] [PubMed]
- Chuang-Smith, O.N.; Wells, C.L.; Henry-Stanley, M.J.; Dunny, G.M. Acceleration of Enterococcus faecalis biofilm formation by aggregation substance expression in an Ex Vivo model of cardiac valve colonization. PLoS ONE 2010, 5, e15798. [Google Scholar] [CrossRef] [PubMed]
- Nallapareddy, S.R.; Murray, B.E. Ligand-signaled upregulation of Enterococcus faecalis ace transcription, a mechanism for modulating host-E. faecalis interaction. Infect. Immun. 2006, 74, 4982–4989. [Google Scholar] [CrossRef] [PubMed]
- Hashem, Y.A.; Amin, H.M.; Essam, T.M.; Yassin, A.S.; Aziz, R.K. Biofilm formation in enterococci: Genotype-phenotype correlations and inhibition by vancomycin. Sci. Rep. 2017, 7, 5733. [Google Scholar] [CrossRef] [PubMed]
- Van Houdt, R.; Michiels, C.W. Biofilm formation and the food industry, a focus on the bacterial outer surface. J. Appl. Microbiol. 2010, 109, 1117–1131. [Google Scholar] [CrossRef] [PubMed]
- Zhan, X.; Tan, Y.; Lv, Y.; Fang, J.; Zhou, Y.; Gao, X.; Zhu, H.; Shi, C. The Antimicrobial and Antibiofilm Activity of Oregano Essential Oil against Enterococcus faecalis and Its Application in Chicken Breast. Foods 2022, 11, 2296. [Google Scholar] [CrossRef]
- Gajewska, J.; Chajęcka-Wierzchowska, W. Biofilm formation ability and presence of adhesion genes among coagulase-negative and coagulase-positive staphylococci isolates from raw cow’s milk. Pathogens 2020, 9, 654. [Google Scholar] [CrossRef]
- Chajęcka-Wierzchowska, W.; Gajewska, J.; Wiśniewski, P.; Zadernowska, A. Enterotoxigenic potential of coagulase-negative staphylococci from ready-to-eat food. Pathogens 2020, 9, 734. [Google Scholar] [CrossRef]
- Freeman, D.J.; Falkiner, F.R.; Patrick, S. New method for detecting slime production by coagulase negative staphylococci. J. Clin. Pathol. 1989, 42, 872–874. [Google Scholar] [CrossRef]
- Stepanović, S.; Vuković, D.; Hola, V.; Bonaventura, G.D.; Djukić, S.; Ćircović, I.; Ruzicka, F. Quantification of biofilm in microtiter plates. Apmis 2007, 115, 891–899. [Google Scholar] [CrossRef]
- Chajecka-Wierzchowska, W.; Zadernowska, A.; Łaniewska-Trokenheim, Ł. Virulence factors, antimicrobial resistance and biofilm formation in Enterococcus spp. isolated from retail shrimps. LWT-Food Sci. Technol. 2016, 69, 117–122. [Google Scholar] [CrossRef]
- Semedo, T.; Santos, M.A.; Martins, P.; Silva Lopes, M.F.; Figueiredo Marques, J.J.; Tenreiro, R.; Barreto Crespo, M.T. Comparative study using type strains and clinical and food isolates to examine hemolytic activity and occurrence of the cyl operon in enterococci. J. Clin. Microbiol. 2003, 41, 2569–2576. [Google Scholar] [CrossRef]
- Lopes, M.d.F.S.; Simões, A.P.; Tenreiro, R.; Marques, J.J.F.; Crespo, M.T.B. Activity and expression of a virulence factor, gelatinase, in dairy enterococci. Int. J. Food Microbiol. 2006, 112, 208–214. [Google Scholar] [CrossRef] [PubMed]
- Willems, R.J.; Homan, W.; Top, J.; van Santen-verheuvel, M.; Tribe, D.; Manzioros, X.; Gaillard, C.; Vandenbroucke-grauls, C.M.; Mascini, E.M.; van Kregten, E.; et al. Variant esp gene as a marker of a distinct genetic lineage of vancomycinresistant Enterococcus faecium spreading in hospitals. Lancet 2001, 357, 853–855. [Google Scholar] [CrossRef]
- Vankerckhoven, V.; Van Autgaerden, T.; Vael, C.; Lammens, C.; Chapelle, S.; Rossi, R.; Jabes, D.; Goossens, H. Development of a multiplex PCR for the detection of asa1, gelE, cylA, esp, and hyl Genes in Enterococci and Survey for Virulence Determinants among European Hospital Isolates of Enterococcus faecium. J. Clin. Microbiol. 2004, 42, 4473–4479. [Google Scholar] [CrossRef] [PubMed]
- Coque, T.M.; Patterson, J.E.; Steckelberg, J.M.; Murray, B.E. Incidence of hemolysin, gelatinase, and aggregation substance among enterococci isolated from patients with endocarditis and other infections and from feces of hospitalized and community-based persons. J. Infect. Dis. 1995, 171, 1223–1229. [Google Scholar] [CrossRef] [PubMed]
- Ramos, S.; Silva, V.; de Lurdes Enes Dapkevicius, M.; Igrejas, G.; Poeta, P. Enterococci, from harmless bacteria to a pathogen. Microorganisms 2020, 8, 1118. [Google Scholar] [CrossRef] [PubMed]
- Lauková, A.; Focková, V.; Pogány Simonová, M. Enterococcal species associated with slovak raw goat milk, their safety and susceptibility to lantibiotics and durancin ed26e/7. Processes 2021, 9, 681. [Google Scholar] [CrossRef]
- Kafil, H.S.; Mobarez, A.M. Assessment of biofilm formation by enterococci isolates from urinary tract infections with different virulence profiles. J. King Saud Univ.-Sci. 2015, 27, 312–317. [Google Scholar] [CrossRef]
- Gürler, H.; Findik, A.; GültIken, N.; Ay, S.S.; Çiftçi, A.; Koldas, E.; Arslan, S.; Findik, M. Investigation on the etiology of subclinical mastitis in jersey and hybrid jersey dairy cows. Acta Vet. 2015, 65, 358–370. [Google Scholar]
- Rózańska, H.; Lewtak-Piłat, A.; Kubajka, M.; Weiner, M. Occurrence of enterococci in mastitic cow’s milk and their antimicrobial resistance. J. Vet. Res. 2019, 63, 93–97. [Google Scholar] [CrossRef]
- Terzić-Vidojević, A.; Veljović, K.; Popović, N.; Tolinački, M.; Golić, N. Enterococci from raw-milk cheeses: Current knowledge on safety, technological, and probiotic concerns. Foods 2021, 10, 2753. [Google Scholar] [CrossRef] [PubMed]
- Igbinosa, E.O.; Beshiru, A. Antimicrobial resistance, virulence determinants, and biofilm formation of Enterococcus species from ready-to-eat seafood. Front. Microbiol. 2019, 10, 728. [Google Scholar] [CrossRef] [PubMed]
- Srey, S.; Jahid, I.K.; Ha, S. Do Biofilm formation in food industries: A food safety concern. Food Control 2013, 31, 572–585. [Google Scholar] [CrossRef]
- Abebe, G.M. The Role of Bacterial Biofilm in Antibiotic Resistance and Food Contamination. Int. J. Microbiol. 2020, 2020, 1705814. [Google Scholar] [CrossRef] [PubMed]
- Kagkli, D.M.; Vancanneyt, M.; Vandamme, P.; Hill, C.; Cogan, T.M. Contamination of milk by enterococci and coliforms from bovine faeces. J. Appl. Microbiol. 2007, 103, 1393–1405. [Google Scholar] [CrossRef] [PubMed]
- Gomes, B.C.; Esteves, C.T.; Palazzo, I.C.V.; Darini, A.L.C.; Felis, G.E.; Sechi, L.A.; Franco, B.D.G.M.; De Martinis, E.C.P. Prevalence and characterization of Enterococcus spp. isolated from Brazilian foods. Food Microbiol. 2008, 25, 668–675. [Google Scholar] [CrossRef] [PubMed]
- Fuka, M.M.; Maksimovic, A.Z.; Tanuwidjaja, I.; Hulak, N.; Schloter, M. Characterization of enterococcal community isolated from an Artisan Istrian raw milk cheese: Biotechnologicaland safety aspects. Food Technol. Biotechnol. 2017, 55, 368–380. [Google Scholar]
- Pereira, R.I.; Prichula, J.; Santesteva, N.A.; d’Azevedo, P.A.; Motta, A.d.S.; Frazzon, A.P.G. Virulence Profiles in Enterococcus spp. Isolated from Raw Buffalo’s Milk in South Brazil. Res. J. Microbiol. 2017, 12, 248–254. [Google Scholar]
- Baldassarri, L.; Cecchini, R.; Bertuccini, L.; Ammendolia, M.G.; Iosi, F.; Arciola, C.R.; Montanaro, L.; Di Rosa, R.; Gherardi, G.; Dicuonzo, G.; et al. Enterococcus spp. produces slime and survives in rat peritoneal macrophages. Med. Microbiol. Immunol. 2001, 190, 113–120. [Google Scholar] [CrossRef]
- Creti, R.; Imperi, M.; Bertuccini, L.; Fabretti, F.; Orefici, G.; Di Rosa, R.; Baldassarri, L. Survey for virulence determinants among Enterococcus faecalis isolated from different sources. J. Med. Microbiol. 2004, 53, 13–20. [Google Scholar] [CrossRef] [PubMed]
- Hendrickx, A.P.A.; Willems, R.J.L.; Bonten, M.J.M.; van Schaik, W. LPxTG surface proteins of enterococci. Trends Microbiol. 2009, 17, 423–430. [Google Scholar] [CrossRef] [PubMed]
- Haas, W.; Shepard, B.D.; Gilmore, M.S. Two-component regulator of Enterococcus faecalis cytolysin responds to quorum-sensing autoinduction. Nature 2002, 415, 84–87. [Google Scholar] [CrossRef]
- de Souza, C.P. Pathogenicity mechanisms of prokaryotic cells: An evolutionary view. Braz. J. Infect. Dis. 2003, 7, 23–31. [Google Scholar]
- Di Rosa, R.; Creti, R.; Venditti, M.; D’Amelio, R.; Arciola, C.; Montanaro, L.; Baldassarri, L. Relationship between biofilm formation, the enterococcal surface protein (Esp) and gelatinase in clinical isolates of Enterococcus faecalis and Enterococcus faecium. FEMS Microbiol. Lett. 2006, 256, 145–150. [Google Scholar] [CrossRef]
- Cappitelli, F.; Polo, A.; Villa, F. Biofilm Formation in Food Processing Environments is Still Poorly Understood and Controlled. Food Eng. Rev. 2014, 6, 29–42. [Google Scholar] [CrossRef]
- Wang, W.; Peng, R.; Liu, J.; Wang, Z.; Guo, T.; Liang, Q.; Carrier, A.J.; Wang, L.; Zhang, X. Biofilm eradication by in situ generation of reactive chlorine species on nano-CuO surfaces. J. Mater. Sci. 2020, 55, 11609–11621. [Google Scholar] [CrossRef]
- Anderson, A.C.; Jonas, D.; Huber, I.; Karygianni, L.; Wölber, J.; Hellwig, E.; Arweiler, N.; Vach, K.; Wittmer, A.; Al-Ahmad, A. Enterococcus faecalis from food, clinical specimens, and oral sites: Prevalence of virulence factors in association with biofilm formation. Front. Microbiol. 2016, 6, 1534. [Google Scholar] [CrossRef]
- Kim, H.J.; Youn, H.Y.; Kang, H.J.; Moon, J.S.; Jang, Y.S.; Song, K.Y.; Seo, K.H. Prevalence and Virulence Characteristics of Enterococcus faecalis and Enterococcus faecium in Bovine Mastitis Milk Compared to Bovine Normal Raw Milk in South Korea. Animals 2022, 12, 1407. [Google Scholar] [CrossRef] [PubMed]
- Chajęcka-Wierzchowska, W.; Zadernowska, A.; Łaniewska-Trokenheim, Ł. Virulence factors of Enterococcus spp. presented in food. LWT 2017, 75, 670–676. [Google Scholar] [CrossRef]
- Medeiros, A.W.; Pereira, R.I.; Oliveira, D.V.; Martins, P.D.; d’Azevedo, P.A.; Van der Sand, S.; Frazzon, J.; Frazzon, A.P.G. Molecular detection of virulence factors among food and clinical Enterococcus faecalis strains in South Brazil. Braz. J. Microbiol. 2014, 45, 327–332. [Google Scholar] [CrossRef]
- Pillai, S.K.; Sakoulas, G.; Eliopoulos, G.M.; Moellering, R.C., Jr.; Murray, B.E.; Inouye, R.T. Effects of Glucose on fsr—Mediated Biofilm Formation in Enterococcus faecalis. J. Infect. Dis. 2004, 190, 967–970. [Google Scholar] [CrossRef]
- Homayouni, A.; Ansari, F.; Azizi, A.; Pourjafar, H.; Madadi, M. Cheese as a Potential Food Carrier to Deliver Probiotic Microorganisms into the Human Gut: A Review. Curr. Nutr. Food Sci. 2018, 16, 15–28. [Google Scholar] [CrossRef]
- Chuang, O.N.; Schlievert, P.M.; Wells, C.L.; Manias, D.A.; Tripp, T.J.; Dunny, G.M. Multiple functional domains of Enterococcus faecalis aggregation substance Asc10 contribute to endocarditis virulence. Infect. Immun. 2009, 77, 539–548. [Google Scholar] [CrossRef]
- Tsikrikonis, G.; Maniatis, A.N.; Labrou, M.; Ntokou, E.; Michail, G.; Daponte, A.; Stathopoulos, C.; Tsakris, A.; Pournaras, S. Differences in biofilm formation and virulence factors between clinical and fecal enterococcal isolates of human and animal origin. Microb. Pathog. 2012, 52, 336–343. [Google Scholar] [CrossRef]
- Begley, M.; Hill, C. Stress adaptation in foodborne pathogens. Annu. Rev. Food Sci. Technol. 2015, 6, 191–210. [Google Scholar] [CrossRef] [PubMed]
- Banda, R.; Nduko, J.; Matofari, J. Bacterial biofilm formation in milking equipments in Lilongwe, Malawi. J. Food Qual. Hazards Control 2020, 7, 142–148. [Google Scholar] [CrossRef]
- Marchand, S.; De Block, J.; De Jonghe, V.; Coorevits, A.; Heyndrickx, M.; Herman, L. Biofilm Formation in Milk Production and Processing Environments; Influence on Milk Quality and Safety. Compr. Rev. Food Sci. Food Saf. 2012, 11, 133–147. [Google Scholar] [CrossRef]
Gene | Primers Sequence | PCR Annealing Temperature (°C) | Amplicon Size (bp) | References |
---|---|---|---|---|
agg | CACGTAATTCTTGCCCACCA | 55 | 520 | [24] |
CAAGCATTATTGGCAGCGTT | ||||
ebpA | CCATTTGCAGAAGCAAGAATG | 54 | 613 | [16] |
GAGTGAAAGTTCCTCCTCTAG | ||||
ebpB | CATTAGCAGAGGCATCGCAA | 54 | 504 | |
CAAGTGGTGGTAAGTCATAGG | ||||
ebpC | CTGCTACGAATATGGTGGTG | 54 | 487 | |
GGTGTTTGATTGTTTGCTTC | ||||
pil | GAAGAAACCAAAGCACCTAC | 54 | 620 | |
CTACCTAAGAAAAGAAACGCG | ||||
srt | GTATCCTTTTGTTAGCGATGC | 54 | 612 | |
TGTCCTCGAACTAATAACCGA | ||||
fsrA | ATGAGTGAACAAATGGCTATTTA | 49 | 740 | [25] |
CTAAGTAAGAAATAGTGCCTTGA | ||||
fsrB | GGGAGCTCTGGACAAAGTATTATCTAACCG | 63 | 566 | |
TTGGTACCCACACCATCACTGACTTTTGC | ||||
sprE | TTGAGCTCCGTTCCTGCCGAAAGTCATTC | 55 | 591 | |
TTGGTACCGATTGGGGAACCAGATTGACC | ||||
esp | AGATTTCATCTTTGATTCTTGG | 56 | 510 | [26] |
AATTGATTCTTTAGCATCTGG | ||||
gelE | TATGACAATGCTTTTTGGGAT | 56 | 213 | [27] |
AGATGCACCCGAAATAATATA | ||||
asa1 | GCACGCTATTACGAACTATGA | 56 | 375 | |
TAAGAAAGAACATCACCACGA | ||||
cylA | ACTCGGGGATTGATAGGC | 56 | 688 | [28] |
GCTGCTAAAGCTGCGCTT |
Number (%) of Isolates | |||||
---|---|---|---|---|---|
Isolation Source | E. feacalis | E. feacium | E. gallinarum | E. casseliflavus | Total |
Raw milk | 42 (89.4%) | 5 (10.2%) | 1 (2.0%) | 1 (2.0%) | 49 (57.6%) |
Raw milk cheeses | 29 (80.6%) | 5 (13.9%) | 2 (5.6%) | 0 (0.0%) | 36 (42.4%) |
Total | 71 (83.5%) | 10 (11.8%) | 3 (3.5%) | 1 (1.2%) | 85 (100.0%) |
Milk Samples | ||||||
---|---|---|---|---|---|---|
Biofilm Formation | Congo Red Agar Method | |||||
Species | Strong | Moderate | Weak | No Biofilm | Positive | Negative |
E. faecalis (n = 42) | 33 (78.6%) | 1 (2.4%) | 0 (0.0%) | 8 (19.0%) | 19 (45.2%) | 23 (54.8%) |
E. faecium (n = 5) | 1 (20%) | 0 (0.0%) | 0 (0.0%) | 4 (80%) | 1 (20%) | 4 (80%) |
E. casseliflavus (n = 1) | 1 (100.0%) | 0 (0.0%) | 0 (0.0%) | 0 (0.0%) | 1 (100%) | 0 (0.0%) |
E. gallinarum (n = 1) | 1 (100.0%) | 0 (0.0%) | 0 (0.0%) | 0 (0.0%) | 0 (0.0%) | 1 (100%) |
All enterococci (n = 49) | 36 (73.5%) | 1 (2.0%) | 0 (0.0%) | 12 (24.5%) | 21 (42.9%) | 28 (57.1%) |
Cheese samples | ||||||
E. faecalis (n = 29) | 12 (41.4%) | 0 (0.0%) | 1 (3.4%) | 16 (55.2%) | 16 (55.2%) | 13 (44.8%) |
E. faecium (n = 5) | 4 (80.0%) | 0 (0.0%) | 0 (0.0%) | 1 (20.0%) | 2 (40.0%) | 3 (60.0%) |
E. gallinarum (n = 2) | 1 (50.0%) | 0 (0.0%) | 0 (0.0%) | 1 (50.0%) | 2 (100.0%) | 0 (0.0%) |
All enterococci (n = 36) | 17 (47.2%) | 0 (0.0%) | 1 (2.8%) | 18 (50.0%) | 20 (55.6%) | 16 (44.4%) |
Genes | Milk Samples | Cheese Samples | ||||||||
---|---|---|---|---|---|---|---|---|---|---|
E. faecalis (n = 42) | E. faecium (n = 5) | E. casseliflavus (n = 1) | E. gallinarum (n = 1) | Total (n = 49) | E. faecalis (n = 29) | E. faecium (n = 5) | E. gallinarum (n = 2) | Total (n = 36) | Total (n = 85) | |
gelE | 36 (85.7%) | 4 (80.0%) | 1 (100.0%) | 1 (100.0%) | 42 (85.7%) | 25 (86.2%) | 5 (100.0%) | 2 (100.0%) | 32 (88.9%) | 74 (87.1%) |
esp | 13 (31.0%) | 2 (40.0%) | 0 (0.0%) | 0 (0.0%) | 15 (30.6%) | 8 (27.6%) | 4 (80.0%) | 1 (50.0%) | 13 (36.1%) | 28 (32.9%) |
asa1 | 28 (66.7%) | 2 (40.0%) | 1 (100.0%) | 0 (0.0%) | 31 (63.3%) | 19 (65.5%) | 4 (80.0%) | 2 (100.0%) | 25 (69.4%) | 56 (65.9%) |
cylA | 2 (4.8%) | 0 (0.0%) | 0 (0.0%) | 0 (0.0%) | 2 (4.1%) | 0 (0.0%) | 0 (0.0%) | 0 (0.0%) | 0 (0.0%) | 2 (2.4%) |
agg | 12 (28.6%) | 2 (40.0%) | 0 (0.0%) | 0 (0.0%) | 14 (28.6%) | 13 (44.8%) | 0 (0.0%) | 1 (50.0%) | 14 (38.9%) | 28 (32.9%) |
ebpA | 27 (64.3%) | 5 (100.0%) | 1 (100.0%) | 1 (100.0%) | 34 (69.4%) | 18 (62.1%) | 5 (100.0%) | 2 (100.0%) | 25 (69.4%) | 59 (69.4%) |
ebpB | 25 (59.5%) | 3 (60.0%) | 1 (100.0%) | 1 (100.0%) | 30 (61.2%) | 21 (72.4%) | 5 (100.0%) | 1 (50.0%) | 27 (75.0%) | 57 (67.1%) |
ebpC | 16 (38.1%) | 1 (20.0%) | 0 (0.0%) | 1 (100.0%) | 18 (36.7%) | 28 (96.6%) | 4 (80.0%) | 2 (100.0%) | 34 (94.4%) | 52 (61.2%) |
pil | 17 (40.5%) | 1 (20.0%) | 0 (0.0%) | 1 (100.0%) | 19 (38.8%) | 26 (89.7%) | 3 (60.0%) | 2 (100.0%) | 31 (86.1%) | 50 (58.8%) |
srt | 20 (47.6%) | 4 (80.0%) | 0 (0.0%) | 1 (100.0%) | 25 (51.0%) | 23 (79.3%) | 4 (80.0%) | 1 (50.0%) | 28 (77.8%) | 53 (62.4%) |
fsrA | 0 (0.0%) | 0 (0.0%) | 0 (0.0%) | 0 (0.0%) | 0 (0.0%) | 5 (17.2%) | 1 (20.0%) | 0 (0.0%) | 6 (16.7%) | 6 (7.1%) |
fsrB | 1 (2.4%) | 2 (40.0%) | 0 (0.0%) | 0 (0.0%) | 3 (6.1%) | 7 (24.1%) | 1 (20.0%) | 0 (0.0%) | 8 (22.2%) | 11 (12.9%) |
sprE | 1 (2.4%) | 0 (0.0%) | 0 (0.0%) | 0 (0.0%) | 1 (2.0%) | 6 (20.7%) | 0 (0.0%) | 0 (0.0%) | 6 (16.7%) | 7 (8.2%) |
Virulence Genes | Enterococcus Species (n = 85) | ||
---|---|---|---|
Biofilm Producers (n = 55) | Non-Biofilm Producers (n = 30) | p-Value | |
n (%) | n (%) | ||
gelE | 48 (87.3) | 26 (86.7) | 1.000 |
esp | 19 (34.5) | 9 (30.0) | 0.810 |
asa1 | 36 (65.5) | 21 (70.0) | 0.810 |
cylA | 2 (3.6) | 0 (0.0) | 0.537 |
agg | 16 (29.1) | 12 (40.0) | 0.341 |
ebpA | 36 (65.5) | 23 (76.7) | 0.332 |
ebpB | 34 (61.8) | 23 (76.7) | 0.228 |
ebpC | 30 (54.5) | 22 (73.3) | 0.107 |
pil | 29 (52.7) | 21 (70.0) | 0.167 |
srt | 31 (56.4) | 22 (73.3) | 0.162 |
fsrA | 2 (3.6) | 4 (13.3) | 0.179 |
fsrB | 7 (12.7) | 4 (13.3) | 1.000 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gajewska, J.; Chajęcka-Wierzchowska, W.; Byczkowska-Rostkowska, Z.; Saki, M. Biofilm Formation Capacity and Presence of Virulence Determinants among Enterococcus Species from Milk and Raw Milk Cheeses. Life 2023, 13, 495. https://doi.org/10.3390/life13020495
Gajewska J, Chajęcka-Wierzchowska W, Byczkowska-Rostkowska Z, Saki M. Biofilm Formation Capacity and Presence of Virulence Determinants among Enterococcus Species from Milk and Raw Milk Cheeses. Life. 2023; 13(2):495. https://doi.org/10.3390/life13020495
Chicago/Turabian StyleGajewska, Joanna, Wioleta Chajęcka-Wierzchowska, Zuzanna Byczkowska-Rostkowska, and Morteza Saki. 2023. "Biofilm Formation Capacity and Presence of Virulence Determinants among Enterococcus Species from Milk and Raw Milk Cheeses" Life 13, no. 2: 495. https://doi.org/10.3390/life13020495
APA StyleGajewska, J., Chajęcka-Wierzchowska, W., Byczkowska-Rostkowska, Z., & Saki, M. (2023). Biofilm Formation Capacity and Presence of Virulence Determinants among Enterococcus Species from Milk and Raw Milk Cheeses. Life, 13(2), 495. https://doi.org/10.3390/life13020495