Impact of Dietary Administration of Seaweed Polysaccharide on Growth, Microbial Abundance, and Growth and Immune-Related Genes Expression of The Pacific Whiteleg Shrimp (Litopenaeus vannamei)
Abstract
1. Introduction
2. Materials and Methods
2.1. Brown Seaweed, Sargassum dentifolium
2.2. Investigation of Water Quality
2.3. The Pacific Whiteleg Shrimp (Litopenaeus vannamei)
2.3.1. Animal Experiment
2.3.2. Experimental Design and Facilities
2.3.3. Experimental Diet
2.4. Tested Parameters
2.4.1. Growth Performances
2.4.2. Biochemical Composition Analysis
2.4.3. Microbial Communities
2.4.4. RNA Extraction and cDNA Synthesis for Genes Expression
2.5. Statistical Analysis
3. Results
3.1. Water Quality
3.2. Growth Performances and Nutrient Utilization Indices
3.3. Shrimp Body Composition Analysis
3.4. Microbial Communities
3.5. Growth, Immunity, and Stress-Related Genes Expressions
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Abbas, E.M.; Ali, F.S.; Desouky, M.G.; Ashour, M.; El-Shafei, A.; Maaty, M.M.; Sharawy, Z.Z. Novel Comprehensive Molecular and Ecological Study Introducing Coastal Mud Shrimp (Solenocera crassicornis) Recorded at the Gulf of Suez, Egypt. J. Mar. Sci. Eng. 2020, 9, 9. [Google Scholar] [CrossRef]
- Abdelrhman, A.M.; Ashour, M.; Al-Zahaby, M.A.; Sharawy, Z.Z.; Nazmi, H.; Zaki, M.A.; Ahmed, N.H.; Ahmed, S.R.; El-Haroun, E.; Van Doan, H. Effect of polysaccharides derived from brown macroalgae Sargassum dentifolium on growth performance, serum biochemical, digestive histology and enzyme activity of hybrid red tilapia. Aquac. Rep. 2022, 25, 101212. [Google Scholar] [CrossRef]
- Goda, A.; Saad, A.; Hanafy, M.; Sharawy, Z.; El-Haroun, E. Dietary effects of Azolla pinnata combined with exogenous digestive enzyme (Digestin™) on growth and nutrients utilization of freshwater prawn, Macrobrachium rosenbergii (de Man 1879). J. Oceanol. Limnol. 2018, 36, 1434–1441. [Google Scholar] [CrossRef]
- Sharawy, Z.Z.; Abbas, E.M.; Abdelkhalek, N.K.; Ashry, O.A.; Abd El-Fattah, L.S.; El-Sawy, M.A.; Helal, M.F.; El-Haroun, E. Effect of organic carbon source and stocking densities on growth indices, water microflora, and immune-related genes expression of Litopenaeus vannamei Larvae in intensive culture. Aquaculture 2022, 546, 737397. [Google Scholar] [CrossRef]
- Gillett, R. Global study of shrimp fisheries. FAO Fish Tech. Pap. 2008, 475, 25–29. [Google Scholar]
- Ahmed, N.; Thompson, S.; Glaser, M. Global aquaculture productivity, environmental sustainability, and climate change adaptability. Environ. Manag. 2019, 63, 159–172. [Google Scholar] [CrossRef] [PubMed]
- Lukwambe, B.; Nicholaus, R.; Zhang, D.; Yang, W.; Zhu, J.; Zheng, Z. Successional changes of microalgae community in response to commercial probiotics in the intensive shrimp (Litopenaeus vannamei Boone) culture systems. Aquaculture 2019, 511, 734257. [Google Scholar] [CrossRef]
- Li, E.; Xu, C.; Wang, X.; Wang, S.; Zhao, Q.; Zhang, M.; Qin, J.G.; Chen, L. Gut microbiota and its modulation for healthy farming of Pacific white shrimp Litopenaeus vannamei. Rev. Fish. Sci. Aquac. 2018, 26, 381–399. [Google Scholar] [CrossRef]
- Stevens, C.; Croft, D.; Paull, G.; Tyler, C. Stress and welfare in ornamental fishes: What can be learned from aquaculture? J. Fish Biol. 2017, 91, 409–428. [Google Scholar] [CrossRef]
- El-Sayed, A.F.M. Use of biofloc technology in shrimp aquaculture: A comprehensive review, with emphasis on the last decade. Rev. Aquac. 2021, 13, 676–705. [Google Scholar] [CrossRef]
- Anh, N.T.N.; Shayo, F.A.; Nevejan, N.; Van Hoa, N. Effects of stocking densities and feeding rates on water quality, feed efficiency, and performance of white leg shrimp Litopenaeus vannamei in an integrated system with sea grape Caulerpa lentillifera. J. Appl. Phycol. 2021, 33, 3331–3345. [Google Scholar] [CrossRef]
- Emerenciano, M.G.; Rombenso, A.N.; Vieira, F.d.N.; Martins, M.A.; Coman, G.J.; Truong, H.H.; Noble, T.H.; Simon, C.J. Intensification of Penaeid Shrimp Culture: An Applied Review of Advances in Production Systems, Nutrition and Breeding. Animals 2022, 12, 236. [Google Scholar] [CrossRef] [PubMed]
- Mansour, A.T.; Ashry, O.A.; Ashour, M.; Alsaqufi, A.S.; Ramadan, K.M.; Sharawy, Z.Z. The optimization of dietary protein level and carbon sources on biofloc nutritive values, bacterial abundance, and growth performances of whiteleg shrimp (Litopenaeus vannamei) juveniles. Life 2022, 12, 888. [Google Scholar] [CrossRef] [PubMed]
- Mansour, A.T.; Ashry, O.A.; El-Neweshy, M.S.; Alsaqufi, A.S.; Dighiesh, H.S.; Ashour, M.; Kelany, M.S.; El-Sawy, M.A.; Mabrouk, M.M.; Abbas, E.M. Effect of Agricultural By-Products as a Carbon Source in a Biofloc-Based System on Growth Performance, Digestive Enzyme Activities, Hepatopancreas Histology, and Gut Bacterial Load of Litopenaeus vannamei Post Larvae. J. Mar. Sci. Eng. 2022, 10, 1333. [Google Scholar] [CrossRef]
- Iber, B.T.; Kasan, N.A. Recent advances in Shrimp aquaculture wastewater management. Heliyon 2021, 7, e08283. [Google Scholar] [CrossRef] [PubMed]
- Zaki, M.A.; Ashour, M.; Heneash, A.M.M.; Mabrouk, M.M.; Alprol, A.E.; Khairy, H.M.; Nour, A.M.; Mansour, A.T.; Hassanien, H.A.; Gaber, A.; et al. Potential Applications of Native Cyanobacterium Isolate (Arthrospira platensis NIOF17/003) for Biodiesel Production and Utilization of Its Byproduct in Marine Rotifer (Brachionus plicatilis) Production. Sustainability 2021, 13, 1769. [Google Scholar] [CrossRef]
- Abisha, R.; Krishnani, K.K.; Sukhdhane, K.; Verma, A.; Brahmane, M.; Chadha, N. Sustainable development of climate-resilient aquaculture and culture-based fisheries through adaptation of abiotic stresses: A review. J. Water Clim. Change 2022, 13, 2671–2689. [Google Scholar] [CrossRef]
- Alprol, A.E.; Ashour, M.; Mansour, A.T.; Alzahrani, O.M.; Mahmoud, S.F.; Gharib, S.M. Assessment of Water Quality and Phytoplankton Structure of Eight Alexandria Beaches, Southeastern Mediterranean Sea, Egypt. J. Mar. Sci. Eng. 2021, 9, 1328. [Google Scholar] [CrossRef]
- Metwally, A.S.; El-Naggar, H.A.; El-Damhougy, K.A.; Bashar, M.A.E.; Ashour, M.; Abo-Taleb, H.A.H. GC-MS analysis of bioactive components in six different crude extracts from the Soft Coral (Sinularia maxim) collected from Ras Mohamed, Aqaba Gulf, Red Sea, Egypt. Egypt. J. Aquat. Biol. Fish. 2020, 24, 425–434. [Google Scholar] [CrossRef]
- Magouz, F.I.; Essa, M.A.; Matter, M.; Tageldein Mansour, A.; Alkafafy, M.; Ashour, M. Population Dynamics, Fecundity and Fatty Acid Composition of Oithona nana (Cyclopoida, Copepoda), Fed on Different Diets. Animals 2021, 11, 1188. [Google Scholar] [CrossRef]
- Kesselring, J.; Gruber, C.; Standen, B.; Wein, S. Effect of a phytogenic feed additive on the growth performance and immunity of Pacific white leg shrimp, Litopenaeus vannamei, fed a low fishmeal diet. J. World Aquac. Soc. 2021, 52, 303–315. [Google Scholar] [CrossRef]
- Sharawy, Z.Z.; Ashour, M.; Labena, A.; Alsaqufi, A.S.; Mensour, A.T.; Abbas, E. Effects of dietary Arthrospira platensis nanoparticles on growth performance, feed utilization, and growth-related gene expression of Pacific white shrimp, Litopenaeus vannamei. Aquaculture 2022, 551, 737905. [Google Scholar] [CrossRef]
- Ceseña, C.E.; Jacinto, E.C.; González, A.L.; Villasante, F.V.; Castro, R.M.M.; Ochoa, N.; Montes, R.E.; Ramírez, D.T.; Ortiz, A.C.S.; Campa-Córdova, A.I. Dietary supplementation of Debaryomyces hansenii enhanced survival, antioxidant and immune response in juvenile shrimp penaeus vannamei challenged with Vibrio Parahaemolyticus. Trop. Subtrop. Agroecosyst. 2021, 24, 2. [Google Scholar] [CrossRef]
- Mansour, A.T.; Ashour, M.; Alprol, A.E.; Alsaqufi, A.S. Aquatic Plants and Aquatic Animals in the Context of Sustainability: Cultivation Techniques, Integration, and Blue Revolution. Sustainability 2022, 14, 3257. [Google Scholar] [CrossRef]
- Hassan, S.M.; Ashour, M.; Soliman, A.A.F.; Hassanien, H.A.; Alsanie, W.F.; Gaber, A.; Elshobary, M.E. The Potential of a New Commercial Seaweed Extract in Stimulating Morpho-Agronomic and Bioactive Properties of Eruca vesicaria (L.) Cav. Sustainability 2021, 13, 4485. [Google Scholar] [CrossRef]
- Essa, D.; Abo-Shady, A.; Khairy, H.; Abomohra, A.E.-F.; Elshobary, M. Potential cultivation of halophilic oleaginous microalgae on industrial wastewater. Egypt. J. Bot. 2018, 58, 205–216. [Google Scholar] [CrossRef]
- Mansour, A.T.; Alprol, A.E.; Abualnaja, K.M.; El-Beltagi, H.S.; Ramadan, K.M.A.; Ashour, M. Dried Brown Seaweed’s Phytoremediation Potential for Methylene Blue Dye Removal from Aquatic Environments. Polymers 2022, 14, 1375. [Google Scholar] [CrossRef]
- Mansour, A.T.; Alprol, A.E.; Abualnaja, K.M.; El-Beltagi, H.S.; Ramadan, K.M.A.; Ashour, M. The Using of Nanoparticles of Microalgae in Remediation of Toxic Dye from Industrial Wastewater: Kinetic and Isotherm Studies. Materials 2022, 15, 3922. [Google Scholar] [CrossRef] [PubMed]
- Mansour, A.T.; Alprol, A.E.; Ashour, M.; Ramadan, K.M.; Alhajji, A.H.; Abualnaja, K.M. Do Red Seaweed Nanoparticles Enhance Bioremediation Capacity of Toxic Dyes from Aqueous Solution? Gels 2022, 8, 310. [Google Scholar] [CrossRef] [PubMed]
- Abou-Shanab, R.A.I.; El-Dalatony, M.M.; El-Sheekh, M.M.; Ji, M.-K.; Salama, E.-S.; Kabra, A.N.; Jeon, B.-H. Cultivation of a new microalga, Micractinium reisseri, in municipal wastewater for nutrient removal, biomass, lipid, and fatty acid production. Biotechnol. Bioprocess Eng. 2014, 19, 510–518. [Google Scholar] [CrossRef]
- Vieira, M.V.; Pastrana, L.M.; Fuciños, P. Microalgae encapsulation systems for food, pharmaceutical and cosmetics applications. Mar. Drugs 2020, 18, 644. [Google Scholar] [CrossRef]
- Fais, G.; Manca, A.; Bolognesi, F.; Borselli, M.; Concas, A.; Busutti, M.; Broggi, G.; Sanna, P.; Castillo-Aleman, Y.M.; Rivero-Jiménez, R.A. Wide Range Applications of Spirulina: From Earth to Space Missions. Mar. Drugs 2022, 20, 299. [Google Scholar] [CrossRef]
- Shao, W.; Ebaid, R.; El-Sheekh, M.; Abomohra, A.; Eladel, H. Pharmaceutical applications and consequent environmental impacts of Spirulina (Arthrospira): An overview. Grasas Y Aceites 2019, 70, e292. [Google Scholar] [CrossRef]
- Ashour, M.; Omran, A.M.M.M. Recent Advances in Marine Microalgae Production: Highlighting Human Health Products from Microalgae in View of the Coronavirus Pandemic (COVID-19). Fermentation 2022, 8, 466. [Google Scholar] [CrossRef]
- Mourelle, M.L.; Gómez, C.P.; Legido, J.L. The potential use of marine microalgae and cyanobacteria in cosmetics and thalassotherapy. Cosmetics 2017, 4, 46. [Google Scholar] [CrossRef]
- Zhuang, D.; He, N.; Khoo, K.S.; Ng, E.-P.; Chew, K.W.; Ling, T.C. Application progress of bioactive compounds in microalgae on pharmaceutical and cosmetics. Chemosphere 2021, 291, 132932. [Google Scholar] [CrossRef] [PubMed]
- Osman, M.E.H.; Abo-shady, A.M.; Elshobary, M.E. In vitro screening of antimicrobial activity of extracts of some macroalgae collected from Abu-Qir bay Alexandria, Egypt. Afr. J. Biotechnol. 2010, 9, 7203–7208. [Google Scholar]
- Osman, M.E.H.; Abo-Shady, A.M.; Elshobary, M.E.; Abd El-Ghafar, M.O.; Abomohra, A.E.-F. Screening of seaweeds for sustainable biofuel recovery through sequential biodiesel and bioethanol production. Environ. Sci. Pollut. Res. 2020, 27, 32481–32493. [Google Scholar] [CrossRef] [PubMed]
- Abomohra, A.E.-F.; Elshobary, M. Biodiesel, Bioethanol, and Biobutanol Production from Microalgae. In Microalgae Biotechnology for Development of Biofuel and Wastewater Treatment; Springer: Cham, Switzerland, 2019; pp. 293–321. [Google Scholar] [CrossRef]
- Elshobary, M.E.; El-Shenody, R.A.; Abomohra, A.E.F. Sequential biofuel production from seaweeds enhances the energy recovery: A case study for biodiesel and bioethanol production. Int. J. Energy Res. 2021, 45, 6457–6467. [Google Scholar] [CrossRef]
- Cai, J.; Lovatelli, A.; Aguilar-Manjarrez, J.; Cornish, L.; Dabbadie, L.; Desrochers, A.; Diffey, S.; Garrido Gamarro, E.; Geehan, J.; Hurtado, A. Seaweeds and Microalgae: An Overview for Unlocking Their Potential in Global Aquaculture Development. In FAO Fisheries and Aquaculture Circular; FAO: Rome, Italy, 2021. [Google Scholar] [CrossRef]
- Chopin, T.; Tacon, A.G. Importance of seaweeds and extractive species in global aquaculture production. Rev. Fish. Sci. Aquac. 2021, 29, 139–148. [Google Scholar] [CrossRef]
- Wan, A.H.; Davies, S.J.; Soler-Vila, A.; Fitzgerald, R.; Johnson, M.P. Macroalgae as a sustainable aquafeed ingredient. Rev. Aquac. 2019, 11, 458–492. [Google Scholar] [CrossRef]
- Khalid, S.; Abbas, M.; Saeed, F.; Bader-Ul-Ain, H.; Suleria, H.A.R. Therapeutic Potential of Seaweed Bioactive Compounds; IntechOpen: London, UK, 2018. [Google Scholar]
- Gamero-Vega, G.; Palacios-Palacios, M.; Quitral, V. Nutritional composition and bioactive compounds of red seaweed: A mini-review. J. Food Nutr. Res. 2020, 8, 431–440. [Google Scholar] [CrossRef]
- Syakilla, N.; George, R.; Chye, F.Y.; Pindi, W.; Mantihal, S.; Wahab, N.A.; Fadzwi, F.M.; Gu, P.H.; Matanjun, P. A Review on Nutrients, Phytochemicals, and Health Benefits of Green Seaweed, Litopenaeus vannamei. Foods 2022, 11, 2832. [Google Scholar] [CrossRef] [PubMed]
- Pereira, V.A.; de Alencar, D.B.; de Araújo, I.W.F.; Rodrigues, J.A.G.; Lopes, J.T.; Nunes, L.T.; Ferreira, Y.M.; Lobato, J.S.; Montenegro, A.R.; Vanderley, C.S.B.S. Supplementation of cryodiluent media with seaweed or Nile tilapia skin sulfated polysaccharides for freezing of Colossoma macropomum (Characiformes: Serrasalmidae) semen. Aquaculture 2020, 528, 735553. [Google Scholar] [CrossRef]
- Yudiati, E.; Isnansetyo, A.; Handayani, C.R. Innate immune-stimulating and immune genes up-regulating activities of three types of alginate from Sargassum siliquosum in Pacific white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol. 2016, 54, 46–53. [Google Scholar] [CrossRef] [PubMed]
- Cantelli, L.; Goncalves, P.; Guertler, C.; Kayser, M.; Pilotto, M.R.; Barracco, M.A.; Perazzolo, L.M. Dietary supplementation with sulfated polysaccharides from Gracilaria birdiae promotes a delayed immunostimulation in marine shrimp challenged by the white spot syndrome virus. Aquac. Int. 2019, 27, 349–367. [Google Scholar] [CrossRef]
- Setyawan, A.; Isnansetyo, A.; Murwantoko, M.; Indarjulianto, S.; Handayani, C. Comparative immune response of dietary fucoidan from three Indonesian brown algae in white shrimp Litopenaeus vannamei. AACL Bioflux 2018, 11, 1707–1723. [Google Scholar]
- Yangthong, M.; Hutadilok-Towatana, N.; Thawonsuwan, J.; Phromkunthong, W. An aqueous extract from Sargassum sp. enhances the immune response and resistance against Streptococcus iniae in the Asian sea bass (Lates calcarifer Bloch). J. Appl. Phycol. 2016, 28, 3587–3598. [Google Scholar]
- Yuguchi, Y.; Bui, L.M.; Takebe, S.; Suzuki, S.; Nakajima, N.; Kitamura, S.; Thanh, T.T.T. Primary structure, conformation in aqueous solution, and intestinal immunomodulating activity of fucoidan from two brown seaweed species Sargassum crassifolium and Padina australis. Carbohydr. Polym. 2016, 147, 69–78. [Google Scholar] [CrossRef]
- Øverland, M.; Mydland, L.T.; Skrede, A. Marine macroalgae as sources of protein and bioactive compounds in feed for monogastric animals. J. Sci. Food Agric. 2019, 99, 13–24. [Google Scholar] [CrossRef] [PubMed]
- Vidhya Hindu, S.; Chandrasekaran, N.; Mukherjee, A.; Thomas, J. A review on the impact of seaweed polysaccharide on the growth of probiotic bacteria and its application in aquaculture. Aquac. Int. 2019, 27, 227–238. [Google Scholar] [CrossRef]
- Sakai, M. Current research status of fish immunostimulants. Aquaculture 1999, 172, 63–92. [Google Scholar] [CrossRef]
- Yan, J.; Guo, C.; Dawood, M.; Gao, J. Effects of dietary chitosan on growth, lipid metabolism, immune response and antioxidant-related gene expression in Misgurnus anguillicaudatus. Benef. Microbes 2017, 8, 439–449. [Google Scholar] [CrossRef] [PubMed]
- Kumari, N.; Kumar, M.; Lorenzo, J.M.; Sharma, D.; Puri, S.; Pundir, A.; Dhumal, S.; Bhuyan, D.J.; Jayanthy, G.; Selim, S. Onion and garlic polysaccharides: A review on extraction, characterization, bioactivity, and modifications. Int. J. Biol. Macromol. 2022, 219, 1047–1061. [Google Scholar] [CrossRef]
- Song, S.K.; Beck, B.R.; Kim, D.; Park, J.; Kim, J.; Kim, H.D.; Ringø, E. Prebiotics as immunostimulants in aquaculture: A review. Fish Shellfish Immunol. 2014, 40, 40–48. [Google Scholar] [CrossRef] [PubMed]
- Paiva, L.; Lima, E.; Neto, A.I.; Baptista, J. Seasonal variability of the biochemical composition and antioxidant properties of Fucus spiralis at two Azorean Islands. Mar. Drugs 2018, 16, 248. [Google Scholar] [CrossRef]
- Pan, S.; Jiang, L.; Wu, S. Stimulating effects of polysaccharide from Angelica sinensis on the nonspecific immunity of white shrimps (Litopenaeus vannamei). Fish Shellfish Immunol. 2018, 74, 170–174. [Google Scholar] [CrossRef] [PubMed]
- Eissa, H.; Hegazi, M.M.; Elmor, M.E.; Sharawy, Z.Z. Effects of partial substitution of fish meal with different levels of marine macroalgae species on growth indices and RNA/DNA ratio of hybrid red tilapia. Egypt. J. Aquat. Biol. Fish. 2021, 25, 395–410. [Google Scholar] [CrossRef]
- Sritunyalucksana, K.; Söderhäll, K. The proPO and clotting system in crustaceans. Aquaculture 2000, 191, 53–70. [Google Scholar] [CrossRef]
- Wang, Y.-B. Effect of probiotics on growth performance and digestive enzyme activity of the shrimp Penaeus vannamei. Aquaculture 2007, 269, 259–264. [Google Scholar] [CrossRef]
- Janeway, C.A. Approaching the asymptote? Evolution and revolution in immunology. Cold Spring Harb. Symp. Quant. Biol. 1989, 54, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Amparyup, P.; Sutthangkul, J.; Charoensapsri, W.; Tassanakajon, A. Pattern recognition protein binds to lipopolysaccharide and β-1, 3-glucan and activates shrimp prophenoloxidase system. J. Biol. Chem. 2012, 287, 10060–10069. [Google Scholar] [CrossRef]
- Kanost, M.R.; Jiang, H.; Yu, X.Q. Innate immune responses of a lepidopteran insect, Manduca sexta. Immunol. Rev. 2004, 198, 97–105. [Google Scholar] [CrossRef]
- Yu, X.-Q.; Kanost, M.R. Immulectin-2, a pattern recognition receptor that stimulates hemocyte encapsulation and melanization in the tobacco hornworm, Manduca sexta. Dev. Comp. Immunol. 2004, 28, 891–900. [Google Scholar] [CrossRef] [PubMed]
- Romo-Figueroa, M.a.G.; Vargas-Requena, C.; Sotelo-Mundo, R.R.; Vargas-Albores, F.; Higuera-Ciapara, I.; Söderhäll, K.; Yepiz-Plascencia, G. Molecular cloning of a β-glucan pattern-recognition lipoprotein from the white shrimp Penaeus (Litopenaeus) vannamei: Correlations between the deduced amino acid sequence and the native protein structure. Dev. Comp. Immunol. 2004, 28, 713–726. [Google Scholar] [CrossRef]
- Lee, S.Y.; Wang, R.; Söderhäll, K. A lipopolysaccharide-and β-1, 3-glucan-binding protein from hemocytes of the freshwater crayfish Pacifastacus leniusculus: Purification, characterization, and cDNA cloning. J. Biol. Chem. 2000, 275, 1337–1343. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.Y.; Söderhäll, K. Early events in crustacean innate immunity. Fish Shellfish Immunol. 2002, 12, 421–437. [Google Scholar] [PubMed]
- Holmblad, T.; Söderhäll, K. Cell adhesion molecules and antioxidative enzymes in a crustacean, possible role in immunity. Aquaculture 1999, 172, 111–123. [Google Scholar] [CrossRef]
- Campa-Córdova, A.; Hernández-Saavedra, N.; De Philippis, R.; Ascencio, F. Generation of superoxide anion and SOD activity in haemocytes and muscle of American white shrimp (Litopenaeus vannamei) as a response to β-glucan and sulphated polysaccharide. Fish Shellfish Immunol. 2002, 12, 353–366. [Google Scholar] [CrossRef] [PubMed]
- Yu, B.P. Cellular defenses against damage from reactive oxygen species. Physiol. Rev. 1994, 74, 139–162. [Google Scholar] [CrossRef]
- Zhang, Q.; Li, F.; Wang, B.; Zhang, J.; Liu, Y.; Zhou, Q.; Xiang, J. The mitochondrial manganese superoxide dismutase gene in Chinese shrimp Fenneropenaeus chinensis: Cloning, distribution and expression. Dev. Comp. Immunol. 2007, 31, 429–440. [Google Scholar] [CrossRef] [PubMed]
- Han, L.; Hole, J.A.; Stock, J.M.; Fuis, G.S.; Kell, A.; Driscoll, N.W.; Kent, G.M.; Harding, A.J.; Rymer, M.J.; González-Fernández, A. Continental rupture and the creation of new crust in the Salton Trough rift, Southern California and northern Mexico: Results from the Salton Seismic Imaging Project. J. Geophys. Res. Solid Earth 2016, 121, 7469–7489. [Google Scholar] [CrossRef]
- Tassanakajon, A.; Rimphanitchayakit, V.; Visetnan, S.; Amparyup, P.; Somboonwiwat, K.; Charoensapsri, W.; Tang, S. Shrimp humoral responses against pathogens: Antimicrobial peptides and melanization. Dev. Comp. Immunol. 2018, 80, 81–93. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Z.-y.; Liu, R.-q.; Si, C.-l.; Zhou, F.; Wang, Y.-x.; Ding, L.-n.; Jing, C.; Liu, A.-j.; Zhang, Y.-m. Structural analysis and anti-tumor activity comparison of polysaccharides from Astragalus. Carbohydr. Polym. 2011, 85, 895–902. [Google Scholar] [CrossRef]
- Picha, M.E.; Turano, M.J.; Tipsmark, C.K.; Borski, R.J. Regulation of endocrine and paracrine sources of Igfs and Gh receptor during compensatory growth in hybrid striped bass (Morone chrysops × Morone saxatilis). J. Endocrinol. 2008, 199, 81. [Google Scholar] [CrossRef] [PubMed]
- Castillo-Juárez, H.; Campos-Montes, G.R.; Caballero-Zamora, A.; Montaldo, H.H. Genetic improvement of Pacific white shrimp [Penaeus (Litopenaeus) vannamei]: Perspectives for genomic selection. Front. Genet. 2015, 6, 93. [Google Scholar] [CrossRef] [PubMed]
- Ashour, M.; Abo-Taleb, H.A.; Hassan, A.-K.M.; Abdelzaher, O.F.; Mabrouk, M.M.; Elokaby, M.A.; Alzahrani, O.M.; Mahmoud, S.F.; El-feky, M.M.M.; Shaban, W.M.; et al. Valorization Use of Amphipod Meal, Gammarus pulex, as a Fishmeal Substitute on Growth Performance, Feed Utilization, Histological and Histometric Indices of the Gut, and Economic Revenue of Grey Mullet. J. Mar. Sci. Eng. 2021, 9, 1336. [Google Scholar] [CrossRef]
- Tabarsa, M.; Shin, I.-S.; Lee, J.H.; Surayot, U.; Park, W.; You, S. An immune-enhancing water-soluble α-glucan from Chlorella vulgaris and structural characteristics. Food Sci. Biotechnol. 2015, 24, 1933–1941. [Google Scholar] [CrossRef]
- Boyd, C.E.; Tucker, C.S. Pond Aquaculture Water Quality Management; Springer Science & Business Media: Berlin/Heidelberg, Germany, 2012. [Google Scholar]
- APHA. Standard Methods for the Examination of Water and Wastewater; American Public Health Association (APHA): Washington, DC, USA, 2005. [Google Scholar]
- Mehrabi, Z.; Firouzbakhsh, F.; Jafarpour, A. Effects of dietary supplementation of synbiotic on growth performance, serum biochemical parameters and carcass composition in rainbow trout (Oncorhynchus mykiss) fingerlings. J. Anim. Physiol. Anim. Nutr. 2012, 96, 474–481. [Google Scholar] [CrossRef]
- Zeraatpisheh, F.; Firouzbakhsh, F.; Khalili, K.J. Effects of the macroalga Sargassum angustifolium hot water extract on hematological parameters and immune responses in rainbow trout (Oncohrynchus mykiss) infected with Yersinia rukeri. J. Appl. Phycol. 2018, 30, 2029–2037. [Google Scholar] [CrossRef]
- AOAC. Official Methods of Analysis of the ASSOCIATION of Official Analytical Chemists; The Association of Official Analytical Chemists: Washington DC, USA, 2003; Volume 2. [Google Scholar]
- Mansour, A.T.; Ashour, M.; Abbas, E.M.; Alsaqufi, A.S.; Kelany, M.S.; El-Sawy, M.A.; Sharawy, Z.Z. Growth Performance, Immune-Related and Antioxidant Genes Expression, and Gut Bacterial Abundance of Pacific White Leg Shrimp, Litopenaeus vannamei, Dietary Supplemented with Natural Astaxanthin. Front. Physiol. 2022, 13, 874172. [Google Scholar] [CrossRef]
- Draper, N.R.; Smith, H. Applied Regression Analysis; John Wiley & Sons: Hoboken, NJ, USA, 1998; Volume 326. [Google Scholar]
- Ganesh, E.A.; Das, S.; Chandrasekar, K.; Arun, G.; Balamurugan, S. Monitoring of total heterotrophic bacteria and Vibrio spp. in an aquaculture pond. Curr. Res. J. Biol. Sci. 2010, 2, 48–52. [Google Scholar]
- Xu, Z.; Regenstein, J.M.; Xie, D.; Lu, W.; Ren, X.; Yuan, J.; Mao, L. The oxidative stress and antioxidant responses of Litopenaeus vannamei to low temperature and air exposure. Fish Shellfish Immunol. 2018, 72, 564–571. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Zar, J. Biostat—Stical Anaslysis, 2nd ed.; Prentice-Hall Inc.: Englewood Cliffs, NJ, USA, 1984. [Google Scholar]
- Abdel-Latif, H.M.; Dawood, M.A.; Alagawany, M.; Faggio, C.; Nowosad, J.; Kucharczyk, D. Health benefits and potential applications of fucoidan (FCD) extracted from brown seaweeds in aquaculture: An updated review. Fish Shellfish Immunol. 2022, 122, 115–130. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.; Zhou, H.; Zhang, H. The effect of Sargassum fusiforme polysaccharide extracts on vibriosis resistance and immune activity of the shrimp, Fenneropenaeus chinensis. Fish Shellfish Immunol. 2006, 20, 750–757. [Google Scholar] [CrossRef]
- Milledge, J.J.; Nielsen, B.V.; Bailey, D. High-value products from macroalgae: The potential uses of the invasive brown seaweed, Sargassum muticum. Rev. Environ. Sci. Bio/Technol. 2016, 15, 67–88. [Google Scholar] [CrossRef]
- Raguraman, V.; Ravindran, N.; Selvaraju, K.; Kasivelu, G. Seaweed polysaccharides as potential therapeutic agents against white spot syndrome virus (WSSV): A mini review. Aquac. Int. 2020, 28, 2333–2343. [Google Scholar] [CrossRef]
- Thanigaivel, S.; Vickram, S.; Saranya, V.; Ali, H.; Alarifi, S.; Modigunta, J.K.R.; Anbarasu, K.; Lakshmipathy, R.; Rohini, K. Seaweed polysaccharide mediated synthesis of silver nanoparticles and its enhanced disease resistance in Oreochromis mossambicus. J. King Saud Univ. Sci. 2022, 34, 101771. [Google Scholar] [CrossRef]
- Lee, P.-T.; Tran, H.T.Q.; Huang, H.-T.; Nan, F.-H.; Lee, M.-C. Sargassum horneri extracts stimulate innate immunity, enhance growth performance, and upregulate immune genes in the white shrimp Litopenaeus vannamei. Fish Shellfish Immunol. 2020, 102, 276–285. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.-C.; Zhou, S.-H.; Balasubramanian, B.; Zeng, F.-Y.; Sun, C.-B.; Pang, H.-Y. Dietary seaweed (Enteromorpha) polysaccharides improves growth performance involved in regulation of immune responses, intestinal morphology and microbial community in banana shrimp Fenneropenaeus merguiensis. Fish Shellfish Immunol. 2020, 104, 202–212. [Google Scholar] [CrossRef]
- Ashour, M.; Mabrouk, M.M.; Ayoub, H.F.; El-Feky, M.M.M.M.; Zaki, S.Z.; Hoseinifar, S.H.; Rossi, W.; Van Doan, H.; El-Haroun, E.; Goda, A.M.A.S. Effect of dietary seaweed extract supplementation on growth, feed utilization, hematological indices, and non-specific immunity of Nile Tilapia, Oreochromis niloticus challenged with Aeromonas hydrophila. J. Appl. Phycol. 2020, 32, 3467–3479. [Google Scholar] [CrossRef]
- Ringø, E.; Zhou, Z.; Vecino, J.G.; Wadsworth, S.; Romero, J.; Krogdahl, Å.; Olsen, R.E.; Dimitroglou, A.; Foey, A.; Davies, S. Effect of dietary components on the gut microbiota of aquatic animals. A never-ending story? Aquac. Nutr. 2016, 22, 219–282. [Google Scholar] [CrossRef]
- Kitikiew, S.; Chen, J.-C.; Putra, D.F.; Lin, Y.-C.; Yeh, S.-T.; Liou, C.-H. Fucoidan effectively provokes the innate immunity of white shrimp Litopenaeus vannamei and its resistance against experimental Vibrio alginolyticus infection. Fish Shellfish Immunol. 2013, 34, 280–290. [Google Scholar] [CrossRef]
- Wongsasak, U.; Chaijamrus, S.; Kumkhong, S.; Boonanuntanasarn, S. Effects of dietary supplementation with β-glucan and synbiotics on immune gene expression and immune parameters under ammonia stress in Pacific white shrimp. Aquaculture 2015, 436, 179–187. [Google Scholar] [CrossRef]
- Cheng, Y. The growth performance and nonspecific immunity of red swamp crayfish Procambarus clarkia affected by dietary Rhodiola rosea polysaccharide. Fish Shellfish Immunol. 2019, 93, 796–800. [Google Scholar] [CrossRef] [PubMed]
- Labbe, P.; Little, T.J. ProPhenolOxidase in Daphnia magna: cDNA sequencing and expression in relation to resistance to pathogens. Dev. Comp. Immunol. 2009, 33, 674–680. [Google Scholar] [CrossRef]
- Panigrahi, A.; Saranya, C.; Sundaram, M.; Kannan, S.V.; Das, R.R.; Kumar, R.S.; Rajesh, P.; Otta, S. Carbon: Nitrogen (C: N) ratio level variation influences microbial community of the system and growth as well as immunity of shrimp (Litopenaeus vannamei) in biofloc based culture system. Fish Shellfish Immunol. 2018, 81, 329–337. [Google Scholar] [CrossRef]
- Rowley, A.F.; Powell, A. Invertebrate immune systems–specific, quasi-specific, or nonspecific? J. Immunol. 2007, 179, 7209–7214. [Google Scholar] [CrossRef] [PubMed]
- Ai-Aql, Z.; Alagl, A.S.; Graves, D.T.; Gerstenfeld, L.C.; Einhorn, T.A. Molecular mechanisms controlling bone formation during fracture healing and distraction osteogenesis. J. Dent. Res. 2008, 87, 107–118. [Google Scholar] [CrossRef]
- Söderhäll, K.; Cerenius, L. Role of the prophenoloxidase-activating system in invertebrate immunity. Curr. Opin. Immunol. 1998, 10, 23–28. [Google Scholar] [CrossRef] [PubMed]
- Sivagnanavelmurugan, M.; Thaddaeus, B.J.; Palavesam, A.; Immanuel, G. Dietary effect of Sargassum wightii fucoidan to enhance growth, prophenoloxidase gene expression of Penaeus monodon and immune resistance to Vibrio parahaemolyticus. Fish Shellfish Immunol. 2014, 39, 439–449. [Google Scholar] [CrossRef]
- Vargas-Albores, F.; Martínez-Porchas, M. Crustins are distinctive members of the WAP-containing protein superfamily: An improved classification approach. Dev. Comp. Immunol. 2017, 76, 9–17. [Google Scholar] [CrossRef] [PubMed]
- Rattanachai, A.; Hirono, I.; Ohira, T.; Takahashi, Y.; Aoki, T. Cloning of kuruma prawn Marsupenaeus japonicus crustin-like peptide cDNA and analysis of its expression. Fish. Sci. 2004, 70, 765–771. [Google Scholar] [CrossRef]
- Wang, H.; Dai, A.; Liu, F.; Guan, Y. Effects of dietary astaxanthin on the immune response, resistance to white spot syndrome virus and transcription of antioxidant enzyme genes in Pacific white shrimp Litopenaeus vannamei. Iran. J. Fish. Sci. 2015, 14, 699–718. [Google Scholar]
- Tyagi, V.V.; Buddhi, D. PCM thermal storage in buildings: A state of art. Renew. Sustain. Energy Rev. 2007, 11, 1146–1166. [Google Scholar] [CrossRef]
- Ringø, E. Evaluation of probiotic strain Bacillus subtilis C-3102 as a feed supplement for koi carp (Cyprinus carpio). J. Aquac. Res. Dev. 2011. [Google Scholar] [CrossRef]
- Zhang, J.; Li, F.; Wang, Z.; Xiang, J. Cloning and recombinant expression of a crustin-like gene from Chinese shrimp, Fenneropenaeus chinensis. J. Biotechnol. 2007, 127, 605–614. [Google Scholar] [CrossRef]
- Liu, W.-J.; Chang, Y.-S.; Wang, C.-H.; Kou, G.-H.; Lo, C.-F. Microarray and RT-PCR screening for white spot syndrome virus immediate-early genes in cycloheximide-treated shrimp. Virology 2005, 334, 327–341. [Google Scholar] [CrossRef] [PubMed]
- Feng, K.; Yu, J.; Cheng, Y.; Ruan, M.; Wang, R.; Ye, Q.; Zhou, G.; Li, Z.; Yao, Z.; Yang, Y. The SOD gene family in tomato: Identification, phylogenetic relationships, and expression patterns. Front. Plant Sci. 2016, 7, 1279. [Google Scholar] [CrossRef] [PubMed]
- Campa-Córdova, A.; Hernández-Saavedra, N.; Aguirre-Guzmán, G.; Ascencio, F. Respuesta inmunomoduladora de la superóxido dismutasa en juveniles de camarón blanco (Litopenaeus vannamei) expuestos a inmunoestimulantes. Ciencias marinas 2005, 31, 661–669. [Google Scholar] [CrossRef]
- Wang, K.H.-C.; Tseng, C.-W.; Lin, H.-Y.; Chen, I.-T.; Chen, Y.-H.; Chen, Y.-M.; Chen, T.-Y.; Yang, H.-L. RNAi knock-down of the Litopenaeus vannamei Toll gene (LvToll) significantly increases mortality and reduces bacterial clearance after challenge with Vibrio harveyi. Dev. Comp. Immunol. 2010, 34, 49–58. [Google Scholar] [CrossRef] [PubMed]
- Sharawy, Z.Z.; Thiele, R.; Abbas, E.M.; El-Magd, M.A.; Hassaan, M.S.; Peter, C.; Schmidt, J.; Saborowski, R.; Goda, A.M.; Slater, M.J. Antioxidant response and body composition of whiteleg shrimp co-cultured with Nile tilapia in recirculating aquaculture. Aquac. Environ. Interact. 2017, 9, 257–268. [Google Scholar] [CrossRef]
- Roch, P. Defense mechanisms and disease prevention in farmed marine invertebrates. Aquaculture 1999, 172, 125–145. [Google Scholar] [CrossRef]
- Hassan, S.A.; Sharawy, Z.Z.; El Nahas, A.F.; Hemeda, S.A.; El-Haroun, E.; Abbas, E.M. Carbon sources improve water quality, microbial community, immune-related and antioxidant genes expression and survival of challenged Litopenaeus vannamei Postlarvae in biofloc system. Aquac. Res. 2022, 53, 5902–5914. [Google Scholar] [CrossRef]
- Hassan, S.A.; Sharawy, Z.Z.; El Nahas, A.F.; Hemeda, S.A.; El-Haroun, E.; Abbas, E.M. Modulatory effects of various carbon sources on growth indices, digestive enzymes activity and expression of growth-related genes in Whiteleg shrimp, Litopenaeus vannamei reared under an outdoor zero-exchange system. Aquac. Res. 2022, 53, 5594–5605. [Google Scholar] [CrossRef]


| Genes | Sequences | Amplicon Size |
|---|---|---|
| β-actin (AF300705) | F: GCCCATCTACGAGGGATA R: GGTGGTCGTGAAGGTGTAA | 121 bp |
| Bgp (AY249858) | F: ACGAGAACGGACAAGAAGTG R: TTCAGCATAGAAGCCATCAGG | 137 bp |
| ProPO (AY723296) | F: CGGTGACAAAGTTCCTCTTC R: GCAGGTCGCCGTAGTAAG | 122 bp |
| Crustin (AF430076) | F: ACGAGGCAACCATGAAGG R: AACCACCACCAACACCTAC | 141 |
| Lys (AY170126) | F: GGACTACGGCATCTTCCAGA R: ATCGGACATCAGATCGGAAC | 97 bp |
| IGF-I (KP420228) * | F: GTGGGCAGGGACCAAATC R: TCAGTTACCACCAGCGATT | 123 bp |
| IGF-II (XM02739466) * | F: CTCTGTACAGTCAGCCCAGC R: CACACCCAGTCAGTCCCAAG | 220 bp |
| SOD (DQ005531) | F: AATTGGAGTGAAAGGCTCTGGCT R: ACGGAGGTTCTTGTACTGAAGGT | 153 |
| GPx (AY973252) | F: AGG GACTTC CAC CAG ATG R: CAA CAACTC CCC TTC GGTA | 117 |
| Tested Parameters | SWP0 | SWP1 | SWP2 | SWP3 |
|---|---|---|---|---|
| NH3− (mg L−1) | 0.119 ± 0.001 | 0.106 ± 0.016 | 0.123 ± 0.015 | 0.125 ± 0.004 |
| NO2− (mg L−1) | 0.119 ± 0.016 bc | 0.101 ± 0.009 c | 0.140 ± 0.001 a | 0.132 ± 0.003 ab |
| NO3− (mg L−1) | 0.222 ± 0.028 | 0.217 ± 0.008 | 0.262 ± 0.004 | 0.257 ± 0.005 |
| PO4− (mg L−1) | 0.485 ± 0.010 | 0.495 ± 0.018 | 0.505 ± 0.007 | 0.485 ± 0.018 |
| Alkalinity (mg L−1) | 7.700 ± 0.625 b | 7.625 ± 0.050 b | 8.563 ± 0.438 ab | 9.038 ± 0.763 a |
| Temperature (°C) | 26.84 ± 0.20 a | 26.75 ± 0.07 a | 26.46 ± 0.04 b | 26.65 ± 0.15 ab |
| Salinity (ppt) | 32.25 ± 0.09 b | 32.35 ± 0.03 b | 32.46 ± 0.02 a | 32.32 ± 0.04 b |
| pH | 7.79 ± 0.02 a | 7.82 ± 0.01 a | 7.78 ± 0.03 a | 7.73 ± 0.08 b |
| Indicator | SWP0 | SWP1 | SWP2 | SWP3 |
|---|---|---|---|---|
| IW (g) | 0.0017 ± 0.001 | 0.0017 ± 0.001 | 0.0017 ± 0.001 | 0.0017 ± 0.001 |
| WG (g) | 10.43 ± 1.15 c | 12.75 ± 2.21 b | 14.97 ± 1.26 a | 15.06 ± 1.28 a |
| SR (%) | 75.56 ± 2.94 b | 77.78 ± 4.08 a | 83.33 ± 3.74 a | 60.00 ± 2.45 c |
| SGR | 7.29 ± 0.55 | 7.45 ± 0.77 | 7.59 ± 0.33 | 7.59 ± 0.41 |
| FCR | 1.58 ± 0.05 | 1.59 ± 0.07 | 1.59 ± 0.09 | 1.58 ± 0.15 |
| Diets | Composition Analysis (% of Dry Weight) | |||
|---|---|---|---|---|
| Dry Matter | Protein | Fat | Ash | |
| SWP0 | 26.53 ± 0.13 a | 23.12 ± 0.03 a | 7.79 ± 0.01 d | 1.60 ± 0.01 d |
| SWP1 | 25.33 ± 0.04 b | 22.32 ± 0.03 b | 10.61 ± 0.02 c | 1.89 ± 0.01 c |
| SWP2 | 24.60 ± 0.03 d | 21.88 ± 0.02 d | 11.00 ± 0.01 a | 2.48 ± 0.02 a |
| SWP3 | 24.93 ± 0.04 c | 22.10 ± 0.01 c | 10.78 ± 0.03 b | 2.19 ± 0.01 b |
| Bacterial Count (CFU mL−1 × 105) | Experimental Diets | |||
|---|---|---|---|---|
| SWP0 | SWP1 | SWP2 | SWP3 | |
| Water | ||||
| THB | 7.251 ± 0.0033 d | 4.200 ± 0.0030 c | 2.651 ± 0.0063 b | 0.119 ± 0.0066 a |
| TVC | 0.114 ± 0.0005 d | 0.068 ± 0.0002 c | 0.045 ± 0.0003 b | 0.005 ± 0.0004 a |
| Intestine | ||||
| THB | 80.00 ± 0.0033 d | 50.00 ± 0.0035 c | 35.00 ± 0.0020 b | 3.00 ± 0.0033 a |
| TVC | 0.591 ± 0.4583 d | 0.476 ± 0.4041 c | 0.282 ± 0.5508 b | 0.007 ± 0.0306 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Abbas, E.M.; Al-Souti, A.S.; Sharawy, Z.Z.; El-Haroun, E.; Ashour, M. Impact of Dietary Administration of Seaweed Polysaccharide on Growth, Microbial Abundance, and Growth and Immune-Related Genes Expression of The Pacific Whiteleg Shrimp (Litopenaeus vannamei). Life 2023, 13, 344. https://doi.org/10.3390/life13020344
Abbas EM, Al-Souti AS, Sharawy ZZ, El-Haroun E, Ashour M. Impact of Dietary Administration of Seaweed Polysaccharide on Growth, Microbial Abundance, and Growth and Immune-Related Genes Expression of The Pacific Whiteleg Shrimp (Litopenaeus vannamei). Life. 2023; 13(2):344. https://doi.org/10.3390/life13020344
Chicago/Turabian StyleAbbas, Eman M., Ahmed Said Al-Souti, Zaki Z. Sharawy, Ehab El-Haroun, and Mohamed Ashour. 2023. "Impact of Dietary Administration of Seaweed Polysaccharide on Growth, Microbial Abundance, and Growth and Immune-Related Genes Expression of The Pacific Whiteleg Shrimp (Litopenaeus vannamei)" Life 13, no. 2: 344. https://doi.org/10.3390/life13020344
APA StyleAbbas, E. M., Al-Souti, A. S., Sharawy, Z. Z., El-Haroun, E., & Ashour, M. (2023). Impact of Dietary Administration of Seaweed Polysaccharide on Growth, Microbial Abundance, and Growth and Immune-Related Genes Expression of The Pacific Whiteleg Shrimp (Litopenaeus vannamei). Life, 13(2), 344. https://doi.org/10.3390/life13020344

