Inhibition of BRUTUS Enhances Plant Tolerance to Zn Toxicity by Upregulating Pathways Related to Iron Nutrition
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Plant Cultivation
2.3. Chlorophyll Quantification
2.4. Measurement of Zn and Fe Contents
2.5. RNA Isolation and Transcription Analysis
2.6. RNA Sequencing and Functional Enrichment Analysis
2.7. Statistical Analysis
3. Results
3.1. Effects of BTS Inhibition on Zn Tolerance and Zn Accumulation
3.2. Effect of BTS Inhibition on the Whole-Genome Transcriptome Profile under Zn Stress
3.3. The Role of Fe Nutrition in BTS Inhibition-Improved Zn Tolerance
3.4. Knockout of BTS-Regulated FRO2 or FRD3 Leads to Impaired Zn Tolerance
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Zhao, K.; Fu, W.; Ye, Z.; Zhang, C. Contamination and Spatial Variation of Heavy Metals in the Soil-Rice System in Nanxun County, Southeastern China. Int. J. Environ. Res. Public Health 2015, 12, 1577–1594. [Google Scholar] [CrossRef] [PubMed]
- Pilon-Smits, E. Phytoremediation. Annu. Rev. Plant Biol. 2005, 56, 15–39. [Google Scholar] [CrossRef] [PubMed]
- Zhao, F.-J.; McGrath, S. Biofortification and phytoremediation. Curr. Opin. Plant Biol. 2009, 12, 373–380. [Google Scholar] [CrossRef]
- Raskin, I.; Ensley, B.D. Phytoremediation of Toxic Metals; Using Plants to Clean up the Environment; John Wiley & Sons, Inc.: New York, NY, USA, 2000; p. 304. [Google Scholar]
- Baker, A.J.M.; McGrath, S.P.; Reeves, R.D.; Smith, J.A.C. Metal Hyperaccumulator Plants: A Review of the Ecology and Physiology of a Biological Resource for Phytoremediation of Metal-Polluted Soils. In Phytoremediation of Contaminated Soil and Water; Terry, N., Banuelos, G., Eds.; Lewis Publ. CRC: Boca Raton, FL, USA, 2000; pp. 85–107. [Google Scholar] [CrossRef]
- Krämer, U. Metal Hyperaccumulation in Plants. Annu. Rev. Plant Biol. 2010, 61, 517–534. [Google Scholar] [CrossRef] [PubMed]
- Sheoran, V.; Sheoran, A.S.; Poonia, P. Phytomining: A review. Miner. Eng. 2009, 22, 1007–1019. [Google Scholar] [CrossRef]
- Cherian, S.; Oliveira, M.M. Transgenic Plants in Phytoremediation: Recent Advances and New Possibilities. Environ. Sci. Technol. 2005, 39, 9377–9390. [Google Scholar] [CrossRef]
- DalCorso, G.; Martini, F.; Fasani, E.; Manara, A.; Visioli, G.; Furini, A. Enhancement of Zn tolerance and accumulation in plants mediated by the expression of Saccharomyces cerevisiae vacuolar transporter ZRC1. Planta 2021, 253, 117. [Google Scholar] [CrossRef]
- Bauddh, K.; Singh, K.; Singh, R.P. Ricinus communis, L. A Value Added Crop for Remediation of Cadmium Contaminated Soil. Bull. Environ. Contam. Toxicol. 2015, 96, 265–269. [Google Scholar] [CrossRef]
- DalCorso, G.; Farinati, S.; Maistri, S.; Furini, A. How Plants Cope with Cadmium: Staking All on Metabolism and Gene Expression. J. Integr. Plant Biol. 2008, 50, 1268–1280. [Google Scholar] [CrossRef]
- Grant, C.A.; Clarke, J.M.; Duguid, S.; Chaney, R.L. Selection and breeding of plant cultivars to minimize cadmium accumulation. Sci. Total Environ. 2008, 390, 301–310. [Google Scholar] [CrossRef]
- Ramesh, S.A.; Choimes, S.; Schachtman, D.P. Over-expression of an Arabidopsis zinc transporter in Hordeum Vulgare increases short-Term zinc uptake after zinc deprivation and seed zinc content. Plant Mol. Biol. 2004, 54, 373–385. [Google Scholar] [CrossRef] [PubMed]
- Marschner, H. Mineral Nutrition of Higher Plants, 2nd ed.; Academic Press: London, UK, 1995; p. 889. [Google Scholar]
- Van Assche, F.; Clijsters, H. Inhibition of photosynthesis in Phaseolus vulgaris by treatment with toxic concentrations of zinc: Effects on electron transport and photophosphorylation. Physiol. Plant. 1986, 66, 717–721. [Google Scholar] [CrossRef]
- Van Assche, F.; Clijsters, H. Inhibition of Photosynthesis in Phaseolus vulgaris by Treatment with Toxic Concentration of Zinc: Effect on Ribulose-1,5-bisphosphate Carboxylase/Oxygenase. J. Plant Physiol. 1986, 125, 355–360. [Google Scholar] [CrossRef]
- Shanmugam, V.; Lo, J.-C.; Yeh, K.-C. Control of Zn uptake in Arabidopsis halleri: A balance between Zn and Fe. Front. Plant Sci. 2013, 4, 281. [Google Scholar] [CrossRef] [Green Version]
- Grotz, N.; Guerinot, M.L. Molecular aspects of Cu, Fe and Zn homeostasis in plants. Biochim. Biophys. Acta BBA-Mol. Cell Res. 2006, 1763, 595–608. [Google Scholar] [CrossRef] [Green Version]
- Xie, X.; Hu, W.; Fan, X.; Chen, H.; Tang, M. Interactions Between Phosphorus, Zinc, and Iron Homeostasis in Nonmycorrhizal and Mycorrhizal Plants. Front. Plant Sci. 2019, 10, 1172. [Google Scholar] [CrossRef]
- Milner, M.J.; Seamon, J.; Craft, E.; Kochian, L. Transport properties of members of the ZIP family in plants and their role in Zn and Mn homeostasis. J. Exp. Bot. 2012, 64, 369–381. [Google Scholar] [CrossRef] [Green Version]
- Tran, B.T.T.; Cavagnaro, T.R.; Able, J.A.; Watts-Williams, S.J. Bioavailability of zinc and iron in durum wheat: A trade-off between grain weight and nutrition. Plants People Planet 2021, 3, 627–639. [Google Scholar] [CrossRef]
- Erenoglu, E.B. Iron deficiency-induced zinc uptake by bread wheat. J. Plant Nutr. Soil Sci. 2019, 182, 496–501. [Google Scholar] [CrossRef]
- VonWiren, N.; Marschner, H.; Romheld, V. Roots of iron-efficient maize also absorb phytosiderophore-chelated zinc. Plant Physiol. 1996, 111, 1119–1125. [Google Scholar] [CrossRef] [Green Version]
- Kawakami, Y.; Bhullar, N.K. Molecular processes in iron and zinc homeostasis and their modulation for biofortification in rice. J. Integr. Plant Biol. 2018, 60, 1181–1198. [Google Scholar] [CrossRef] [PubMed]
- Nascimento, C.W.A.D.; Hesterberg, D.; Tappero, R. Effects of exogenous citric acid on the concentration and spatial distribution of Ni, Zn, Co, Cr, Mn and Fe in leaves of Noccaea caerulescens grown on a serpentine soil. J. Hazard. Mater. 2020, 398, 122992. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, M.; Tsukamoto, T.; Inoue, H.; Watanabe, S.; Matsuhashi, S.; Takahashi, M.; Nakanishi, H.; Mori, S.; Nishizawa, N.K. Deoxymugineic acid increases Zn translocation in Zn-deficient rice plants. Plant Mol. Biol. 2008, 66, 609–617. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guerinot, M.L.; Palmer, C.M. Facing the challenges of Cu, Fe and Zn homeostasis in plants. Nat. Chem. Biol. 2009, 5, 333–340. [Google Scholar] [CrossRef] [Green Version]
- Selote, D.; Samira, R.; Matthiadis, A.; Gillikin, J.W.; Long, T.A. Iron-Binding E3 Ligase Mediates Iron Response in Plants by Targeting Basic Helix-Loop-Helix Transcription Factors. Plant Physiol. 2015, 167, 273–286. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Long, T.A.; Tsukagoshi, H.; Busch, W.; Lahner, B.; Salt, D.E.; Benfey, P.N. The bHLH Transcription Factor POPEYE Regulates Response to Iron Deficiency inArabidopsisRoots. Plant Cell 2010, 22, 2219–2236. [Google Scholar] [CrossRef] [Green Version]
- Zhang, J.; Liu, B.; Li, M.; Feng, D.; Jin, H.; Wang, P.; Liu, J.; Xiong, F.; Wang, J.; Wang, H.-B. The bHLH Transcription Factor bHLH104 Interacts with IAA-LEUCINE RESISTANT3 and Modulates Iron Homeostasis in Arabidopsis. Plant Cell 2015, 27, 787–805. [Google Scholar] [CrossRef] [Green Version]
- Kobayashi, T.; Nagasaka, S.; Senoura, T.; Itai, R.N.; Nakanishi, H.; Nishizawa, N.K. Iron-binding haemerythrin RING ubiquitin ligases regulate plant iron responses and accumulation. Nat. Commun. 2013, 4, 2792. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Y.; Lu, C.K.; Li, C.Y.; Lei, R.H.; Na Pu, M.; Zhao, J.H.; Peng, F.; Ping, H.Q.; Wang, D.; Liang, G. IRON MAN interacts with BRUTUS to maintain iron homeostasis in Arabidopsis. Proc. Natl. Acad. Sci. USA 2021, 118, e2109063118. [Google Scholar] [CrossRef] [PubMed]
- Robinson, N.J.; Procter, C.M.; Connolly, E.L.; Guerinot, M.L. A ferric-chelate reductase for iron uptake from soils. Nature 1999, 397, 694–697. [Google Scholar] [CrossRef]
- Satbhai, S.B.; Setzer, C.; Freynschlag, F.; Slovak, R.; Kerdaffrec, E.; Busch, W. Natural allelic variation of FRO2 modulates Arabidopsis root growth under iron deficiency. Nat. Commun. 2017, 8, 15603. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. Cell Mol. Biol. 1998, 16, 735–743. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fang, X.Z.; Tian, W.H.; Liu, X.X.; Lin, X.Y.; Jin, C.W.; Zheng, S.J. Alleviation of proton toxicity by nitrate uptake specifically depends on nitrate transporter 1.1 in Arabidopsis. New Phytol. 2016, 211, 149–158. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lin, X.Y.; Ye, Y.Q.; Fan, S.K.; Jin, C.W.; Zheng, S.J. Increased Sucrose Accumulation Regulates Iron-Deficiency Responses by Promoting Auxin Signaling in Arabidopsis Plants. Plant Physiol. 2016, 170, 907–920. [Google Scholar] [CrossRef] [Green Version]
- Jin, C.W.; Du, S.T.; Chen, W.W.; Li, G.X.; Zhang, Y.S.; Zheng, S.J. Elevated Carbon Dioxide Improves Plant Iron Nutrition through Enhancing the Iron-Deficiency-Induced Responses under Iron-Limited Conditions in Tomato. Plant Physiol. 2009, 150, 272–280. [Google Scholar] [CrossRef] [Green Version]
- Pertea, M.; Kim, D.; Pertea, G.M.; Leek, J.T.; Salzberg, S.L. Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown. Nat. Protoc. 2016, 11, 1650–1667. [Google Scholar] [CrossRef]
- Yu, G.C.; Wang, L.G.; Han, Y.Y.; He, Q.Y. Cluster Profiler: An R package for comparing biological themes among genclusters. Omics 2012, 16, 284–287. [Google Scholar] [CrossRef]
- Gu, Z.G.; Eils, R.; Schlesner, M. Complex heatmaps reveal patterns and correlations in multidimensional genomic data. Bioinformatics 2016, 32, 2847–2849. [Google Scholar] [CrossRef] [Green Version]
- Kobayashi, T.; Nishizawa, N.K. Iron Uptake, Translocation, and Regulation in Higher Plants. Annu. Rev. Plant Biol. 2012, 63, 131–152. [Google Scholar] [CrossRef] [Green Version]
- Salt, D.E.; Smith, R.D.; Raskin, I. Phytoremediation. Annu. Rev. Plant Phys. 1998, 49, 643–668. [Google Scholar] [CrossRef]
- McGrath, S.P.; Zhao, F.J. Phytoextraction of metals and metalloids from contaminated soils. Curr. Opin. Biotechnol. 2003, 14, 277–282. [Google Scholar] [CrossRef]
- Hindt, M.N.; Akmakjian, G.Z.; Pivarski, K.L.; Punshon, T.; Baxter, I.; Salt, D.E.; Guerinot, M.L. BRUTUS and its paralogs, BTS LIKE1 and BTS LIKE2, encode important negative regulators of the iron deficiency response in Arabidopsis thaliana. Metallomics 2017, 9, 876–890. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.X.; Du, W.X.; Fang, X.Z.; Zhang, L.L.; Jin, C.W. Knockdown of BTS may provide a new strategy to improve cadmium-phytoremediation efficiency by improving iron status in plants. J. Hazard. Mater. 2020, 384, 121473. [Google Scholar] [CrossRef] [PubMed]
- Hurd-Karrer, A.M. Antagonism of certain elements essential to plants toward chemically related toxic elements. Plant Physiol. 1939, 14, 9–29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- He, X.L.; Fan, S.K.; Zhu, J.; Guan, M.Y.; Liu, X.X.; Zhang, Y.S.; Jin, C.W. Iron supply prevents Cd uptake in Arabidopsis by inhibiting IRT1 expression and favoring competition between Fe and Cd uptake. Plant Soil 2017, 416, 453–462. [Google Scholar] [CrossRef]
Usage | Gene Name | Forward Primer Sequence 5′-3′ | Reverse Primer Sequence 5′-3′ |
---|---|---|---|
Real Time PCR | FIT | CAGTCACAAGCGAAGAAACTCA | CTTGTAAAGAGATGGAGCAACACC |
IRT1 | GAATGTGGAAGCGAGTCAGCGA | GATCCCGGAGGCGAAACACTTA | |
FRO2 | GATCGAAAAAAGCAATAACGGTGGTT | GATGTGGCAACCACTTGGTTCGATA | |
FRD3 | TGGACGATCATCCTCTTCATC | GGCAGAGGGCTCCATATTTT | |
BTS | ATGCGAGCATTACAAGCGTAAC | GCATACAGAGCATTTCCGTCAC | |
Cloning | BTS-promoter | GCTATGACCATGATTACGAATTCATACGGCATG GAACGTTTCT | AAATCTGGTAACGGCGTCGCCATTTCCCCCAAAGCTTATCT |
BTS | AGATAAGCTTTGGGGGAAATGGCGACGC CGTTACCAGATTT | TCGCCCTTGCTCACCATGTCGACGGATGAGGTTGAGCAGTCCG | |
Genotyping | BTS | CCAAATGCGTTCGTAGGTAAG | TCAGATTTACACAAATTTGCAGC |
LB1.3 | ATTTTGCCGATTTCGGAAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, Y.; Dai, Y.; Jing, X.; Liu, X.; Jin, C. Inhibition of BRUTUS Enhances Plant Tolerance to Zn Toxicity by Upregulating Pathways Related to Iron Nutrition. Life 2022, 12, 216. https://doi.org/10.3390/life12020216
Zhu Y, Dai Y, Jing X, Liu X, Jin C. Inhibition of BRUTUS Enhances Plant Tolerance to Zn Toxicity by Upregulating Pathways Related to Iron Nutrition. Life. 2022; 12(2):216. https://doi.org/10.3390/life12020216
Chicago/Turabian StyleZhu, Yaxin, Yujie Dai, Xiangting Jing, Xingxing Liu, and Chongwei Jin. 2022. "Inhibition of BRUTUS Enhances Plant Tolerance to Zn Toxicity by Upregulating Pathways Related to Iron Nutrition" Life 12, no. 2: 216. https://doi.org/10.3390/life12020216