Overexpression of PeHKT1;1 Improves Salt Tolerance in Populus
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material and Stress Treatments
2.2. Extraction of DNA and RNA, and cDNA Synthesis
2.3. Isolation of PeHKT1;1 and Sequence Analysis
2.4. Expression Analysis of PeHKT1;1
2.5. Overexpression Vector Construction and Poplar Transformation
2.6. Transgenic Poplar Confirmation and Salt Tolerance Assays
2.7. Physiological Assay
2.8. Accession Numbers of HKTs from Different Species
3. Results
3.1. Isolation and Characterization of PeHKT1;1
3.2. Tissue-Specific Expression of PeHKT1;1
3.3. PeHKT1;1 Transcripts in Salt Stress Conditions
3.4. Generation of PeHKT1;1-Overexpressing Transgenic Poplar Lines
3.5. Overexpression of PeHKT1;1 Enhanced Salt Tolerance
3.6. Overexpression of PeHKT1;1 Raised the Efficiency of Antioxidant Systems under Salt Tolerance
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Munns, R.; Tester, M. Mechanisms of salinity tolerance. Annu. Rev. Plant Biol. 2008, 59, 651–681. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J. Plant salt tolerance. Trends Plant Sci. 2001, 6, 66–71. [Google Scholar] [CrossRef]
- Hasegawa, P.; Bressan, R.; Zhu, J.; Bohnert, H.J. Plant cellular and molecular responses to high salinity. Ann. Rev. Plant Physiol. Plant Mol. Biol. 2000, 51, 463–499. [Google Scholar] [CrossRef] [PubMed]
- Hasegawa, P.M. Sodium (Na+) homeostasis and salt tolerance of plants. Environ. Exp. Bot. 2013, 92, 19–31. [Google Scholar] [CrossRef]
- Apse, M.P.; Aharon, G.S.; Snedden, W.A.; Blumwald, E. Salt tolerance conferred by overexpression of a vacuolar Na+/H+ antiport in Arabidopsis. Science 1999, 285, 1256–1258. [Google Scholar] [CrossRef] [PubMed]
- Schachtman, D.P.; Schroeder, J.I. Structure and transport mechanism of a high-affinity potassium uptake transporter from higher plants. Nature 1994, 370, 655–658. [Google Scholar] [CrossRef] [PubMed]
- Rubio, F.; Gassmann, W.; Schroeder, J.I. Sodium-driven potassium uptake by the plant potassium transporter HKT1 and mutations conferring salt tolerance. Science 1995, 270, 1660–1663. [Google Scholar] [CrossRef] [PubMed]
- Waters, S.; Gilliham, M.; Hrmova, M. Plant High-Affinity Potassium (HKT) Transporters Involved in Salinity Tolerance: Structural Insights to Probe Differences in Ion Selectivity. Int. J. Mol. Sci. 2013, 14, 7660–7680. [Google Scholar] [CrossRef] [PubMed]
- Garriga, M.; Raddatz, N.; Véry, A.; Sentenac, H.; Rubio-Meléndez, M.E.; González, W.; Dreyer, I. Cloning and functional characterization of HKT1 and AKT1 genes of Fragaria spp.—Relationship to plant response to salt stress. J. Plant Physiol. 2017, 210, 9–17. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Wang, P.; Bao, Z.; Ma, Q.; Duan, L.; Bao, A.; Zhang, J.; Wang, S. SOS1, HKT1;5, and NHX1 Synergistically Modulate Na+ Homeostasis in the Halophytic Grass Puccinellia tenuiflora. Front. Plant. Sci. 2017, 8, 576. [Google Scholar] [CrossRef] [PubMed]
- Platten, J.D.; Cotsaftis, O.; Berthomieu, P.; Bohnert, H.; Davenport, R.J.; Fairbairn, D.J.; Horie, T.; Leigh, R.A.; Lin, H.; Luan, S. Nomenclature for HKT transporters, key determinants of plant salinity tolerance. Trends Plant Sci. 2006, 11, 372–374. [Google Scholar] [CrossRef] [PubMed]
- Almeida, P.; Katschnig, D.; de Boer, A.H. HKT transporters—State of the art. Int. J. Mol. Sci. 2013, 14, 20359–20385. [Google Scholar] [CrossRef] [PubMed]
- Jansson, S.; Douglas, C.J. Populus: A model system for plant biology. Annu. Rev. Plant Biol. 2007, 58, 435–458. [Google Scholar] [CrossRef] [PubMed]
- Ye, X.; Busov, V.; Zhao, N.; Meilan, R.; McDonnell, L.M.; Coleman, H.D.; Mansfield, S.D.; Chen, F.; Li, Y.; Cheng, M.Z. Transgenic Populus Trees for Forest Products, Bioenergy, and Functional Genomics. Crit. Rev. Plant Sci. 2011, 30, 415–434. [Google Scholar] [CrossRef]
- Karim, A.; Jiang, Y.; Guo, L.; Ling, Z.; Ye, S.; Duan, Y.; Li, C.; Luo, K. Isolation and characterization of a subgroup IIa WRKY transcription factor PtrWRKY40 from Populus trichocarpa. Tree Physiol. 2015, 35, 1129–1139. [Google Scholar] [CrossRef] [PubMed]
- Yao, W.; Wang, S.; Zhou, B.; Jiang, T. Transgenic poplar overexpressing the endogenous transcription factor ERF76 gene improves salinity tolerance. Tree Physiol. 2016, 36, 896–908. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Su, X.; Zhang, B.; Huang, Q.; Zhang, X.; Huang, R. Expression of jasmonic ethylene responsive factor gene in transgenic poplar tree leads to increased salt tolerance. Tree Physiol. 2009, 29, 273–279. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Wang, J.; Bi, Y.; Wang, L.; Tang, L.; Yu, X.; Ohtani, M.; Demura, T.; Zhuge, Q. Overexpression of PtSOS2 enhances salt tolerance in transgenic poplars. Plant Mol. Biol. Rep. 2014, 32, 185–197. [Google Scholar] [CrossRef] [PubMed]
- Gao, W.; Bai, S.; Li, Q.; Gao, C.; Liu, G.; Li, G.; Tan, F. Overexpression of TaLEA gene from Tamarix androssowii improves salt and drought tolerance in transgenic poplar (Populus simonii × Populus nigra). PLoS ONE 2013, 8, e67462. [Google Scholar] [CrossRef] [PubMed]
- Han, M.S.; Noh, E.W.; Han, S.H. Enhanced drought and salt tolerance by expression of AtGSK1 gene in poplar. Plant Biotechnol. Rep. 2013, 7, 39–47. [Google Scholar] [CrossRef]
- Hu, L.; Lu, H.; Liu, Q.; Chen, X.; Jiang, X. Overexpression of mtlD gene in transgenic Populus tomentosa improves salt tolerance through accumulation of mannitol. Tree Physiol. 2005, 25, 1273–1281. [Google Scholar] [CrossRef] [PubMed]
- Han, X.; Ma, S.; Kong, X.; Takano, T.; Liu, S. Efficient Agrobacterium-mediated transformation of hybrid poplar Populus davidiana Dode × Populus bolleana Lauche. Int. J. Mol. Sci. 2013, 14, 2515–2528. [Google Scholar] [CrossRef] [PubMed]
- Stothard, P. The sequence manipulation suite: JavaScript programs for analyzing and formatting protein and DNA sequences. Biotechniques 2000, 28, 1102–1104. [Google Scholar] [CrossRef] [PubMed]
- Gasteiger, E.; Hoogland, C.; Gattiker, A.; Duvaud, S.; Wilkins, M.R.; Appel, R.D.; Bairoch, A. Protein Identification and Analysis Tools on the ExPASy Server. In The Proteomics Protocols Handbook; Walker, J.M., Ed.; Humana Press: Totowa, NJ, USA, 2005; pp. 571–607. [Google Scholar]
- Krogh, A.; Larsson, B.; von Heijne, G.; Sonnhammer, E.L.L. Predicting transmembrane protein topology with a hidden Markov model: Application to complete genomes. J. Mol. Biol. 2001, 305, 567–580. [Google Scholar] [CrossRef] [PubMed]
- Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Xu, M.; Zhang, B.; Su, X.; Zhang, S.; Huang, M. Reference gene selection for quantitative real-time polymerase chain reaction in Populus. Anal. Biochem. 2011, 408, 337–339. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Xiao, Y.; Cao, L.; Yan, X.; Li, C.; Shi, H.; Wang, J.; Ye, Y. Cerebroside C Increases Tolerance to Chilling Injury and Alters Lipid Composition in Wheat Roots. PLoS ONE 2013, 8, e73380. [Google Scholar] [CrossRef] [PubMed]
- Kader, M.A.; Seidel, T.; Golldack, D.; Lindberg, S. Expressions of OsHKT1, OsHKT2, and OsVHA are differentially regulated under NaCl stress in salt-sensitive and salt-tolerant rice (Oryza sativa L.) cultivars. J. Exp. Bot. 2006, 57, 4257–4268. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, R.; Liu, S.; Takano, T. Cloning and functional comparison of a high-affinity K+ transporter gene PhaHKT1 of salt-tolerant and salt-sensitive reed plants. J. Exp. Bot. 2007, 58, 4387–4395. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Chen, X.; Gu, H.; Wu, B.; Zhang, H.; Yuan, X.; Cui, X. GmHKT1;4, a novel soybean gene regulating Na+ /K+ ratio in roots enhances salt tolerance in transgenic plants. Plant Growth Regul. 2014, 73, 299–308. [Google Scholar] [CrossRef]
- Hauser, F.; Horie, T. A conserved primary salt tolerance mechanism mediated by HKT transporters: A mechanism for sodium exclusion and maintenance of high K+/Na+ ratio in leaves during salinity stress. Plant Cell Environ. 2010, 33, 552–565. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez-Navarro, A.; Rubio, F. High-affinity potassium and sodium transport systems in plants. J. Exp. Bot. 2006, 57, 1149–1160. [Google Scholar] [CrossRef] [PubMed]
- Pardo, J.M.; Rubio, F. Na+ and K+ transporters in plant signaling. In Transporters and Pumps in Plant Signaling; Springer: Berlin/Heidelberg, Germany, 2011; Volume 7, pp. 65–98. ISBN 978-3-642-14368-7. [Google Scholar]
- Durell, S.R.; Guy, H.R. Structural models of the KtrB, TrkH, and Trk1, 2 symporters based on the structure of the KcsA K+ channel. Biophys. J. 1999, 77, 789–807. [Google Scholar] [CrossRef]
- Durell, S.R.; Hao, Y.; Nakamura, T.; Bakker, E.P.; Guy, H.R. Evolutionary relationship between K+ channels and symporters. Biophys. J. 1999, 77, 775–788. [Google Scholar] [CrossRef]
- Mäser, P.; Hosoo, Y.; Goshima, S.; Horie, T.; Eckelman, B.; Yamada, K.; Yoshida, K.; Bakker, E.P.; Shinmyo, A.; Oiki, S. Glycine residues in potassium channel-like selectivity filters determine potassium selectivity in four-loop-per-subunit HKT transporters from plants. Proc. Natl. Acad. Sci. USA 2002, 99, 6428–6433. [Google Scholar] [CrossRef] [PubMed]
- Jabnoune, M.; Espeout, S.; Mieulet, D.; Fizames, C.; Verdeil, J.; Conéjéro, G.; Rodríguez-Navarro, A.; Sentenac, H.; Guiderdoni, E.; Abdelly, C. Diversity in expression patterns and functional properties in the rice HKT transporter family. Plant Physiol. 2009, 150, 1955–1971. [Google Scholar] [CrossRef] [PubMed]
- Berthomieu, P.; Conéjéro, G.; Nublat, A.; Brackenbury, W.J.; Lambert, C.; Savio, C.; Uozumi, N.; Oiki, S.; Yamada, K.; Cellier, F. Functional analysis of AtHKT1 in Arabidopsis shows that Na+ recirculation by the phloem is crucial for salt tolerance. EMBO J. 2003, 22, 2004–2014. [Google Scholar] [CrossRef] [PubMed]
- Su, H.; Balderas, E.; Vera-Estrella, R.; Golldack, D.; Quigley, F.; Zhao, C.; Pantoja, O.; Bohnert, H.J. Expression of the cation transporter McHKT1 in a halophyte. Plant Mol. Biol. 2003, 52, 967–980. [Google Scholar] [CrossRef] [PubMed]
- Shao, Q.; Zhao, C.; Han, N.; Wang, B. Cloning and expression pattern of SsHKT1 encoding a putative cation transporter from halophyte Suaeda salsa. DNA Sequence 2009, 19, 106–114. [Google Scholar] [CrossRef] [PubMed]
- Fairbairn, D.J.; Liu, W.; Schachtman, D.P.; Gomez-Gallego, S.; Day, S.R.; Teasdale, R.D. Characterisation of two distinct HKT1-like potassium transporters from Eucalyptus camaldulensis. Plant Mol. Biol. 2000, 43, 515–525. [Google Scholar] [CrossRef] [PubMed]
- Deinlein, U.; Stephan, A.B.; Horie, T.; Luo, W.; Xu, G.; Schroeder, J.I. Plant salt-tolerance mechanisms. Trends Plant Sci. 2014, 19, 371–379. [Google Scholar] [CrossRef] [PubMed]
- Horie, T.; Motoda, J.; Kubo, M.; Yang, H.; Yoda, K.; Horie, R.; Chan, W.Y.; Leung, H.Y.; Hattori, K.; Konomi, M. Enhanced salt tolerance mediated by AtHKT1 transporter-induced Na+ unloading from xylem vessels to xylem parenchyma cells. Plant J. 2005, 44, 928–938. [Google Scholar] [CrossRef]
- Shavrukov, Y. Salt stress or salt shock: Which genes are we studying? J. Exp. Bot. 2012, 64, 119–127. [Google Scholar] [CrossRef] [PubMed]
- Munns, R. Comparative physiology of salt and water stress. Plant Cell Environ. 2002, 25, 239–250. [Google Scholar] [CrossRef] [PubMed]
- Tsuchihira, A.; Hanba, Y.T.; Kato, N.; Doi, T.; Kawazu, T.; Maeshima, M. Effect of overexpression of radish plasma membrane aquaporins on water-use efficiency, photosynthesis and growth of Eucalyptus trees. Tree Physiol. 2010, 30, 417–430. [Google Scholar] [CrossRef] [PubMed]
- Hsieh, T.; Lee, J.; Yang, P.; Chiu, L.; Charng, Y.; Wang, Y.; Chan, M. Heterology Expression of the Arabidopsis C-Repeat/Dehydration Response Element Binding Factor 1 Gene Confers Elevated Tolerance to Chilling and Oxidative Stresses in Transgenic Tomato. Plant Physiol. 2002, 129, 1086–1094. [Google Scholar] [CrossRef] [PubMed]
- Romero, C.; Bellés, J.M.; Vayá, J.L.; Serrano, R.; Culiáñez-Macià, F.A. Expression of the yeast trehalose-6-phosphate synthase gene in transgenic tobacco plants: Pleiotropic phenotypes include drought tolerance. Planta 1997, 201, 293–297. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.K. Salt and drought stress signal transduction in plants. Annu. Rev. Plant Biol. 2002, 53, 247–273. [Google Scholar] [CrossRef] [PubMed]
- Du, C.; Zhao, P.; Zhang, H.; Li, N.; Zheng, L.; Wang, Y. The Reaumuria trigyna transcription factor RtWRKY1 confers tolerance to salt stress in transgenic Arabidopsis. J. Plant Physiol. 2017, 215, 48–58. [Google Scholar] [CrossRef] [PubMed]
- Mason, M.G.; Jha, D.; Salt, D.E.; Tester, M.; Hill, K.; Kieber, J.J.; Eric Schaller, G. Type-B response regulators ARR1 and ARR12 regulate expression of AtHKT1;1 and accumulation of sodium in Arabidopsis shoots. Plant J. 2010, 64, 753–763. [Google Scholar] [CrossRef] [PubMed]
- Nishiyama, R.; Le, D.T.; Watanabe, Y.; Matsui, A.; Tanaka, M.; Seki, M.; Yamaguchi-Shinozaki, K.; Shinozaki, K.; Tran, L.P. Transcriptome analyses of a salt-tolerant cytokinin-deficient mutant reveal differential regulation of salt stress response by cytokinin deficiency. PLoS ONE 2012, 7, e32124. [Google Scholar] [CrossRef] [PubMed]
- Shkolnik Inbar, D.; Adler, G.; Bar Zvi, D. ABI4 downregulates expression of the sodium transporter HKT1;1 in Arabidopsis roots and affects salt tolerance. Plant J. 2013, 73, 993–1005. [Google Scholar] [CrossRef] [PubMed]
- Yang, O.; Popova, O.V.; Suthoff, U.; Luking, I.; Dietz, K.; Golldack, D. The Arabidopsis basic leucine zipper transcription factor AtbZIP24 regulates complex transcriptional networks involved in abiotic stress resistance. Gene 2009, 436, 45–55. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Jing, W.; Xiao, L.; Jin, Y.; Shen, L.; Zhang, W. The rice high-affinity potassium transporter1;1 is involved in salt tolerance and regulated by an MYB-type transcription factor. Plant Physiol. 2015, 168, 1076–1090. [Google Scholar] [CrossRef] [PubMed]







| Primer ID | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| 3′RACE outer | ATCTATTGTCGATCTCTCCATC | TACCGTCGTTCCACTAGTGATTT |
| 3′RACE inner | TGCCGAAAAAGCAACAGGAAGAGGTTGA | CGCGGATCCTCCACTAGTGATTTCACTATAGG |
| 5′RACE outer | AGAACCCGACATTTCCGTATGC | CATGGCTACATGCTGACAGCCTA |
| 5′RACE inner | GGTGAGAACAACAGGCACTGAACCAAAGAC | CGCGGATCCACAGCCTACTGATGATCAGTCGATG |
| PeHKT1;1-ORF | ATGAAGAGCTTTGCTAGT | CTAGGATAGCTTCCAAGCTTTACCA |
| SqRT-PCR | TCTTCGGCAACAGTTTCAAG | CCACACAAGCAAGGCTCTTA |
| qRT-PCR | GGCTATAGCTGCAAACGACA | AAGCCTTCCGAAGAGCATTA |
| Eflα | GGCAAGGAGAAGGTACACAT | CAATCACACGCTTGTCAATA |
| 18SrRNA | TCAACTTTCGATGGTAGGATAGTG | CCGTGTCAGGATTGGGTAATTT |
| BP detection | ATGAAGAGCTTTGCTAGT | TAATACGACTCACTATAGGG’ |
| LR detection | CGCACAATCCCACTATCCTT | CTAGGATAGCTTCCAAGCTTTACCA |
| Transgene detection | CGCACAATCCCACTATCCTT | CTAGGATAGCTTCCAAGCTTTACCA |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, M.; Chen, C.; Cai, H.; Wu, L. Overexpression of PeHKT1;1 Improves Salt Tolerance in Populus. Genes 2018, 9, 475. https://doi.org/10.3390/genes9100475
Xu M, Chen C, Cai H, Wu L. Overexpression of PeHKT1;1 Improves Salt Tolerance in Populus. Genes. 2018; 9(10):475. https://doi.org/10.3390/genes9100475
Chicago/Turabian StyleXu, Meng, Caihui Chen, Heng Cai, and Ling Wu. 2018. "Overexpression of PeHKT1;1 Improves Salt Tolerance in Populus" Genes 9, no. 10: 475. https://doi.org/10.3390/genes9100475
APA StyleXu, M., Chen, C., Cai, H., & Wu, L. (2018). Overexpression of PeHKT1;1 Improves Salt Tolerance in Populus. Genes, 9(10), 475. https://doi.org/10.3390/genes9100475
