Copy Number Variations of the NSMF Gene and Their Associations with Growth Traits in Three Chinese Sheep Breeds
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Phenotype Data Collection
2.2. DNA Extraction
2.3. Quantitative PCR Analysis for NSMF CNV Detection
2.4. Determination of NSMF Gene Copy Number
2.5. Statistical Analysis
3. Results
3.1. NSMF Gene CNVs and Validation of Detection Primers
3.2. NSMF CNV Profile and Genotype Frequencies in Three Sheep Breeds
3.3. Association Analysis of NSMF CNV with Growth Traits in Sheep
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
CNV | copy number variation |
qPCR | quantitative PCR |
CKS | Chaka sheep |
HS | Hu sheep |
STHS | Small-tailed Han sheep |
References
- Hasan, N.; Choudhary, S.; Naaz, N.; Sharma, N.; Laskar, R.A. Recent advancements in molecular marker-assisted selection and applications in plant breeding programmes. J. Genet. Eng. Biotechnol. 2021, 19, 128. [Google Scholar] [CrossRef]
- Salpietro, V.; Manole, A.; Efthymiou, S.; Houlden, H. A review of copy number variants in inherited neuropathies. Curr. Genom. 2018, 19, 412–419. [Google Scholar] [CrossRef]
- Liu, X.; Chen, W.; Huang, B.; Wang, X.; Peng, Y.; Zhang, X.; Chai, W.; Khan, M.Z.; Wang, C. Advancements in copy number variation screening in herbivorous livestock genomes and their association with phenotypic traits. Front. Vet. Sci. 2024, 10, 1334434. [Google Scholar] [CrossRef] [PubMed]
- Bhanuprakash, V.; Chhotaray, S.; Pruthviraj, D.; Rawat, C.; Karthikeyan, A.; Panigrahi, M. Copy number variation in livestock: A mini review. Vet. World 2018, 11, 535. [Google Scholar] [CrossRef]
- Celus, C.; Ahmad, S.F.; Gangwar, M.; Kumar, S.; Kumar, A. Deciphering new insights into copy number variations as drivers of genomic diversity and adaptation in farm animal species. Gene 2024, 939, 149159. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Xu, L.; Zhou, Y.; Liu, M.; Wang, L.; Kijas, J.W.; Zhang, H.; Li, L.; Liu, G.E. Diversity of copy number variation in a worldwide population of sheep. Genomics 2018, 110, 143–148. [Google Scholar] [CrossRef] [PubMed]
- Clop, A.; Vidal, O.; Amills, M. Copy number variation in the genomes of domestic animals. Anim. Genet. 2012, 43, 503–517. [Google Scholar] [CrossRef] [PubMed]
- Rice, A.M.; McLysaght, A. Dosage sensitivity is a major determinant of human copy number variant pathogenicity. Nat. Commun. 2017, 8, 14366. [Google Scholar] [CrossRef] [PubMed]
- Sønderby, I.E.; Gústafsson, Ó.; Doan, N.T.; Hibar, D.P.; Martin-Brevet, S.; Abdellaoui, A.; Ames, D.; Amunts, K.; Andersson, M.; Armstrong, N.J. Dose response of the 16p11. 2 distal copy number variant on intracranial volume and basal ganglia. Mol. Psychiatry 2020, 25, 584–602. [Google Scholar] [CrossRef] [PubMed]
- Benfica, L.F.; Brito, L.F.; do Bem, R.D.; Mulim, H.A.; Glessner, J.; Braga, L.G.; Gloria, L.S.; Cyrillo, J.N.; Bonilha, S.F.; Mercadante, M.E. Genome-wide association study between copy number variation and feeding behavior, feed efficiency, and growth traits in Nellore cattle. BMC Genom. 2024, 25, 54. [Google Scholar] [CrossRef]
- Xu, Y.; Zhang, L.; Shi, T.; Zhou, Y.; Cai, H.; Lan, X.; Zhang, C.; Lei, C.; Chen, H. Copy number variations of MICAL-L2 shaping gene expression contribute to different phenotypes of cattle. Mamm. Genome 2013, 24, 508–516. [Google Scholar] [CrossRef]
- Taghizadeh, S.; Gholizadeh, M.; Rahimi-Mianji, G.; Moradi, M.H.; Costilla, R.; Moore, S.; Di Gerlando, R. Genome-wide identification of copy number variation and association with fat deposition in thin and fat-tailed sheep breeds. Sci. Rep. 2022, 12, 8834. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Li, Y.; Wang, X.; Yu, J.; Cai, Y.; Zheng, Z.; Li, R.; Zhang, S.; Chen, N.; Asadollahpour Nanaei, H. An atlas of CNV maps in cattle, goat and sheep. Sci. China Life Sci. 2021, 64, 1747–1764. [Google Scholar] [CrossRef] [PubMed]
- Grochowska, K.M.; Bär, J.; Gomes, G.M.; Kreutz, M.R.; Karpova, A. Jacob, a synapto-nuclear protein messenger linking N-methyl-D-aspartate receptor activation to nuclear gene expression. Front. Synaptic Neurosci. 2021, 13, 787494. [Google Scholar] [CrossRef]
- Gomes, G.M.; Bär, J.; Karpova, A.; Kreutz, M.R. A Jacob/nsmf gene knockout does not protect against acute hypoxia-and NMDA-induced excitotoxic cell death. Mol. Brain 2023, 16, 23. [Google Scholar] [CrossRef]
- Ju, M.K.; Shin, K.J.; Lee, J.R.; Khim, K.W.; Lee, E.A.; Ra, J.S.; Kim, B.-G.; Jo, H.-s.; Yoon, J.H.; Kim, T.M. NSMF promotes the replication stress-induced DNA damage response for genome maintenance. Nucleic Acids Res. 2021, 49, 5605–5622. [Google Scholar] [CrossRef] [PubMed]
- Kang, Y.; Han, Y.G.; Khim, K.W.; Choi, W.G.; Ju, M.K.; Park, K.; Shin, K.J.; Chae, Y.C.; Choi, J.H.; Kim, H. Alteration of replication protein A binding mode on single-stranded DNA by NSMF potentiates RPA phosphorylation by ATR kinase. Nucleic Acids Res. 2023, 51, 7936–7950. [Google Scholar] [CrossRef] [PubMed]
- Moon, H.Y. N-methyl D-aspartate receptor synaptonuclear signaling and neuronal migration factor (Nsmf) plays a novel role in myoblast proliferation. Vitr. Cell. Dev. Biol.-Anim. 2015, 51, 79–84. [Google Scholar] [CrossRef]
- Esquivelzeta, C.; Fina, M.; Bach, R.; Madruga, C.; Caja, G.; Casellas, J.; Piedrafita, J. Morphological analysis and subpopulation characterization of Ripollesa sheep breed. Anim. Genet. Resour. 2011, 49, 9–17. [Google Scholar] [CrossRef]
- Bautista-Díaz, E.; Mezo-Solis, J.A.; Herrera-Camacho, J.; Cruz-Hernández, A.; Gomez-Vazquez, A.; Tedeschi, L.O.; Lee-Rangel, H.A.; Vargas-Bello-Pérez, E.; Chay-Canul, A.J. Prediction of carcass traits of hair sheep lambs using body measurements. Animals 2020, 10, 1276. [Google Scholar] [CrossRef]
- Denman, A. Molecular cloning: A laboratory manual. Immunology 1983, 49, 411. [Google Scholar]
- Jiang, R.; Cheng, J.; Cao, X.-K.; Ma, Y.-L.; Chaogetu, B.; Huang, Y.-Z.; Lan, X.-Y.; Lei, C.-Z.; Hu, L.-Y.; Chen, H. Copy number variation of the SHE gene in sheep and its association with economic traits. Animals 2019, 9, 531. [Google Scholar] [CrossRef]
- Cheng, J.; Jiang, R.; Yang, Y.; Cao, X.; Huang, Y.; Lan, X.; Lei, C.; Hu, L.; Chen, H. Association analysis of KMT2D copy number variation as a positional candidate for growth traits. Gene 2020, 753, 144799. [Google Scholar] [CrossRef]
- Cao, K.; Hao, D.; Wang, J.; Peng, W.; Yan, Y.; Cao, H.; Sun, F.; Chen, H. Cold exposure induces the acquisition of brown adipocyte gene expression profiles in cattle inguinal fat normalized with a new set of reference genes for qRT-PCR. Res. Vet. Sci. 2017, 114, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Cheng, J.; Zhao, H.; Chen, N.; Cao, X.; Hanif, Q.; Pi, L.; Hu, L.; Chaogetu, B.; Huang, Y.; Lan, X. Population structure, genetic diversity, and selective signature of Chaka sheep revealed by whole genome sequencing. BMC Genom. 2020, 21, 520. [Google Scholar] [CrossRef] [PubMed]
- National Commission of Animal Genetic Resources of China. Annals of Animal Genetic Resources in China—Sheep; National Commission of Animal Genetic Resources of China: Beijing, China, 2011. [Google Scholar]
- Cao, X.; Ling, C.; Liu, Y.; Gu, Y.; Huang, J.; Sun, W. Pleiotropic Gene HMGA2 Regulates Myoblast Proliferation and Affects Body Size of Sheep. Animals 2024, 14, 2721. [Google Scholar] [CrossRef]
- Lv, S.-J.; Yang, Y.; Dwyer, C.; Li, F.-K. Pen size and parity effects on maternal behaviour of Small-Tail Han sheep. Animal 2015, 9, 1195–1202. [Google Scholar] [CrossRef] [PubMed]
- Stamou, M.I.; Brand, H.; Wang, M.; Wong, I.; Lippincott, M.F.; Plummer, L.; Crowley, W.F.; Talkowski, M.; Seminara, S.; Balasubramanian, R. Prevalence and phenotypic effects of copy number variants in isolated hypogonadotropic hypogonadism. J. Clin. Endocrinol. Metab. 2022, 107, 2228–2242. [Google Scholar] [CrossRef] [PubMed]
- Zhang, F.; Gu, W.; Hurles, M.E.; Lupski, J.R. Copy number variation in human health, disease, and evolution. Annu. Rev. Genom. Hum. Genet. 2009, 10, 451–481. [Google Scholar] [CrossRef] [PubMed]
- Gamazon, E.R.; Stranger, B.E. The impact of human copy number variation on gene expression. Brief. Funct. Genom. 2015, 14, 352–357. [Google Scholar] [CrossRef]
- Zinzen, R.P.; Girardot, C.; Gagneur, J.; Braun, M.; Furlong, E.E. Combinatorial binding predicts spatio-temporal cis-regulatory activity. Nature 2009, 462, 65–70. [Google Scholar] [CrossRef]
- Gamazon, E.R.; Cox, N.J.; Davis, L.K. Structural architecture of SNP effects on complex traits. Am. J. Hum. Genet. 2014, 95, 477–489. [Google Scholar] [CrossRef]
Primer ID | Sequences (5′-3′) | Products (bp) |
---|---|---|
NSMF-F | GGCTACATCTGGGACCATCTT | 137 |
NSMF-R | CGAGCCGCCCAATTTTATGGT | |
ANKRD1-F | AAGACCCCCGAAATGCTACC | 128 |
ANKRD1-R | GCCGACCTCAACGTCAAGAA |
Growth Traits | CNV Types (LSM ± S.E.) | F-Value | p-Value | ||
---|---|---|---|---|---|
Deletion (n = 269) | Normal (n = 10) | Duplication (n = 18) | |||
Withers height (cm) | 66.11 ± 0.26 | 66.04 ± 1.34 | 66.16 ± 1.00 | 0.00 | 1.00 |
Body length (cm) | 72.00 ± 0.42 | 71.20 ± 2.16 | 72.28 ± 1.61 | 0.08 | 0.92 |
Chest girth (cm) | 89.31 ± 0.49 | 91.08 ± 2.54 | 91.74 ± 1.90 | 0.97 | 0.38 |
Body weight (kg) | 53.99 ± 0.77 | 56.00 ± 3.97 | 57.00 ± 2.97 | 0.59 | 0.56 |
Growth Traits | CNV Types (LSM ± S.E.) | F-Value | p-Value | ||
---|---|---|---|---|---|
Deletion (n = 47) | Normal (n = 8) | Duplication (n = 9) | |||
Withers height (cm) | 64.98 ± 0.42 | 66.00 ± 0.96 | 65.56 ± 1.09 | 0.51 | 0.60 |
Pin bone width (cm) | 17.14 ± 0.23 | 16.94 ± 0.63 | 16.44 ± 0.47 | 0.74 | 0.48 |
Body diagonal length (cm) | 70.66 ± 0.48 a | 71.75 ± 1.21 a | 67.56 ± 2.04 b | 3.16 | 0.05 |
Chest girth (cm) | 76.60 ± 0.50 | 78.00 ± 2.04 | 79.56 ± 1.64 | 2.29 | 0.11 |
Cannon circumference (cm) | 7.20 ± 0.06 b | 7.63 ± 0.18 a | 7.50 ± 0.22 ab | 4.14 | 0.02 |
Body weight (kg) | 34.02 ± 0.61 | 34.63 ± 0.72 | 32.92 ± 1.48 | 0.42 | 0.66 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cao, X.; Liu, Y.; Cheng, J.; Ling, C.; Huang, J.; Sun, W. Copy Number Variations of the NSMF Gene and Their Associations with Growth Traits in Three Chinese Sheep Breeds. Genes 2025, 16, 218. https://doi.org/10.3390/genes16020218
Cao X, Liu Y, Cheng J, Ling C, Huang J, Sun W. Copy Number Variations of the NSMF Gene and Their Associations with Growth Traits in Three Chinese Sheep Breeds. Genes. 2025; 16(2):218. https://doi.org/10.3390/genes16020218
Chicago/Turabian StyleCao, Xiukai, Yongqi Liu, Jie Cheng, Chen Ling, Jinlin Huang, and Wei Sun. 2025. "Copy Number Variations of the NSMF Gene and Their Associations with Growth Traits in Three Chinese Sheep Breeds" Genes 16, no. 2: 218. https://doi.org/10.3390/genes16020218
APA StyleCao, X., Liu, Y., Cheng, J., Ling, C., Huang, J., & Sun, W. (2025). Copy Number Variations of the NSMF Gene and Their Associations with Growth Traits in Three Chinese Sheep Breeds. Genes, 16(2), 218. https://doi.org/10.3390/genes16020218