The Effect of Dicer Knockout on RNA Interference Using Various Dicer Substrate Small Interfering RNA (DsiRNA) Structures
Abstract
:1. Introduction
2. Materials and Methods
2.1. DsiRNA Duplex
2.2. Cell Culture and Transfection
2.3. Surveyor Nuclease Assay
2.4. Sequencing Analysis
2.5. Dual-Luciferase Assay
2.6. Statistical Analysis
3. Results
3.1. Design of DsiRNAs Targeting hnRNPH1
3.2. Generation of Dicer Knockout HCT116 Cells
3.3. Tetra-Looped DsiRNA Enhances siRNA Efficacy
3.4. Gene Silencing Activity is Controlled by Dicer
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Cummings, J.C.; Zhang, H.; Jakymiw, A. Peptide carriers to the rescue: Overcoming the barriers to siRNA delivery for cancer treatment. Transl. Res. J. Lab. Clin. Med. 2019, 214, 92–104. [Google Scholar] [CrossRef] [PubMed]
- Adams, D.; Gonzalez-Duarte, A.; O’Riordan, W.D.; Yang, C.C.; Ueda, M.; Kristen, A.V.; Tournev, I.; Schmidt, H.H.; Coelho, T.; Berk, J.L.; et al. Patisiran, an RNAi Therapeutic, for Hereditary Transthyretin Amyloidosis. N. Engl. J. Med. 2018, 379, 11–21. [Google Scholar] [CrossRef] [PubMed]
- Raja, M.A.G.; Katas, H.; Amjad, M.W. Design, mechanism, delivery and therapeutics of canonical and Dicer-substrate siRNA. Asian J. Pharm. Sci. 2019, 14, 497–510. [Google Scholar] [CrossRef] [PubMed]
- Soukup, G.A. Nucleic acids: General properties. In Encyclopedia of Life Sciences; Wiley & Sons: Hoboken, NJ, USA, 2003. [Google Scholar] [CrossRef]
- Chen, Y.; Varani, G. RNA Structure. eLS, Ed.; In Encyclopedia of Life Sciences; Wiley & Sons: Hoboken, NJ, USA, 2010. [Google Scholar]
- Cheong, C.; Cheong, H.-K. RNA Structure: Tetraloops. In Encyclopedia of Life Sciences; Wiley & Sons: Hoboken, NJ, USA, 2010. [Google Scholar] [CrossRef]
- Antao, V.P.; Tinoco, I., Jr. Thermodynamic parameters for loop formation in RNA and DNA hairpin tetraloops. Nucleic Acids Res. 1992, 20, 819–824. [Google Scholar] [CrossRef]
- Wolters, J. The nature of preferred hairpin structures in 16S-like rRNA variable regions. Nucleic Acids Res. 1992, 20, 1843–1850. [Google Scholar] [CrossRef] [Green Version]
- Fourmy, D.; Guittet, E.; Yoshizawa, S. Structure of prokaryotic SECIS mRNA hairpin and its interaction with elongation factor SelB. J. Mol. Biol. 2002, 324, 137–150. [Google Scholar] [CrossRef]
- Du, Z.; Yu, J.; Andino, R.; James, T.L. Extending the Family of UNCG-like Tetraloop Motifs: NMR Structure of a CACG Tetraloop from Coxsackievirus B3. Biochemistry 2003, 42, 4373–4383. [Google Scholar] [CrossRef]
- Girard, F.C.; Ottink, O.M.; Ampt KA, M.; Tessari, M.; Wijmenga, S.S. Thermodynamics and NMR studies on Duck, Heron and Human HBV encapsidation signals. Nucleic Acids Res. 2007, 35, 2800–2811. [Google Scholar] [CrossRef] [Green Version]
- Kieft, J.S.; Tinoco, I., Jr. Solution structure of a metal-binding site in the major groove of RNA complexed with cobalt (III) hexammine. Structure 1997, 5, 713–721. [Google Scholar] [CrossRef] [Green Version]
- Wu, H.; Yang, P.K.; Butcher, S.E.; Kang, S.; Chanfreau, G.; Feigon, J. A novel family of RNA tetraloop structure forms the recognition site for Saccharomyces cerevisiae RNase III. EMBO J. 2001, 20, 7240–7249. [Google Scholar] [CrossRef] [Green Version]
- Varani, G. Exceptionally stable nucleic acid hairpins. Annu. Rev. Biophys. Biomol. Struct. 1995, 24, 379–404. [Google Scholar] [CrossRef]
- Jucker, F.M.; Heus, H.A.; Yip, P.F.; Moors, E.H.; Pardi, A. A network of heterogeneous hydrogen bonds in GNRA tetraloops. J. Mol. Biol. 1996, 264, 968–980. [Google Scholar] [CrossRef] [PubMed]
- Cheong, C.; Varani, G.; Tinoco, I. Solution structure of an unusually stable RNA hairpin, 5GGAC(UUCG)GUCC. Nature 1990, 346, 680–682. [Google Scholar] [CrossRef] [PubMed]
- Legault, P.; Li, J.; Mogridge, J.; Kay, L.E.; Greenblatt, J. NMR structure of the bacteriophage lambda N peptide/boxB RNA complex: Recognition of a GNRA fold by an arginine-rich motif. Cell 1998, 93, 289–299. [Google Scholar] [CrossRef] [Green Version]
- Tinoco, I., Jr.; Bustamante, C. How RNA folds. J. Mol. Biol. 1999, 293, 271–281. [Google Scholar] [CrossRef]
- Kim, D.H.; Behlke, M.A.; Rose, S.D.; Chang, M.S.; Choi, S.; Rossi, J.J. Synthetic dsRNA Dicer substrates enhance RNAi potency and efficacy. Nat. Biotechnol. 2005, 23, 222–226. [Google Scholar] [CrossRef] [Green Version]
- Snead, N.M.; Wu, X.; Li, A.; Cui, Q.; Sakurai, K.; Burnett, J.C.; Rossi, J.J. Molecular basis for improved gene silencing by Dicer substrate interfering RNA compared with other siRNA variants. Nucleic Acids Res. 2013, 41, 6209–6221. [Google Scholar] [CrossRef] [Green Version]
- Rose, S.D.; Kim, D.-H.; Amarzguioui, M.; Heidel, J.D.; Collingwood, M.A.; Davis, M.E.; Rossi, J.J.; Behlke, M.A. Functional polarity is introduced by Dicer processing of short substrate RNAs. Nucleic Acids Res. 2005, 33, 4140–4156. [Google Scholar] [CrossRef]
- Hefner, E.; Clark, K.; Whitman, C.; Behlke, M.A.; Rose, S.D.; Peek, A.S.; Rubio, T. Increased potency and longevity of gene silencing using validated Dicer substrates. J. Biomol. Tech. 2008, 19, 231–237. [Google Scholar]
- Kubo, T.; Zhelev, Z.; Ohba, H.; Bakalova, R. Modified 27-nt dsRNAs with dramatically enhanced stability in serum and long-term RNAi activity. Oligonucleotides 2007, 17, 445–464. [Google Scholar] [CrossRef]
- Dudek, H.; Wong, D.H.; Arvan, R.; Shah, A.; Wortham, K.; Ying, B.; Diwanji, R.; Zhou, W.; Holmes, B.; Yang, H.; et al. Knockdown of β-catenin with Dicer-Substrate siRNAs Reduces Liver Tumor Burden In vivo. Mol. Ther. 2014, 22, 92–101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bobbin, M.L.; Rossi, J.J. RNA Interference (RNAi)-Based Therapeutics: Delivering on the Promise? Annu. Rev. Pharmacol. Toxicol. 2016, 56, 103–122. [Google Scholar] [CrossRef] [PubMed]
- Gu, S.; Jin, L.; Zhang, Y.; Huang, Y.; Zhang, F.; Valdmanis, P.N.; Kay, M.A. The loop position of shRNAs and pre-miRNAs is critical for the accuracy of dicer processing in vivo. Cell 2012, 151, 900–911. [Google Scholar] [CrossRef] [Green Version]
- Herrera-Carrillo, E.; Harwig, A.; Berkhout, B. Influence of the loop size and nucleotide composition on AgoshRNA biogenesis and activity. RNA Biol. 2017, 14, 1559–1569. [Google Scholar] [CrossRef] [Green Version]
- Liu, Z.; Wang, J.; Cheng, H.; Ke, X.; Sun, L.; Zhang, Q.C.; Wang, H.W. Cryo-EM Structure of Human Dicer and Its Complexes with a Pre-miRNA Substrate. Cell 2018, 173, 1191–1203.e12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sakurai, K.; Amarzguioui, M.; Kim, D.H.; Alluin, J.; Heale, B.; Song, M.S.; Gatignol, A.; Behlke, M.A.; Rossi, J.J. A role for human Dicer in pre-RISC loading of siRNAs. Nucleic Acids Res. 2011, 39, 1510–1525. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bramsen, J.B.; Laursen, M.B.; Damgaard, C.K.; Lena, S.W.; Babu, B.R.; Wengel, J.; Kjems, J. Improved silencing properties using small internally segmented interfering RNAs. Nucleic Acids Res. 2007, 35, 5886–58897. [Google Scholar] [CrossRef]
- Kim, Y.K.; Kim, B.; Kim, V.N. Re-evaluation of the roles of DROSHA, Export in 5, and DICER in microRNA biogenesis. Proc. Natl. Acad. Sci. USA 2016, 113, E1881–E1889. [Google Scholar] [CrossRef] [Green Version]
- Knutsen, T.; Padilla-Nash, H.M.; Wangsa, D.; Barenboim-Stapleton, L.; Camps, J.; McNeil, N.; Difilippantonio, M.J.; Ried, T. Definitive molecular cytogenetic characterization of 15 colorectal cancer cell lines. Genes Chromosomes Cancer 2010, 49, 204–223. [Google Scholar] [CrossRef] [Green Version]
- Ran, F.A.; Hsu, P.D.; Lin, C.-Y.; Gootenberg, J.S.; Konermann, S.; Trevino, A.E.; Scott, D.A.; Inoue, A.; Matoba, S.; Zhang, Y.; et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell 2013, 154, 1380–1389. [Google Scholar] [CrossRef] [Green Version]
- Yoda, M.; Cifuentes, D.; Izumi, N.; Sakaguchi, Y.; Suzuki, T.; Giraldez, A.J.; Tomari, Y. Poly(A)-specific ribonuclease mediates 3′-end trimming of Argonaute2-cleaved precursor microRNAs. Cell Rep. 2013, 5, 715–726. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rossi, J.J. Expression strategies for short hairpin RNA interference triggers. Hum. Gene 2008, 19, 313–317. [Google Scholar] [CrossRef] [PubMed]
- McCaffrey, A.P.; Meuse, L.; Pham, T.T.; Conklin, D.S.; Hannon, G.J.; Kay, M.A. RNA interference in adult mice. Nature 2002, 418, 38–39. [Google Scholar] [CrossRef] [PubMed]
- Brummelkamp, T.R.; Bernards, R.; Agami, R. A system for stable expression of short interfering RNAs in mammalian cells. Science 2002, 296, 550–553. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pokornowska, M.; Milewski, M.C.; Ciechanowska, K.; Szczepanska, A.; Wojnicka, M.; Radogostowicz, Z.; Figlerowicz, M.; Kurzynska-Kokorniak, A. The RNA-RNA base pairing potential of human Dicer and Ago2 proteins. Cell. Mol. Life Sci. 2019, 77, 3231–3244. [Google Scholar] [CrossRef] [Green Version]
- Hansen, S.R.; Aderounmu, A.M.; Donelick, H.M.; Bass, B.L. Dicer’s Helicase Domain: A Meeting Place for Regulatory Proteins. Cold Spring Harb. Symp. Quant. Biol. 2020, 84, 185–193. [Google Scholar] [CrossRef]
- Park, J.E.; Heo, I.; Tian, Y.; Simanshu, D.K.; Chang, H.; Jee, D.; Patel, D.J.; Kim, V.N. Dicer recognizes the 5’ end of RNA for efficient and accurate processing. Nature 2011, 475, 201–205. [Google Scholar] [CrossRef]
- Tai, W. Current Aspects of siRNA Bioconjugate for In Vitro and In Vivo Delivery. Molecules 2019, 24, 2211. [Google Scholar] [CrossRef] [Green Version]
- Tian, Y.; Simanshu, D.K.; Ma, J.B.; Park, J.E.; Heo, I.; Kim, V.N.; Patel, D.J. A phosphate-binding pocket within the platform-PAZ-connector helix cassette of human Dicer. Mol. Cell 2014, 53, 606–616. [Google Scholar] [CrossRef] [Green Version]
- Taylor, D.W.; Ma, E.; Shigematsu, H.; Cianfrocco, M.A.; Noland, C.L.; Nagayama, K.; Nogales, E.; Doudna, J.A.; Wang, H.W. Substrate-specific structural rearrangements of human Dicer. Nat. Struct. Mol. Biol. 2013, 20, 662–670. [Google Scholar] [CrossRef]
- Kandasamy, S.K.; Fukunaga, R. Phosphate-binding pocket in Dicer-2 PAZ domain for high-fidelity siRNA production. Proc. Natl. Acad. Sci. USA 2016, 113, 14031–14036. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chakravarthy, S.; Sternberg, S.H.; Kellenberger, C.A.; Doudna, J.A. Substrate-Specific Kinetics of Dicer-Catalyzed RNA Processing. J. Mol. Biol. 2010, 404, 392–402. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fukunaga, R.; Han, B.W.; Hung, J.H.; Xu, J.; Weng, Z.; Zamore, P.D. Dicer partner proteins tune the length of mature miRNAs in flies and mammals. Cell 2012, 151, 533–546. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rybak-Wolf, A.; Jens, M.; Murakawa, Y.; Herzog, M.; Landthaler, M.; Rajewsky, N.A. Variety of Dicer Substrates in Human and C. elegans. Cell 2014, 159, 1153–1167. [Google Scholar] [CrossRef] [Green Version]
- Soifer, H.S.; Sano, M.; Sakurai, K.; Chomchan, P.; Saetrom, P.; Sherman, M.A.; Collingwood, M.A.; Behlke, M.A.; Rossi, J.J. A role for the Dicer helicase domain in the processing of thermodynamically unstable hairpin RNAs. Nucleic Acids Res. 2008, 36, 6511–6522. [Google Scholar] [CrossRef] [Green Version]
- Cifuentes, D.; Xue, H.; Taylor, D.W.; Patnode, H.; Mishima, Y.; Cheloufi, S.; Ma, E.; Mane, S.; Hannon, G.J.; Lawson, N.D.; et al. A Novel miRNA Processing Pathway Independent of Dicer Requires Argonaute2 Catalytic Activity. Science 2010, 328, 1694–1698. [Google Scholar] [CrossRef] [Green Version]
- Burckstummer, T.; Banning, C.; Hainzl, P.; Schobesberger, R.; Kerzendorfer, C.; Pauler, F.M.; Chen, D.; Them, N.; Schischlik, F.; Rebsamen, M.; et al. A reversible gene trap collection empowers haploid genetics in human cells. Nat. Methods 2013, 10, 965–971. [Google Scholar] [CrossRef]
- Reiling, J.H.; Clish, C.B.; Carette, J.E.; Varadarajan, M.; Brummelkamp, T.R.; Sabatini, D.M. A haploid genetic screen identifies the major facilitator domain containing 2A (MFSD2A) transporter as a key mediator in the response to tunicamycin. Proc. Natl. Acad. Sci. USA 2011, 108, 11756. [Google Scholar] [CrossRef] [Green Version]
- Carette, J.E.; Guimaraes, C.P.; Varadarajan, M.; Park, A.S.; Wuethrich, I.; Godarova, A.; Kotecki, M.; Cochran, B.H.; Spooner, E.; Ploegh, H.L.; et al. Haploid genetic screens in human cells identify host factors used by pathogens. Science 2009, 326, 1231–1235. [Google Scholar] [CrossRef] [Green Version]
- Giuliano, C.J.; Lin, A.; Girish, V.; Sheltzer, J.M. Generating Single Cell–Derived Knockout Clones in Mammalian Cells with CRISPR/Cas9. Curr. Protoc. Mol. Biol. 2019, 128, e100. [Google Scholar] [CrossRef] [Green Version]
- Duan, B.; Zhou, C.; Zhu, C.; Yu, Y.; Li, G.; Zhang, S.; Zhang, C.; Ye, X.; Ma, H.; Qu, S.; et al. Model-based understanding of single-cell CRISPR screening. Nat. Commun. 2019, 10, 2233. [Google Scholar] [CrossRef] [PubMed]
- Datlinger, P.; Rendeiro, A.F.; Schmidl, C.; Krausgruber, T.; Traxler, P.; Klughammer, J.; Schuster, L.C.; Kuchler, A.; Alpar, D.; Bock, C. Pooled CRISPR screening with single-cell transcriptome readout. Nat. Methods 2017, 14, 297–301. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Baker, M. Reproducibility crisis: Blame it on the antibodies. Nature 2015, 521, 274–276. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mullane, K.; Enna, S.J.; Piette, J.; Williams, M. Guidelines for manuscript submission in the peer-reviewed pharmacological literature. Biochem. Pharmacol. 2015, 97, 225–235. [Google Scholar] [CrossRef]
- Song, M.-S.; Rossi, J.J. Molecular mechanisms of Dicer: Endonuclease and enzymatic activity. Biochem. J. 2017, 474, 1603–1618. [Google Scholar] [CrossRef] [Green Version]
- Cole, C.; Sobala, A.; Lu, C.; Thatcher, S.R.; Bowman, A.; Brown JW, S.; Green, P.J.; Barton, G.J.; Hutvagner, G. Filtering of deep sequencing data reveals the existence of abundant Dicer-dependent small RNAs derived from tRNAs. RNA 2009, 15, 2147–2160. [Google Scholar] [CrossRef] [Green Version]
- Kumar, P.; Kuscu, C.; Dutta, A. Biogenesis and Function of Transfer RNA-Related Fragments (tRFs). Trends Biochem. Sci. 2016, 41, 679–689. [Google Scholar] [CrossRef] [Green Version]
- Li, Z.; Ender, C.; Meister, G.; Moore, P.S.; Chang, Y.; John, B. Extensive terminal and asymmetric processing of small RNAs from rRNAs, snoRNAs, snRNAs, and tRNAs. Nucleic Acids Res. 2012, 40, 6787–6799. [Google Scholar] [CrossRef] [Green Version]
- Taft, R.J.; Glazov, E.A.; Lassmann, T.; Hayashizaki, Y.; Carninci, P.; Mattick, J.S. Small RNAs derived from snoRNAs. RNA 2009, 15, 1233–1240. [Google Scholar] [CrossRef] [Green Version]
- Ender, C.; Krek, A.; Friedlander, M.R.; Beitzinger, M.; Weinmann, L.; Chen, W.; Pfeffer, S.; Rajewsky, N.; Meister, G. A human snoRNA with microRNA-like functions. Mol. Cell 2008, 32, 519–528. [Google Scholar] [CrossRef]
- Wilson, R.C.; Tambe, A.; Kidwell, M.A.; Noland, C.L.; Schneider, C.P.; Doudna, J.A. Dicer-TRBP complex formation ensures accurate mammalian microRNA biogenesis. Mol. Cell 2015, 57, 397–407. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Noland, C.L.; Ma, E.; Doudna, J.A. siRNA repositioning for guide strand selection by human Dicer complexes. Mol. Cell 2011, 43, 110–121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Name | 5′ to 3′ | Size (n.t.) |
---|---|---|
S_DI | UGAAUCAGAAGAUGAAGUCAA | 21 |
AS_TL_DI_O | AUdTdGGAAACAAUUUGACUUCAUCUUCUGAUUCAAG | 35 |
AS_TL_DI | GCAGCCGAAAGGCUGCUUGACUUCAUCUUCUGAUUCAAG | 38 |
S_TL_DII_O | GAAUCAGAAGAUGAAGUCAAAUUdGdGGAAACCAAU | 35 |
S_TL_DII | GAAUCAGAAGAUGAAGUCAAGCAGCCGAAAGGCUGC | 36 |
AS_DII | UUGACUUCAUCUUCUGAUUCAA | 22 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Song, M.-S.; Alluin, J.; Rossi, J.J. The Effect of Dicer Knockout on RNA Interference Using Various Dicer Substrate Small Interfering RNA (DsiRNA) Structures. Genes 2022, 13, 436. https://doi.org/10.3390/genes13030436
Song M-S, Alluin J, Rossi JJ. The Effect of Dicer Knockout on RNA Interference Using Various Dicer Substrate Small Interfering RNA (DsiRNA) Structures. Genes. 2022; 13(3):436. https://doi.org/10.3390/genes13030436
Chicago/Turabian StyleSong, Min-Sun, Jessica Alluin, and John J. Rossi. 2022. "The Effect of Dicer Knockout on RNA Interference Using Various Dicer Substrate Small Interfering RNA (DsiRNA) Structures" Genes 13, no. 3: 436. https://doi.org/10.3390/genes13030436