Mechanical Stress Induces Sodium Entry and Osmoprotective Responses in Murine Synovial Fibroblasts
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture Experiments
2.1.1. General Cell Culture Conditions
2.1.2. Experiments with Different Salt Concentrations without Mechanical Loading
2.1.3. Experiments with Static Compressive Force Application
2.1.4. Experiments with Intermittent Tensile Strain
2.2. Assessment of Intracellular Na+ Using Atomic Adsorption Spectrometry
2.3. Quantitative Polymerase Chain Reaction (qPCR)
2.4. Enzyme Linked Immune Absorbent Assays (ELISAs)
2.5. Statistics
3. Results
3.1. Impact of Different Extracellular Na+ Concentrations on Synovial Fibroblasts
3.2. Impact of Static Pressure Application and Extracellular Na+ Levels on Synovial Fibroblasts
3.3. Impact of Intermittant Tension and Extracellular Na+ on Synovial Fibroblasts
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Abramoff, B.; Caldera, F.E. Osteoarthritis: Pathology, Diagnosis, and Treatment Options. Med. Clin. N. Am. 2020, 104, 293–311. [Google Scholar] [CrossRef]
- Perruccio, A.V.; Young, J.J.; Wilfong, J.M.; Denise Power, J.; Canizares, M.; Badley, E.M. Osteoarthritis Year in Review 2023: Epidemiology & therapy. Osteoarthr. Cartil. 2023, 32, 159–165. [Google Scholar] [CrossRef]
- Vitaloni, M.; Botto-van Bemden, A.; Sciortino Contreras, R.M.; Scotton, D.; Bibas, M.; Quintero, M.; Monfort, J.; Carné, X.; de Abajo, F.; Oswald, E.; et al. Global management of patients with knee osteoarthritis begins with quality of life assessment: A systematic review. BMC Musculoskelet. Disord. 2019, 20, 493. [Google Scholar] [CrossRef] [PubMed]
- Michael, J.W.-P.; Schlüter-Brust, K.U.; Eysel, P. The epidemiology, etiology, diagnosis, and treatment of osteoarthritis of the knee. Dtsch. Arztebl. Int. 2010, 107, 152–162. [Google Scholar] [CrossRef] [PubMed]
- Hunter, D.J.; March, L.; Chew, M. Osteoarthritis in 2020 and beyond: A Lancet Commission. Lancet 2020, 396, 1711–1712. [Google Scholar] [CrossRef] [PubMed]
- Salmon, J.H.; Rat, A.C.; Achit, H.; Ngueyon-Sime, W.; Gard, C.; Guillemin, F.; Jolly, D.; Fautrel, B. Health resource use and costs of symptomatic knee and/or hip osteoarthritis. Osteoarthr. Cartil. 2019, 27, 1011–1017. [Google Scholar] [CrossRef] [PubMed]
- Wright, E.A.; Katz, J.N.; Cisternas, M.G.; Kessler, C.L.; Wagenseller, A.; Losina, E. Impact of knee osteoarthritis on health care resource utilization in a US population-based national sample. Med. Care 2010, 48, 785–791. [Google Scholar] [CrossRef] [PubMed]
- Bedenbaugh, A.V.; Bonafede, M.; Marchlewicz, E.H.; Lee, V.; Tambiah, J. Real-World Health Care Resource Utilization and Costs Among US Patients with Knee Osteoarthritis Compared with Controls. Clinicoecon. Outcomes Res. 2021, 13, 421–435. [Google Scholar] [CrossRef]
- O’Neill, T.W.; McCabe, P.S.; McBeth, J. Update on the epidemiology, risk factors and disease outcomes of osteoarthritis. Best Pract. Res. Clin. Rheumatol. 2018, 32, 312–326. [Google Scholar] [CrossRef]
- Buckwalter, J.A. The role of mechanical forces in the initiation and progression of osteoarthritis. HSS J. 2012, 8, 37–38. [Google Scholar] [CrossRef]
- Buckwalter, J.A.; Anderson, D.D.; Brown, T.D.; Tochigi, Y.; Martin, J.A. The Roles of Mechanical Stresses in the Pathogenesis of Osteoarthritis: Implications for Treatment of Joint Injuries. Cartilage 2013, 4, 286–294. [Google Scholar] [CrossRef]
- Dwivedi, G.; Flaman, L.; Alaybeyoglu, B.; Struglics, A.; Frank, E.H.; Chubinskya, S.; Trippel, S.B.; Rosen, V.; Cirit, M.; Grodzinsky, A.J. Inflammatory cytokines and mechanical injury induce post-traumatic osteoarthritis-like changes in a human cartilage-bone-synovium microphysiological system. Arthritis Res. Ther. 2022, 24, 198. [Google Scholar] [CrossRef]
- Mathiessen, A.; Conaghan, P.G. Synovitis in osteoarthritis: Current understanding with therapeutic implications. Arthritis Res. Ther. 2017, 19, 18. [Google Scholar] [CrossRef]
- Bhattaram, P.; Chandrasekharan, U. The joint synovium: A critical determinant of articular cartilage fate in inflammatory joint diseases. Semin. Cell Dev. Biol. 2017, 62, 86–93. [Google Scholar] [CrossRef] [PubMed]
- Hui, A.Y.; McCarty, W.J.; Masuda, K.; Firestein, G.S.; Sah, R.L. A systems biology approach to synovial joint lubrication in health, injury, and disease. Wiley Interdiscip. Rev. Syst. Biol. Med. 2012, 4, 15–37. [Google Scholar] [CrossRef]
- Doherty, M. Synovial inflammation and osteoarthritis progression: Effects of nonsteroidal antiinflammatory drugs. Osteoarthr. Cartil. 1999, 7, 319–320. [Google Scholar] [CrossRef] [PubMed]
- Sanchez-Lopez, E.; Coras, R.; Torres, A.; Lane, N.E.; Guma, M. Synovial inflammation in osteoarthritis progression. Nat. Rev. Rheumatol. 2022, 18, 258–275. [Google Scholar] [CrossRef] [PubMed]
- Griffin, T.M.; Guilak, F. The role of mechanical loading in the onset and progression of osteoarthritis. Exerc. Sport Sci. Rev. 2005, 33, 195–200. [Google Scholar] [CrossRef] [PubMed]
- Vincent, K.R.; Conrad, B.P.; Fregly, B.J.; Vincent, H.K. The pathophysiology of osteoarthritis: A mechanical perspective on the knee joint. PM&R 2012, 4, S3–S9. [Google Scholar] [CrossRef]
- Wang, X.D.; Zhang, J.N.; Gan, Y.H.; Zhou, Y.H. Current understanding of pathogenesis and treatment of TMJ osteoarthritis. J. Dent. Res. 2015, 94, 666–673. [Google Scholar] [CrossRef]
- Wiegertjes, R.; van de Loo, F.A.J.; Blaney Davidson, E.N. A roadmap to target interleukin-6 in osteoarthritis. Rheumatology 2020, 59, 2681–2694. [Google Scholar] [CrossRef] [PubMed]
- Livshits, G.; Zhai, G.; Hart, D.J.; Kato, B.S.; Wang, H.; Williams, F.M.K.; Spector, T.D. Interleukin-6 is a significant predictor of radiographic knee osteoarthritis: The Chingford Study. Arthritis Rheum. 2009, 60, 2037–2045. [Google Scholar] [CrossRef] [PubMed]
- Siqueira, M.B.P.; Frangiamore, S.; Klika, A.K.; Gajewski, N.; Barsoum, W.K.; Higuera, C.A. Comparison of Synovial Fluid Cytokine Levels between Traumatic Knee Injury and End-Stage Osteoarthritis. J. Knee Surg. 2017, 30, 128–133. [Google Scholar] [CrossRef] [PubMed]
- Liao, Y.; Ren, Y.; Luo, X.; Mirando, A.J.; Long, J.T.; Leinroth, A.; Ji, R.-R.; Hilton, M.J. Interleukin-6 signaling mediates cartilage degradation and pain in posttraumatic osteoarthritis in a sex-specific manner. Sci. Signal. 2022, 15, eabn7082. [Google Scholar] [CrossRef]
- Stannus, O.; Jones, G.; Cicuttini, F.; Parameswaran, V.; Quinn, S.; Burgess, J.; Ding, C. Circulating levels of IL-6 and TNF-α are associated with knee radiographic osteoarthritis and knee cartilage loss in older adults. Osteoarthr. Cartil. 2010, 18, 1441–1447. [Google Scholar] [CrossRef]
- Tsuchida, A.I.; Beekhuizen, M.; Rutgers, M.; van Osch, G.J.V.M.; Bekkers, J.E.J.; Bot, A.G.J.; Geurts, B.; Dhert, W.J.A.; Saris, D.B.F.; Creemers, L.B. Interleukin-6 is elevated in synovial fluid of patients with focal cartilage defects and stimulates cartilage matrix production in an in vitro regeneration model. Arthritis Res. Ther. 2012, 14, R262. [Google Scholar] [CrossRef]
- Gosset, M.; Berenbaum, F.; Levy, A.; Pigenet, A.; Thirion, S.; Cavadias, S.; Jacques, C. Mechanical stress and prostaglandin E2 synthesis in cartilage. Biorheology 2008, 45, 301–320. [Google Scholar] [CrossRef]
- Tat, S.K.; Pelletier, J.-P.; Velasco, C.R.; Padrines, M.; Martel-Pelletier, J. New perspective in osteoarthritis: The OPG and RANKL system as a potential therapeutic target? Keio J. Med. 2009, 58, 29–40. [Google Scholar] [CrossRef]
- Liang, J.; Liu, L.; Feng, H.; Yue, Y.; Zhang, Y.; Wang, Q.; Zhao, H. Therapeutics of osteoarthritis and pharmacological mechanisms: A focus on RANK/RANKL signaling. Biomed. Pharmacother. 2023, 167, 115646. [Google Scholar] [CrossRef]
- Naik, S.; Sahu, S.; Bandyopadhyay, D.; Tripathy, S. Serum levels of osteoprotegerin, RANK-L & vitamin D in different stages of osteoarthritis of the knee. Indian J. Med. Res. 2021, 154, 491–496. [Google Scholar] [CrossRef]
- Favale, N.O.; Casali, C.I.; Lepera, L.G.; Pescio, L.G.; Fernández-Tome, M.C. Hypertonic induction of COX2 expression requires TonEBP/NFAT5 in renal epithelial cells. Biochem. Biophys. Res. Commun. 2009, 381, 301–305. [Google Scholar] [CrossRef]
- Lee, N.; Kim, D.; Kim, W.-U. Role of NFAT5 in the Immune System and Pathogenesis of Autoimmune Diseases. Front. Immunol. 2019, 10, 270. [Google Scholar] [CrossRef]
- Schröder, A.; Neubert, P.; Titze, J.; Bozec, A.; Neuhofer, W.; Proff, P.; Kirschneck, C.; Jantsch, J. Osteoprotective action of low-salt diet requires myeloid cell-derived NFAT5. JCI Insight 2019, 4, e127868. [Google Scholar] [CrossRef]
- Lunazzi, G.; Buxadé, M.; Riera-Borrull, M.; Higuera, L.; Bonnin, S.; Huerga Encabo, H.; Gaggero, S.; Reyes-Garau, D.; Company, C.; Cozzuto, L.; et al. NFAT5 Amplifies Antipathogen Responses by Enhancing Chromatin Accessibility, H3K27 Demethylation, and Transcription Factor Recruitment. J. Immunol. 2021, 206, 2652–2667. [Google Scholar] [CrossRef] [PubMed]
- Schröder, A.; Gubernator, J.; Nazet, U.; Spanier, G.; Jantsch, J.; Proff, P.; Kirschneck, C. Effects of sodium chloride on the gene expression profile of periodontal ligament fibroblasts during tensile strain. J. Orofac. Orthop. 2020, 81, 360–370. [Google Scholar] [CrossRef]
- Madelin, G.; Regatte, R.R. Biomedical applications of sodium MRI in vivo. J. Magn. Reson. Imaging 2013, 38, 511–529. [Google Scholar] [CrossRef] [PubMed]
- Machnik, A.; Neuhofer, W.; Jantsch, J.; Dahlmann, A.; Tammela, T.; Machura, K.; Park, J.-K.; Beck, F.-X.; Müller, D.N.; Derer, W.; et al. Macrophages regulate salt-dependent volume and blood pressure by a vascular endothelial growth factor-C-dependent buffering mechanism. Nat. Med. 2009, 15, 545–552. [Google Scholar] [CrossRef] [PubMed]
- Jantsch, J.; Schatz, V.; Friedrich, D.; Schröder, A.; Kopp, C.; Siegert, I.; Maronna, A.; Wendelborn, D.; Linz, P.; Binger, K.J.; et al. Cutaneous Na+ storage strengthens the antimicrobial barrier function of the skin and boosts macrophage-driven host defense. Cell Metab. 2015, 21, 493–501. [Google Scholar] [CrossRef] [PubMed]
- Neuhofer, W. Role of NFAT5 in inflammatory disorders associated with osmotic stress. Curr. Genom. 2010, 11, 584–590. [Google Scholar] [CrossRef]
- Aramburu, J.; López-Rodríguez, C. Regulation of Inflammatory Functions of Macrophages and T Lymphocytes by NFAT5. Front. Immunol. 2019, 10, 535. [Google Scholar] [CrossRef]
- Nazet, U.; Neubert, P.; Schatz, V.; Grässel, S.; Proff, P.; Jantsch, J.; Schröder, A.; Kirschneck, C. Differential gene expression response of synovial fibroblasts from temporomandibular joints and knee joints to dynamic tensile stress. J. Orofac. Orthop. 2022, 83, 361–375. [Google Scholar] [CrossRef] [PubMed]
- Jobin, K.; Müller, D.N.; Jantsch, J.; Kurts, C. Sodium and its manifold impact on our immune system. Trends Immunol. 2021, 42, 469–479. [Google Scholar] [CrossRef] [PubMed]
- Schröder, A.; Nazet, U.; Muschter, D.; Grässel, S.; Proff, P.; Kirschneck, C. Impact of Mechanical Load on the Expression Profile of Synovial Fibroblasts from Patients with and without Osteoarthritis. Int. J. Mol. Sci. 2019, 20, 585. [Google Scholar] [CrossRef]
- Nazet, U.; Feulner, L.; Muschter, D.; Neubert, P.; Schatz, V.; Grässel, S.; Jantsch, J.; Proff, P.; Schröder, A.; Kirschneck, C. Mechanical Stress Induce PG-E2 in Murine Synovial Fibroblasts Originating from the Temporomandibular Joint. Cells 2021, 10, 298. [Google Scholar] [CrossRef]
- Lohberger, B.; Kaltenegger, H.; Weigl, L.; Mann, A.; Kullich, W.; Stuendl, N.; Leithner, A.; Steinecker-Frohnwieser, B. Mechanical exposure and diacerein treatment modulates integrin-FAK-MAPKs mechanotransduction in human osteoarthritis chondrocytes. Cell. Signal. 2019, 56, 23–30. [Google Scholar] [CrossRef]
- Krampert, L.; Ossner, T.; Schröder, A.; Schatz, V.; Jantsch, J. Simultaneous Increases in Intracellular Sodium and Tonicity Boost Antimicrobial Activity of Macrophages. Cells 2023, 12, 2816. [Google Scholar] [CrossRef]
- Geisberger, S.; Bartolomaeus, H.; Neubert, P.; Willebrand, R.; Zasada, C.; Bartolomaeus, T.; McParland, V.; Swinnen, D.; Geuzens, A.; Maifeld, A.; et al. Salt Transiently Inhibits Mitochondrial Energetics in Mononuclear Phagocytes. Circulation 2021, 144, 144–158. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Müller, D.N.; Geisberger, S.; Kleinewietfeld, M.; Jantsch, J. Salt sensitivity includes effects on immune cell signalling and metabolism. Nat. Rev. Immunol. 2023, 23, 341–342. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Li, M.-N.; Yang, G.-M.; Hou, X.-T.; Yang, D.; Han, M.-M.; Zhang, Y.; Liu, Y.-F. Effects of water-sodium balance and regulation of electrolytes associated with antidiabetic drugs. Eur. Rev. Med. Pharmacol. Sci. 2023, 27, 5784–5794. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Alu, A.; Wei, Y.; Wei, X.; Luo, M. The modulatory effect of high salt on immune cells and related diseases. Cell Prolif. 2022, 55, e13250. [Google Scholar] [CrossRef] [PubMed]
- Suckling, R.J.; Swift, P.A. The health impacts of dietary sodium and a low-salt diet. Clin. Med. 2015, 15, 585–588. [Google Scholar] [CrossRef] [PubMed]
- Robinson, A.T.; Edwards, D.G.; Farquhar, W.B. The Influence of Dietary Salt Beyond Blood Pressure. Curr. Hypertens. Rep. 2019, 21, 42. [Google Scholar] [CrossRef] [PubMed]
- Ha, Y.-J.; Ji, E.; Lee, J.H.; Kim, J.H.; Park, E.H.; Chung, S.W.; Chang, S.H.; Yoo, J.J.; Kang, E.H.; Ahn, S.; et al. High Estimated 24-Hour Urinary Sodium Excretion Is Related to Symptomatic Knee Osteoarthritis: A Nationwide Cross-Sectional Population-Based Study. J. Nutr. Health Aging 2022, 26, 581–589. [Google Scholar] [CrossRef]
- Morales-Ivorra, I.; Romera-Baures, M.; Roman-Viñas, B.; Serra-Majem, L. Osteoarthritis and the Mediterranean Diet: A Systematic Review. Nutrients 2018, 10, 1030. [Google Scholar] [CrossRef]
- Sanchez, C.; Gabay, O.; Salvat, C.; Henrotin, Y.E.; Berenbaum, F. Mechanical loading highly increases IL-6 production and decreases OPG expression by osteoblasts. Osteoarthr. Cartil. 2009, 17, 473–481. [Google Scholar] [CrossRef]
- Nazet, U.; Grässel, S.; Jantsch, J.; Proff, P.; Schröder, A.; Kirschneck, C. Early OA Stage Like Response Occurs after Dynamic Stretching of Human Synovial Fibroblasts. Int. J. Mol. Sci. 2020, 21, 3874. [Google Scholar] [CrossRef]
- Takito, J.; Nonaka, N. Osteoclasts at Bone Remodeling: Order from Order. Results Probl. Cell Differ. 2024, 71, 227–256. [Google Scholar] [CrossRef] [PubMed]
- Cafferata, E.A.; Monasterio, G.; Castillo, F.; Carvajal, P.; Flores, G.; Díaz, W.; Fuentes, A.D.; Vernal, R. Overexpression of MMPs, cytokines, and RANKL/OPG in temporomandibular joint osteoarthritis and their association with joint pain, mouth opening, and bone degeneration: A preliminary report. Oral Dis. 2021, 27, 970–980. [Google Scholar] [CrossRef] [PubMed]
- Neubert, P.; Homann, A.; Wendelborn, D.; Bär, A.-L.; Krampert, L.; Trum, M.; Schröder, A.; Ebner, S.; Weichselbaum, A.; Schatz, V.; et al. NCX1 represents an ionic Na+ sensing mechanism in macrophages. PLoS Biol. 2020, 18, e3000722. [Google Scholar] [CrossRef] [PubMed]
- Hernansanz-Agustín, P.; Choya-Foces, C.; Carregal-Romero, S.; Ramos, E.; Oliva, T.; Villa-Piña, T.; Moreno, L.; Izquierdo-Álvarez, A.; Cabrera-García, J.D.; Cortés, A.; et al. Na+ controls hypoxic signalling by the mitochondrial respiratory chain. Nature 2020, 586, 287–291. [Google Scholar] [CrossRef] [PubMed]
- Schröder, A.; Leikam, A.; Käppler, P.; Neubert, P.; Jantsch, J.; Neuhofer, W.; Deschner, J.; Proff, P.; Kirschneck, C. Impact of salt and the osmoprotective transcription factor NFAT-5 on macrophages during mechanical strain. Immunol. Cell Biol. 2021, 99, 84–96. [Google Scholar] [CrossRef]
- Amara, S.; Tiriveedhi, V. Inflammatory role of high salt level in tumor microenvironment (Review). Int. J. Oncol. 2017, 50, 1477–1481. [Google Scholar] [CrossRef] [PubMed]
- Yoon, H.-J.; You, S.; Yoo, S.-A.; Kim, N.-H.; Kwon, H.M.; Yoon, C.-H.; Cho, C.-S.; Hwang, D.; Kim, W.-U. NF-AT5 is a critical regulator of inflammatory arthritis. Arthritis Rheum. 2011, 63, 1843–1852. [Google Scholar] [CrossRef]
- Lee, J.; Lee, J.; Lee, S.; Yoo, S.-A.; Kim, K.-M.; Kim, W.-U.; Cho, C.-S.; Yoon, C.-H. Genetic deficiency of nuclear factor of activated T cells 5 attenuates the development of osteoarthritis in mice. Jt. Bone Spine 2022, 89, 105273. [Google Scholar] [CrossRef]
- Bar-Or, D.; Rael, L.T.; Brody, E.N. Use of Saline as a Placebo in Intra-articular Injections in Osteoarthritis: Potential Contributions to Nociceptive Pain Relief. Open Rheumatol. J. 2017, 11, 16–22. [Google Scholar] [CrossRef]
Gene | Gene Name | 5′-Forward-Primer-3′ | 5′-Reverse-Primer-3′ |
---|---|---|---|
Hprt | hypoxanthine guanine phosphoribosyl transferase | AGCTTGCTGGTGAAAAGGAC | AGTCAAGGGCATATCCAACAAC |
Il6 | Interleukin-6 | AAAGCCAGAGTCCTTCAGAGAG | CCTTAGCCACTCCTTCTGTGAC |
Nfat5 | nuclear factor of activated T-cells | AAATGACCTGTAGTTCTCTGCTTC | GCTGTCGGTGACTGAGGTAG |
Opg | osteoprotegerin | CCTTGCCCTGACCACTCTTAT | CACACACTCGGTTGTGGGT |
Ptgs2 | prostaglandin endoperoxide synthase-2 | TCCCTGAAGCCGTACACATC | TCCCCAAAGATAGCATCTGGAC |
Rankl | receptor activatior of NF-κB ligand | AAACGCAGATTTGCAGGACTC | CCCCACAATGTGTTGCAGTTC |
Sdha | succinat dehydrogenase complex, subunit A | AACACTGGAGGAAGCACACC | AGTAGGAGCGGATAGCAGGAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Proff, A.; Nazet, U.; Schröder, A.; Jantsch, J. Mechanical Stress Induces Sodium Entry and Osmoprotective Responses in Murine Synovial Fibroblasts. Cells 2024, 13, 496. https://doi.org/10.3390/cells13060496
Proff A, Nazet U, Schröder A, Jantsch J. Mechanical Stress Induces Sodium Entry and Osmoprotective Responses in Murine Synovial Fibroblasts. Cells. 2024; 13(6):496. https://doi.org/10.3390/cells13060496
Chicago/Turabian StyleProff, Annemarie, Ute Nazet, Agnes Schröder, and Jonathan Jantsch. 2024. "Mechanical Stress Induces Sodium Entry and Osmoprotective Responses in Murine Synovial Fibroblasts" Cells 13, no. 6: 496. https://doi.org/10.3390/cells13060496
APA StyleProff, A., Nazet, U., Schröder, A., & Jantsch, J. (2024). Mechanical Stress Induces Sodium Entry and Osmoprotective Responses in Murine Synovial Fibroblasts. Cells, 13(6), 496. https://doi.org/10.3390/cells13060496