Cell Type-Selective Loss of Peroxisomal β-Oxidation Impairs Bipolar Cell but Not Photoreceptor Survival in the Retina
Abstract
1. Introduction
2. Materials and Methods
2.1. Generation of Crx-Mfp2−/− and Crx-Pex5−/− Mice
2.2. In Vivo Analysis of Visual Acuity and Functioning
2.3. Western Blotting
2.4. Lipidome
2.5. Histochemistry
2.6. Immunohistochemistry
2.7. RNA Scope®
2.8. RPE Flatmounts
2.9. Transmission Electron Microscopy
2.10. Statistics
3. Results
3.1. Confirmation of MFP2 Deletion in Crx-Mfp2−/− Mice
3.2. Normal Retinal Morphology and Photoreceptor Length in Crx-Mfp2−/− Mice
3.3. Normal DHA Levels but Accumulation of VLC-PUFAs in Crx-Mfp2−/− Mice
3.4. Crx-Mfp2−/− Mice Present with Reduced Visual Acuity and a Negative ERG
3.5. Crx-Mfp2−/− Mice Exhibit Impaired Synaptic Integrity and Loss of Bipolar Cells
3.6. Increased Inflammation in Crx-Mfp2−/− Mice
3.7. Crx-Pex5−/− Mice Do Not Present with a More Severe Retinal Phenotype than Crx-Mfp2−/− Mice
4. Discussion
4.1. Peroxisomal β-Oxidation in Photoreceptors Is Not Essential for Their Survival, Function and DHA Content
4.2. Peroxisomal β-Oxidation Is Crucial for VLC-PUFA Homeostasis That May Affect the Synapse
4.3. Bipolar Cell Survival and Functioning Depend on Peroxisomal β-Oxidation
4.4. Retinal Gene Augmentation for Peroxisomal Disorders Should Target the Entire Retina
4.5. What Is the Role of Peroxisomes in the Photoreceptors?
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Acknowledgments
Conflicts of Interest
References
- Wanders, R.J.; Waterham, H.R. Biochemistry of mammalian peroxisomes revisited. Annu. Rev. Biochem. 2006, 75, 295–332. [Google Scholar] [CrossRef]
- Islinger, M.; Voelkl, A.; Fahimi, H.D.; Schrader, M. The peroxisome: An update on mysteries 2.0. Histochem. Cell Biol. 2018, 150, 443–471. [Google Scholar] [CrossRef]
- Ferdinandusse, S.; Denis, S.; Mooyer, P.A.; Dekker, C.; Duran, M.; Soorani-Lunsing, R.J.; Boltshauser, E.; Macaya, A.; Gärtner, J.; Majoie, C.B.; et al. Clinical and biochemical spectrum of D-bifunctional protein deficiency. Ann. Neurol. 2006, 59, 92–104. [Google Scholar] [CrossRef]
- McMillan, H.J.; Worthylake, T.; Schwartzentruber, J.; Gottlieb, C.C.; Lawrence, S.E.; Mackenzie, A.; Beaulieu, C.L.; Mooyer, P.A.; Wanders, R.J.; Majewski, J.; et al. Specific combinatio n of compound heterozygous mutations in 17β-hydroxysteroid dehydrogenase type 4 (HSD17B4) defines a new subtype of D-bifunctional protein deficiency. Orphanet J. Rare Dis. 2012, 7, 90. [Google Scholar] [CrossRef]
- Lines, M.A.; Jobling, R.; Brady, L.; Marshall, C.R.; Scherer, S.W.; Rodriguez, A.R.; Lee, L.; Lang, A.E.; Mestre, T.A.; Wanders, R.J.; et al. Peroxisomal D-bifunctional protein deficiency: Three adults diagnosed by whole-exome sequencing. Neurology 2014, 82, 963–968. [Google Scholar] [CrossRef]
- Amor, D.J.; Marsh, A.P.; Storey, E.; Tankard, R.; Gillies, G.; Delatycki, M.B.; Pope, K.; Bromhead, C.; Leventer, R.J.; Bahlo, M.; et al. Heterozygous mutations in HSD17B4 cause juvenile peroxisomal D-bifunctional protein deficiency. Neurol. Genet. 2016, 2, e114. [Google Scholar] [CrossRef] [PubMed]
- Das, Y.; Baes, M. Peroxisomal Disorders and Retinal Degeneration. Adv. Exp. Med. Biol. 2019, 1185, 317–321. [Google Scholar] [CrossRef] [PubMed]
- Van Veldhoven, P.P. Biochemistry and genetics of inherited disorders of peroxisomal fatty acid metabolism. J. Lipid Res. 2010, 51, 2863–2895. [Google Scholar] [CrossRef]
- Fliesler, S.J.; Anderson, R.E. Chemistry and metabolism of lipids in the vertebrate retina. Prog. Lipid Res. 1983, 22, 79–131. [Google Scholar] [CrossRef]
- Aveldaño, M.I. Phospholipid species containing long and very long polyenoic fatty acids remain with rhodopsin after hexane extraction of photoreceptor membranes. Biochemistry 1988, 27, 1229–1239. [Google Scholar] [CrossRef]
- Grossfield, A.; Feller, S.E.; Pitman, M.C. A role for direct interactions in the modulation of rhodopsin by omega-3 polyunsaturated lipids. Proc. Natl. Acad. Sci. USA 2006, 103, 4888–4893. [Google Scholar] [CrossRef]
- Sánchez-Martín, M.J.; Ramon, E.; Torrent-Burgués, J.; Garriga, P. Improved conformational stability of the visual G protein-coupled receptor rhodopsin by specific interaction with docosahexaenoic acid phospholipid. Chembiochem 2013, 14, 639–644. [Google Scholar] [CrossRef]
- Deák, F.; Anderson, R.E.; Fessler, J.L.; Sherry, D.M. Novel Cellular Functions of Very Long Chain-Fatty Acids: Insight From ELOVL4 Mutations. Front. Cell. Neurosci. 2019, 13, 428. [Google Scholar] [CrossRef] [PubMed]
- Das, Y.; Roose, N.; De Groef, L.; Fransen, M.; Moons, L.; Van Veldhoven, P.P.; Baes, M. Differential distribution of peroxisomal proteins points to specific roles of peroxisomes in the murine retina. Mol. Cell. Biochem. 2019, 456, 53–62. [Google Scholar] [CrossRef]
- Smith, C.E.; Poulter, J.A.; Levin, A.V.; Capasso, J.E.; Price, S.; Ben-Yosef, T.; Sharony, R.; Newman, W.G.; Shore, R.C.; Brookes, S.J.; et al. Spectrum of PEX1 and PEX6 variants in Heimler syndrome. Eur. J. Hum. Genet. 2016, 24, 1565–1571. [Google Scholar] [CrossRef] [PubMed]
- Zaki, M.S.; Heller, R.; Thoenes, M.; Nürnberg, G.; Stern-Schneider, G.; Nürnberg, P.; Karnati, S.; Swan, D.; Fateen, E.; Nagel-Wolfrum, K.; et al. PEX6 is Expressed in Photoreceptor Cilia and Mutated in Deafblindness with Enamel Dysplasia and Microcephaly. Hum. Mutat. 2016, 37, 170–174. [Google Scholar] [CrossRef] [PubMed]
- Argyriou, C.; Polosa, A.; Cecyre, B.; Hsieh, M.; Di Pietro, E.; Cui, W.; Bouchard, J.F.; Lachapelle, P.; Braverman, N. A longitudinal study of retinopathy in the PEX1-Gly844Asp mouse model for mild Zellweger Spectrum Disorder. Exp. Eye Res. 2019, 186, 107713. [Google Scholar] [CrossRef]
- Daniele, L.L.; Caughey, J.; Volland, S.; Sharp, R.C.; Dhingra, A.; Williams, D.S.; Philp, N.J.; Boesze-Battaglia, K. Peroxisome turnover and diurnal modulation of antioxidant activity in retinal pigment epithelia utilizes microtubule-associated protein 1 light chain 3B (LC3B). Am. J. Physiol.-Cell Physiol. 2019, 317, 1194–1204. [Google Scholar] [CrossRef] [PubMed]
- Das, Y.; Swinkels, D.; Kocherlakota, S.; Vinckier, S.; Vaz, F.M.; Wever, E.; van Kampen, A.H.C.; Jun, B.; Do, K.V.; Moons, L.; et al. Peroxisomal Multifunctional Protein 2 Deficiency Perturbs Lipid Homeostasis in the Retina and Causes Visual Dysfunction in Mice. Front. Cell Dev. Biol. 2021, 9, 83. [Google Scholar] [CrossRef]
- Argyriou, C.; Polosa, A.; Song, J.Y.; Omri, S.; Steele, B.; Cecyre, B.; McDougald, D.S.; Di Pietro, E.; Bouchard, J.-F.; Bennett, J.; et al. AAV-mediated PEX1 gene augmentation improves visual function in the PEX1-Gly844Asp mouse model for mild Zellweger spectrum disorder. Mol. Ther.-Methods Clin. Dev. 2021, 23, 225–240. [Google Scholar] [CrossRef]
- Bazan, H.E.; Careaga, M.M.; Sprecher, H.; Bazan, N.G. Chain elongation and desaturation of eicosapentaenoate to docosahexaenoate and phospholipid labeling in the rat retina in vivo. Biochim. Biophys. Acta 1982, 712, 123–128. [Google Scholar] [CrossRef]
- Wang, N.; Anderson, R.E. Synthesis of docosahexaenoic acid by retina and retinal pigment epithelium. Biochemistry 1993, 32, 13703–13709. [Google Scholar] [CrossRef]
- Rotstein, N.P.; Pennacchiotti, G.L.; Sprecher, H.; Aveldaño, M.I. Active synthesis of C24:5, n-3 fatty acid in retina. Biochem. J. 1996, 316, 859–864. [Google Scholar] [CrossRef][Green Version]
- Simón, M.V.; Agnolazza, D.L.; German, O.L.; Garelli, A.; Politi, L.E.; Agbaga, M.P.; Anderson, R.E.; Rotstein, N.P. Synthesis of docosahexaenoic acid from eicosapentaenoic acid in retina neurons protects photoreceptors from oxidative stress. J. Neurochem. 2016, 136, 931–946. [Google Scholar] [CrossRef]
- Prasov, L.; Glaser, T. Pushing the envelope of retinal ganglion cell genesis: Context dependent function of Math5 (Atoh7). Dev. Biol. 2012, 368, 214–230. [Google Scholar] [CrossRef] [PubMed]
- Fransen, M.; Brees, C.; Baumgart, E.; Vanhooren, J.C.; Baes, M.; Mannaerts, G.P.; Van Veldhoven, P.P. Identification and characterization of the putative human peroxisomal C-terminal targeting signal import receptor. J. Biol. Chem. 1995, 270, 7731–7736. [Google Scholar] [CrossRef] [PubMed]
- Dodt, G.; Braverman, N.; Wong, C.; Moser, A.; Moser, H.W.; Watkins, P.; Valle, D.; Gould, S.J. Mutations in the PTS1 receptor gene, PXR1, define complementation group 2 of the peroxisome biogenesis disorders. Nat. Genet. 1995, 9, 115–125. [Google Scholar] [CrossRef]
- Wiemer, E.A.; Nuttley, W.M.; Bertolaet, B.L.; Li, X.; Francke, U.; Wheelock, M.J.; Anné, U.K.; Johnson, K.R.; Subramani, S. Human peroxisomal targeting signal-1 receptor restores peroxisomal protein import in cells from patients with fatal peroxisomal disorders. J. Cell Biol. 1995, 130, 51–65. [Google Scholar] [CrossRef]
- Verheijden, S.; Bottelbergs, A.; Krysko, O.; Krysko, D.V.; Beckers, L.; De Munter, S.; Van Veldhoven, P.P.; Wyns, S.; Kulik, W.; Nave, K.A.; et al. Peroxisomal multifunctional protein-2 deficiency causes neuroinflammation and degeneration of Purkinje cells independent of very long chain fatty acid accumulation. Neurobiol. Dis. 2013, 58, 258–269. [Google Scholar] [CrossRef] [PubMed]
- Baes, M.; Dewerchin, M.; Janssen, A.; Collen, D.; Carmeliet, P. Generation of Pex5-loxP mice allowing the conditional elimination of peroxisomes. Genesis 2002, 32, 177–178. [Google Scholar] [CrossRef]
- Prusky, G.T.; Alam, N.M.; Beekman, S.; Douglas, R.M. Rapid quantification of adult and developing mouse spatial vision using a virtual optomotor system. Investig. Ophthalmol. Vis. Sci. 2004, 45, 4611–4616. [Google Scholar] [CrossRef]
- Douglas, R.M.; Alam, N.M.; Silver, B.D.; McGill, T.J.; Tschetter, W.W.; Prusky, G.T. Independent visual threshold measurements in the two eyes of freely moving rats and mice using a virtual-reality optokinetic system. Vis. Neurosci. 2005, 22, 677–684. [Google Scholar] [CrossRef] [PubMed]
- Tanimoto, N.; Sothilingam, V.; Kondo, M.; Biel, M.; Humphries, P.; Seeliger, M.W. Electroretinographic assessment of rod- and cone-mediated bipolar cell pathways using flicker stimuli in mice. Sci. Rep. 2015, 5, 10731. [Google Scholar] [CrossRef]
- Tanimoto, N.; Akula, J.D.; Fulton, A.B.; Weber, B.H.; Seeliger, M.W. Differentiation of murine models of "negative ERG" by single and repetitive light stimuli. Doc. Ophthalmol. 2016, 132, 101–109. [Google Scholar] [CrossRef] [PubMed]
- Antonenkov, V.D.; Van Veldhoven, P.P.; Waelkens, E.; Mannaerts, G.P. Substrate specificities of 3-oxoacyl-CoA thiolase A and sterol carrier protein 2/3-oxoacyl-CoA thiolase purified from normal rat liver peroxisomes. Sterol carrier protein 2/3-oxoacyl-CoA thiolase is involved in the metabolism of 2-methyl-branched fatty acids and bile acid intermediates. J. Biol. Chem. 1997, 272, 26023–26031. [Google Scholar] [CrossRef] [PubMed]
- Vaz, F.M.; McDermott, J.H.; Alders, M.; Wortmann, S.B.; Kölker, S.; Pras-Raves, M.L.; Vervaart, M.A.T.; van Lenthe, H.; Luyf, A.C.M.; Elfrink, H.L.; et al. Mutations in PCYT2 disrupt etherlipid biosynthesis and cause a complex hereditary spastic paraplegia. Brain 2019, 142, 3382–3397. [Google Scholar] [CrossRef]
- Baboota, R.K.; Shinde, A.B.; Lemaire, K.; Fransen, M.; Vinckier, S.; Van Veldhoven, P.P.; Schuit, F.; Baes, M. Functional peroxisomes are required for β-cell integrity in mice. Mol. Metab. 2019, 22, 71–83. [Google Scholar] [CrossRef]
- Audo, I.; Robson, A.G.; Holder, G.E.; Moore, A.T. The negative ERG: Clinical phenotypes and disease mechanisms of inner retinal dysfunction. Surv. Ophthalmol. 2008, 53, 16–40. [Google Scholar] [CrossRef]
- Jiang, X.; Mahroo, O.A. Negative electroretinograms: Genetic and acquired causes, diagnostic approaches and physiological insights. Eye 2021, 35, 2419–2437. [Google Scholar] [CrossRef]
- West, E.R.; Cepko, C.L. Development and diversification of bipolar interneurons in the mammalian retina. Dev. Biol. 2022, 481, 30–42. [Google Scholar] [CrossRef]
- Yoshimatsu, T.; Suzuki, S.C.; Wong, R.O.L. Circuit Assembly in the Developing Vertebrate Retina. In Cellular Migration and Formation of Neuronal Connections: Comprehensive Developmental Neuroscience; Elsevier: San Diego, CA, USA, 2013; Volume 2, pp. 687–711. [Google Scholar]
- Bramall, A.N.; Wright, A.F.; Jacobson, S.G.; McInnes, R.R. The genomic, biochemical, and cellular responses of the retina in inherited photoreceptor degenerations and prospects for the treatment of these disorders. Annu. Rev. Neurosci. 2010, 33, 441–472. [Google Scholar] [CrossRef]
- Volonté, Y.A.; Ayala-Peña, V.B.; Vallese-Maurizi, H.; Garelli, A.; Rotstein, N.P.; Politi, L.E.; German, O.L. Retinoid X receptor activation promotes photoreceptor survival and modulates the inflammatory response in a mouse model of retinitis pigmentosa. Biochim. Biophys. Acta (BBA)-Mol. Cell Res. 2021, 1868, 119098. [Google Scholar] [CrossRef] [PubMed]
- Dirkx, R.; Vanhorebeek, I.; Martens, K.; Schad, A.; Grabenbauer, M.; Fahimi, D.; Declercq, P.; Van Veldhoven, P.P.; Baes, M. Absence of peroxisomes in mouse hepatocytes causes mitochondrial and ER abnormalities. Hepatology 2005, 41, 868–878. [Google Scholar] [CrossRef]
- Agbaga, M.P.; Mandal, M.N.; Anderson, R.E. Retinal very long-chain PUFAs: New insights from studies on ELOVL4 protein. J. Lipid Res. 2010, 51, 1624–1642. [Google Scholar] [CrossRef]
- Bennett, L.D.; Brush, R.S.; Chan, M.; Lydic, T.A.; Reese, K.; Reid, G.E.; Busik, J.V.; Elliott, M.H.; Anderson, R.E. Effect of reduced retinal VLC-PUFA on rod and cone photoreceptors. Investig. Ophthalmol. Vis. Sci. 2014, 55, 3150–3157. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Bennett, L.D.; Hopiavuori, B.R.; Brush, R.S.; Chan, M.; Van Hook, M.J.; Thoreson, W.B.; Anderson, R.E. Examination of VLC-PUFA-deficient photoreceptor terminals. Investig. Ophthalmol. Vis. Sci. 2014, 55, 4063–4072. [Google Scholar] [CrossRef] [PubMed]
- Hopiavuori, B.R.; Anderson, R.E.; Agbaga, M.P. ELOVL4: Very long-chain fatty acids serve an eclectic role in mammalian health and function. Prog. Retin. Eye Res. 2019, 69, 137–158. [Google Scholar] [CrossRef]
- Dick, O.; tom Dieck, S.; Altrock, W.D.; Ammermüller, J.; Weiler, R.; Garner, C.C.; Gundelfinger, E.D.; Brandstätter, J.H. The presynaptic active zone protein bassoon is essential for photoreceptor ribbon synapse formation in the retina. Neuron 2003, 37, 775–786. [Google Scholar] [CrossRef]
- Fairless, R.; Williams, S.K.; Katiyar, R.; Maxeiner, S.; Schmitz, F.; Diem, R. ERG Responses in Mice with Deletion of the Synaptic Ribbon Component RIBEYE. Investig. Ophthalmol. Vis. Sci. 2020, 61, 37. [Google Scholar] [CrossRef]
- Maxeiner, S.; Luo, F.; Tan, A.; Schmitz, F.; Südhof, T.C. How to make a synaptic ribbon: RIBEYE deletion abolishes ribbons in retinal synapses and disrupts neurotransmitter release. EMBO J. 2016, 35, 1098–1114. [Google Scholar] [CrossRef]
- Rubio-Fernández, M.; Uribe, M.L.; Vicente-Tejedor, J.; Germain, F.; Susín-Lara, C.; Quereda, C.; Montoliu, L.; de la Villa, P.; Martín-Nieto, J.; Cruces, J. Impairment of photoreceptor ribbon synapses in a novel Pomt1 conditional knockout mouse model of dystroglycanopathy. Sci. Rep. 2018, 8, 8543. [Google Scholar] [CrossRef]
- Masu, M.; Iwakabe, H.; Tagawa, Y.; Miyoshi, T.; Yamashita, M.; Fukuda, Y.; Sasaki, H.; Hiroi, K.; Nakamura, Y.; Shigemoto, R. Specific deficit of the ON response in visual transmission by targeted disruption of the mGluR6 gene. Cell 1995, 80, 757–765. [Google Scholar] [CrossRef]
- Tagawa, Y.; Sawai, H.; Ueda, Y.; Tauchi, M.; Nakanishi, S. Immunohistological studies of metabotropic glutamate receptor subtype 6-deficient mice show no abnormality of retinal cell organization and ganglion cell maturation. J. Neurosci. 1999, 19, 2568–2579. [Google Scholar] [CrossRef] [PubMed]
- Rao, A.; Dallman, R.; Henderson, S.; Chen, C.K. Gbeta5 is required for normal light responses and morphology of retinal ON-bipolar cells. J. Neurosci. 2007, 27, 14199–14204. [Google Scholar] [CrossRef]
- Zhu, X.; Qi, X.; Yang, Y.; Tian, W.; Liu, W.; Jiang, Z.; Li, S. Loss of the ER membrane protein complex subunit Emc3 leads to retinal bipolar cell degeneration in aged mice. PLoS ONE 2020, 15, e0238435. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Liu, W.; Sun, K.; Jiang, L.; Zhu, X. Tmem30a deficiency leads to retinal rod bipolar cell degeneration. J. Neurochem. 2019, 148, 400–412. [Google Scholar] [CrossRef] [PubMed]
- Das, Y.; Swinkels, D.; Baes, M. Peroxisomal Disorders and Their Mouse Models Point to Essential Roles of Peroxisomes for Retinal Integrity. Int. J. Mol. Sci. 2021, 22, 4101. [Google Scholar] [CrossRef]
- Hiebler, S.; Masuda, T.; Hacia, J.G.; Moser, A.B.; Faust, P.L.; Liu, A.; Chowdhury, N.; Huang, N.; Lauer, A.; Bennett, J.; et al. The Pex1-G844D mouse: A model for mild human Zellweger spectrum disorder. Mol. Genet. Metab. 2014, 111, 522–532. [Google Scholar] [CrossRef]
- Rashid, K.; Akhtar-Schaefer, I.; Langmann, T. Microglia in Retinal Degeneration. Front. Immunol. 2019, 10, 1975. [Google Scholar] [CrossRef] [PubMed]









| Gene | Forward | Reverse |
|---|---|---|
| Cre recombinase | 5′ GCCTGCATTACCGGTCGATGCAACGA 3′ | 5′ GTGGCAGATGGCGCGGCAACACCATT 3′ |
| Mfp2L/L | 5′ CCCAACGCTGGGTCACGGATGACG 3′ | 5′ GCAACCATAAGTTACACAAAATGCC 3′ |
| Pex5L/L | 5′ CTCTGGTTCCCATGGCCAGGGTGG 3′ | 5′ GGGGAGTACGACAAGGCTGTGGACTG 3′ |
| Primary Antibody | Host | Dilution | Supplier/Reference | |
|---|---|---|---|---|
| Cre recombinase | Mouse | 1/500 | Frozen | Euromedex (CRE-2D8-As) |
| GFAP | Rabbit | 1/10,000 | NDF | Dako (Z0334) |
| 4-HNE | Rabbit | 1/100 | 1% PFA | Calbiochem (393207) |
| MFP2 | Rabbit | 1/200 | Western blotting | Proteintech (15116-1-AP) |
| Opsin | Rabbit | 1/100 | NDF | Millipore (AB5405) |
| Peanut agglutinin | / | 1/100 | NDF | Vector Laboratories (FL-1071) |
| Phalloidin-Alexa647 | / | 1/100 | RPE flatmount | Invitrogen (A30107) |
| PKCα | Mouse | 1/100 | 1% PFA | Santa Cruz (SC-17769) |
| PLIN2 | Rabbit | 1/1000 1/200 | NDF RPE flatmount | NOVUS (NB110-40877) |
| Rhodopsin | Mouse | 1/1000 (Alexa 1/750) | NDF | Millipore (MAB5356) |
| Thiolase | Rabbit | 1/500 | Western blotting | Van Veldhoven P.P. [35] |
| VGLUT1 | Rabbit | 1/1000 | 1% PFA | Synaptic Systems (135303) |
| Vinculin | Mouse | 1/2000 | Western blotting | Sigma (V9131) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Swinkels, D.; Das, Y.; Kocherlakota, S.; Vinckier, S.; Wever, E.; van Kampen, A.H.C.; Vaz, F.M.; Baes, M. Cell Type-Selective Loss of Peroxisomal β-Oxidation Impairs Bipolar Cell but Not Photoreceptor Survival in the Retina. Cells 2022, 11, 161. https://doi.org/10.3390/cells11010161
Swinkels D, Das Y, Kocherlakota S, Vinckier S, Wever E, van Kampen AHC, Vaz FM, Baes M. Cell Type-Selective Loss of Peroxisomal β-Oxidation Impairs Bipolar Cell but Not Photoreceptor Survival in the Retina. Cells. 2022; 11(1):161. https://doi.org/10.3390/cells11010161
Chicago/Turabian StyleSwinkels, Daniëlle, Yannick Das, Sai Kocherlakota, Stefan Vinckier, Eric Wever, Antoine H.C. van Kampen, Frédéric M. Vaz, and Myriam Baes. 2022. "Cell Type-Selective Loss of Peroxisomal β-Oxidation Impairs Bipolar Cell but Not Photoreceptor Survival in the Retina" Cells 11, no. 1: 161. https://doi.org/10.3390/cells11010161
APA StyleSwinkels, D., Das, Y., Kocherlakota, S., Vinckier, S., Wever, E., van Kampen, A. H. C., Vaz, F. M., & Baes, M. (2022). Cell Type-Selective Loss of Peroxisomal β-Oxidation Impairs Bipolar Cell but Not Photoreceptor Survival in the Retina. Cells, 11(1), 161. https://doi.org/10.3390/cells11010161

