IFN-λ Modulates the Migratory Capacity of Canine Mammary Tumor Cells via Regulation of the Expression of Matrix Metalloproteinases and Their Inhibitors
Abstract
1. Introduction
2. Materials and Methods
2.1. Canine Mammary Tumor Cell Lines and Culture Conditions
2.2. Cell Viability and Proliferation Assay
2.3. Apoptosis Assay
2.4. Real-Time Quantitative PCR
2.5. Western Blot
2.6. Scratch Test (Wound Healing Assay)
2.7. Statistical Analysis
3. Results
3.1. Canine Mammary Tumor Cells Express the Receptor for IFN-λ and Respond to This Cytokine
3.2. IFN-λ Does Not Regulate Canine Mammary Tumor Cell Survival
3.3. IFN-λ Modulates Canine Mammary Tumor Cell Migration
3.4. IFN-λ Regulates Extracellular Matrix Metalloproteinases and Their Inhibitors Expression in a Akt- and ERK-Independent Manner
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Choi, J.-W.; Yoon, H.-Y.; Jeong, S.-W. Clinical Outcomes of Surgically Managed Spontaneous Tumors in 114 Client-Owned Dogs. Immune Netw. 2016, 16, 116–125. [Google Scholar] [CrossRef] [Scilit]
- Nunes, F.C.; Damasceno, K.A.; de Campos, C.B.; Bertagnolli, A.C.; Lavalle, G.E.; Cassali, G.D. Mixed Tumors of the Canine Mammary Glands: Evaluation of Prognostic Factors, Treatment, and Overall Survival. Vet. Anim. Sci. 2019, 7, 100039. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abdelmegeed, S.; Mohammed, S. Canine Mammary Tumors as a Model for Human Disease (Review). Oncol. Lett. 2018, 15, 8195–8205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vilhena, H.; Figueira, A.C.; Schmitt, F.; Canadas, A.; Chaves, R.; Gama, A.; Dias-Pereira, P. Canine and Feline Spontaneous Mammary Tumours as Models of Human Breast Cancer. In Pets as Sentinels, Forecasters and Promoters of Human Health; Pastorinho, M.R., Sousa, A.C.A., Eds.; Springer International Publishing: Cham, Switzerland, 2020; pp. 173–207. [Google Scholar]
- Soares, M.; Madeira, S.; Correia, J.; Peleteiro, M.; Cardoso, F.; Ferreira, F. Molecular Based Subtyping of Feline Mammary Carcinomas and Clinicopathological Characterization. Breast 2016, 27, 44–51. [Google Scholar] [CrossRef] [Scilit]
- Ariyarathna, H.; Thomson, N.A.; Aberdein, D.; Perrott, M.R.; Munday, J.S. Increased Programmed Death Ligand (PD-L1) and Cytotoxic T-Lymphocyte Antigen-4 (CTLA-4) Expression Is Associated with Metastasis and Poor Prognosis in Malignant Canine Mammary Gland Tumours. Vet. Immunol. Immunopathol. 2020, 230, 110142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Urbano, A.C.; Nascimento, C.; Soares, M.; Correia, J.; Ferreira, F. Clinical Relevance of the Serum CTLA-4 in Cats with Mammary Carcinoma. Sci. Rep. 2020, 10, 3822. [Google Scholar] [CrossRef] [Scilit]
- Nascimento, C.; Urbano, A.C.; Gameiro, A.; Ferreira, J.; Correia, J.; Ferreira, F. Serum PD-1/PD-L1 Levels, Tumor Expression and PD-L1 Somatic Mutations in HER2-Positive and Triple Negative Normal-Like Feline Mammary Carcinoma Subtypes. Cancers 2020, 12, 1386. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amini, P.; Nassiri, S.; Ettlin, J.; Malbon, A.; Markkanen, E. Next-Generation RNA Sequencing of FFPE Subsections Reveals Highly Conserved Stromal Reprogramming between Canine and Human Mammary Carcinoma. Dis. Model. Mech. 2019, 12, dmm040444. [Google Scholar] [CrossRef] [Scilit]
- Ettlin, J.; Clementi, E.; Amini, P.; Malbon, A.; Markkanen, E. Analysis of Gene Expression Signatures in Cancer-Associated Stroma from Canine Mammary Tumours Reveals Molecular Homology to Human Breast Carcinomas. Int. J. Mol. Sci. 2017, 18, 1101. [Google Scholar] [CrossRef] [Scilit]
- Markkanen, E. Know Thy Model: Charting Molecular Homology in Stromal Reprogramming Between Canine and Human Mammary Tumors. Front. Cell Dev. Biol. 2019, 7, 348. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amini, P.; Nassiri, S.; Malbon, A.; Markkanen, E. Differential Stromal Reprogramming in Benign and Malignant Naturally Occurring Canine Mammary Tumours Identifies Disease-Modulating Stromal Components. Sci. Rep. 2020, 10, 5506. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mucha, J.; Majchrzak, K.; Taciak, B.; Hellmén, E.; Król, M. MDSCs Mediate Angiogenesis and Predispose Canine Mammary Tumor Cells for Metastasis via IL-28/IL-28RA (IFN-λ) Signaling. PLoS ONE 2014, 9, e103249. [Google Scholar] [CrossRef] [Scilit]
- Stanifer, M.L.; Pervolaraki, K.; Boulant, S. Differential Regulation of Type I and Type III Interferon Signaling. Int. J. Mol. Sci. 2019, 20, 1445. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kotenko, S.V.; Gallagher, G.; Baurin, V.V.; Lewis-Antes, A.; Shen, M.; Shah, N.K.; Langer, J.A.; Sheikh, F.; Dickensheets, H.; Donnelly, R.P. IFN-Λs Mediate Antiviral Protection through a Distinct Class II Cytokine Receptor Complex. Nat. Immunol. 2003, 4, 69–77. [Google Scholar] [CrossRef] [Scilit]
- Sheppard, P.; Kindsvogel, W.; Xu, W.; Henderson, K.; Schlutsmeyer, S.; Whitmore, T.E.; Kuestner, R.; Garrigues, U.; Birks, C.; Roraback, J.; et al. IL-28, IL-29 and Their Class II Cytokine Receptor IL-28R. Nat. Immunol. 2003, 4, 63–68. [Google Scholar] [CrossRef] [Scilit]
- O’Brien, T.R.; Prokunina-Olsson, L.; Donnelly, R.P. IFN-Λ4: The Paradoxical New Member of the Interferon Lambda Family. J. Interferon Cytokine Res. 2014, 34, 829–838. [Google Scholar] [CrossRef] [Scilit]
- Lasfar, A.; Lewis-Antes, A.; Smirnov, S.V.; Anantha, S.; Abushahba, W.; Tian, B.; Reuhl, K.; Dickensheets, H.; Sheikh, F.; Donnelly, R.P.; et al. Characterization of the Mouse IFN-λ Ligand-Receptor System: IFN-Λs Exhibit Antitumor Activity against B16 Melanoma. Cancer Res. 2006, 66, 4468–4477. [Google Scholar] [CrossRef] [Scilit]
- Reuter, A.; Soubies, S.; Hartle, S.; Schusser, B.; Kaspers, B.; Staeheli, P.; Rubbenstroth, D.; Garcia-Sastre, A. Antiviral Activity of Lambda Interferon in Chickens. J. Virol. 2014, 88, 2835–2843. [Google Scholar] [CrossRef] [Scilit]
- Zhou, P.; Cowled, C.; Todd, S.; Crameri, G.; Virtue, E.R.; Marsh, G.A.; Klein, R.; Shi, Z.; Wang, L.-F.; Baker, M.L. Type III IFNs in Pteropid Bats: Differential Expression Patterns Provide Evidence for Distinct Roles in Antiviral Immunity. J. Immunol. 2011, 186, 3138–3147. [Google Scholar] [CrossRef] [Scilit]
- Quintana, M.E.; Cardoso, N.P.; Pereyra, R.; Barone, L.J.; Barrionuevo, F.M.; Mansilla, F.C.; Turco, C.S.; Capozzo, A.V. Interferon Lambda Protects Cattle against Bovine Viral Diarrhea Virus Infection. Vet. Immunol. Immunopathol. 2020, 230, 110145. [Google Scholar] [CrossRef] [Scilit]
- Ichihashi, T.; Asano, A.; Usui, T.; Takeuchi, T.; Watanabe, Y.; Yamano, Y. Antiviral and Antiproliferative Effects of Canine Interferon-Λ1. Vet. Immunol. Immunopathol. 2013, 156, 141–146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, D.-H.; Park, B.-J.; Ahn, H.-S.; Go, H.-J.; Kim, D.-Y.; Kim, J.-H.; Lee, J.-B.; Park, S.-Y.; Song, C.-S.; Lee, S.-W.; et al. Canine Interferon Lambda 3 Expressed Using an Adenoviral Vector Effectively Induces Antiviral Activity against Canine Influenza Virus. Virus Res. 2021, 296, 198342. [Google Scholar] [CrossRef] [Scilit]
- Fan, W.; Xu, L.; Ren, L.; Qu, H.; Li, J.; Liang, J.; Liu, W.; Yang, L.; Luo, T. Functional Characterization of Canine Interferon-Lambda. J. Interferon Cytokine Res. 2014, 34, 848–857. [Google Scholar] [CrossRef] [Scilit]
- Hubert, M.; Gobbini, E.; Couillault, C.; Manh, T.-P.V.; Doffin, A.-C.; Berthet, J.; Rodriguez, C.; Ollion, V.; Kielbassa, J.; Sajous, C.; et al. IFN-III Is Selectively Produced by CDC1 and Predicts Good Clinical Outcome in Breast Cancer. Sci. Immunol. 2020, 5. [Google Scholar] [CrossRef] [Scilit]
- Finotti, G.; Tamassia, N.; Cassatella, M.A. Interferon-Λs and Plasmacytoid Dendritic Cells: A Close Relationship. Front. Immunol. 2017, 8. [Google Scholar] [CrossRef] [Scilit]
- Israelow, B.; Narbus, C.M.; Sourisseau, M.; Evans, M.J. HepG2 Cells Mount an Effective Antiviral Interferon-Lambda Based Innate Immune Response to Hepatitis C Virus Infection. Hepatology 2014, 60, 1170–1179. [Google Scholar] [CrossRef] [Scilit]
- Swider, A.; Siegel, R.; Eskdale, J.; Gallagher, G. Regulation of Interferon Lambda-1 (IFNL1/IFN-Λ1/IL-29) Expression in Human Colon Epithelial Cells. Cytokine 2014, 65, 17–23. [Google Scholar] [CrossRef] [Scilit]
- Rodríguez Stewart, R.M.; Berry, J.T.L.; Berger, A.K.; Yoon, S.B.; Hirsch, A.L.; Guberman, J.A.; Patel, N.B.; Tharp, G.K.; Bosinger, S.E.; Mainou, B.A. Enhanced Killing of Triple-Negative Breast Cancer Cells by Reassortant Reovirus and Topoisomerase Inhibitors. J. Virol. 2019, 93, e01411-19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lasfar, A.; Zloza, A.; Silk, A.W.; Lee, L.Y.; Cohen-Solal, K.A. Interferon Lambda: Toward a Dual Role in Cancer. J. Interferon Cytokine Res. 2018, 39, 22–29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lasfar, A.; Abushahba, W.; Balan, M.; Cohen-Solal, K.A. Interferon Lambda: A New Sword in Cancer Immunotherapy. Clin. Dev. Immunol. 2011, 2011, 1–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Novak, A.J.; Grote, D.M.; Ziesmer, S.C.; Rajkumar, V.; Doyle, S.E.; Ansell, S.M. A Role for IFN-Λ1 in Multiple Myeloma B Cell Growth. Leukemia 2008, 22, 2240–2246. [Google Scholar] [CrossRef] [Scilit]
- Lee, S.-J.; Lee, E.-J.; Kim, S.-K.; Jeong, P.; Cho, Y.-H.; Yun, S.J.; Kim, S.; Kim, G.-Y.; Choi, Y.H.; Cha, E.-J.; et al. Identification of Pro-Inflammatory Cytokines Associated with Muscle Invasive Bladder Cancer; The Roles of IL-5, IL-20, and IL-28A. PLoS ONE 2012, 7, e40267. [Google Scholar] [CrossRef] [Scilit]
- Lee, S.-J.; Lim, J.-H.; Choi, Y.H.; Kim, W.-J.; Moon, S.-K. Interleukin-28A Triggers Wound Healing Migration of Bladder Cancer Cells via NF-ΚB-Mediated MMP-9 Expression Inducing the MAPK Pathway. Cell. Signal. 2012, 24, 1734–1742. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pingwara, R.; Witt-Jurkowska, K.; Ulewicz, K.; Mucha, J.; Tonecka, K.; Pilch, Z.; Taciak, B.; Zabielska-Koczywas, K.; Mori, M.; Berardozzi, S.; et al. Interferon Lambda 2 Promotes Mammary Tumor Metastasis via Angiogenesis Extension and Stimulation of Cancer Cell Migration. J. Physiol. Pharmacol. 2017, 68, 573–583. [Google Scholar] [PubMed]
- Aresu, L.; Giantin, M.; Morello, E.; Vascellari, M.; Castagnaro, M.; Lopparelli, R.; Zancanella, V.; Granato, A.; Garbisa, S.; Aricò, A.; et al. Matrix Metalloproteinases and Their Inhibitors in Canine Mammary Tumors. BMC Vet. Res. 2011, 7, 33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Klingemann, H. Immunotherapy for Dogs: Running Behind Humans. Front. Immunol. 2018, 9, 133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zmigrodzka, M.; Rzepecka, A.; Krzyzowska, M.; Witkowska-Pilaszewicz, O.; Cywinska, A.; Winnicka, A. The Cyclooxygenase-2/Prostaglandin E2 Pathway and Its Role in the Pathogenesis of Human and Dog Hematological Malignancies. J. Physiol. Pharmacol. 2018, 69. [Google Scholar] [CrossRef] [Scilit]
- Bujak, J.K.; Pingwara, R.; Nelson, M.H.; Majchrzak, K. Adoptive Cell Transfer: New Perspective Treatment in Veterinary Oncology. Acta Vet. Scand. 2018, 60, 60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Berraondo, P.; Sanmamed, M.F.; Ochoa, M.C.; Etxeberria, I.; Aznar, M.A.; Pérez-Gracia, J.L.; Rodríguez-Ruiz, M.E.; Ponz-Sarvise, M.; Castañón, E.; Melero, I. Cytokines in Clinical Cancer Immunotherapy. Br. J. Cancer 2019, 120, 6–15. [Google Scholar] [CrossRef] [Scilit]
- Borden, E.C. Interferons α and β in Cancer: Therapeutic Opportunities from New Insights. Nat. Rev. Drug Discov. 2019, 18, 219–234. [Google Scholar] [CrossRef] [Scilit]
- Thul, P.J.; Åkesson, L.; Wiking, M.; Mahdessian, D.; Geladaki, A.; Ait Blal, H.; Alm, T.; Asplund, A.; Björk, L.; Breckels, L.M.; et al. A Subcellular Map of the Human Proteome. Science 2017, 356, eaal3321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Uhlen, M.; Zhang, C.; Lee, S.; Sjöstedt, E.; Fagerberg, L.; Bidkhori, G.; Benfeitas, R.; Arif, M.; Liu, Z.; Edfors, F.; et al. A Pathology Atlas of the Human Cancer Transcriptome. Science 2017, 357, eaan2507. [Google Scholar] [CrossRef] [Scilit]
- Rajakylä, K.; Krishnan, R.; Tojkander, S. Analysis of Contractility and Invasion Potential of Two Canine Mammary Tumor Cell Lines. Front. Vet. Sci. 2017, 4, 149. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maycotte, P.; Gearheart, C.M.; Barnard, R.; Aryal, S.; Mulcahy Levy, J.M.; Fosmire, S.P.; Hansen, R.J.; Morgan, M.J.; Porter, C.C.; Gustafson, D.L.; et al. STAT3-Mediated Autophagy Dependence Identifies Subtypes of Breast Cancer Where Autophagy Inhibition Can Be Efficacious. Cancer Res. 2014, 74, 2579–2590. [Google Scholar] [CrossRef] [Scilit]
- Avalle, L.; Pensa, S.; Regis, G.; Novelli, F.; Poli, V. STAT1 and STAT3 in Tumorigenesis: A Matter of Balance. JAK-STAT 2012, 1, 65–72. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Furth, P.A. STAT Signaling in Different Breast Cancer Sub-Types. Mol. Cell. Endocrinol. 2014, 382, 612–615. [Google Scholar] [CrossRef] [Scilit]
- Król, M.; Pawłowski, K.M.; Dolka, I.; Musielak, O.; Majchrzak, K.; Mucha, J.; Motyl, T. Density of Gr1-Positive Myeloid Precursor Cells, p-STAT3 Expression and Gene Expression Pattern in Canine Mammary Cancer Metastasis. Vet. Res. Commun. 2011, 35, 409–423. [Google Scholar] [CrossRef] [Scilit]
- Lasfar, A.; Gogas, H.; Zloza, A.; Kaufman, H.L.; Kirkwood, J.M. IFN-λ Cancer Immunotherapy: New Kid on the Block. Immunotherapy 2016, 8, 877–888. [Google Scholar] [CrossRef] [Scilit]
- Gao, D.; Yu, X.; Zhang, B.; Kong, M.; Fang, Y.; Cai, Y.; Zhu, C.; Zhao, J.; Li, J. Role of Autophagy in Inhibiting the Proliferation of A549 Cells by Type III Interferon. Cell Biol. Int. 2019, 43, 605–612. [Google Scholar] [CrossRef] [Scilit]
- Gao, D.; Zhao, J.; Li, X.; Xia, Y.; Cai, Y.; Pan, J.; Zhou, H.; Fang, Y.; Zhang, S.; Wen, H. Interferon-Λ1 Suppresses Invasion and Enhances Autophagy in Human Osteosarcoma Cell. Int. J. Clin. Exp. Med. 2015, 8, 14999–15004. [Google Scholar]
- Mulcahy Levy, J.M.; Thorburn, A. Autophagy in Cancer: Moving from Understanding Mechanism to Improving Therapy Responses in Patients. Cell Death Differ. 2020, 27, 843–857. [Google Scholar] [CrossRef] [Scilit]
- García-Macia, M.; Santos-Ledo, A.; Caballero, B.; Rubio-González, A.; de Luxán-Delgado, B.; Potes, Y.; Rodríguez-González, S.M.; Boga, J.A.; Coto-Montes, A. Selective Autophagy, Lipophagy and Mitophagy, in the Harderian Gland along the Oestrous Cycle: A Potential Retrieval Effect of Melatonin. Sci. Rep. 2019, 9, 18597. [Google Scholar] [CrossRef] [Scilit]
- Rabinowitz, J.D.; White, E. Autophagy and Metabolism. Science 2010, 330, 1344–1348. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, D.; Sanin, D.E.; Everts, B.; Chen, Q.; Qiu, J.; Buck, M.D.; Patterson, A.; Smith, A.M.; Chang, C.-H.; Liu, Z.; et al. Type 1 Interferons Induce Changes in Core Metabolism That Are Critical for Immune Function. Immunity 2016, 44, 1325–1336. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, F.; Zhang, S.; Jeon, R.; Vuckovic, I.; Jiang, X.; Lerman, A.; Folmes, C.D.; Dzeja, P.D.; Herrmann, J. Interferon Gamma Induces Reversible Metabolic Reprogramming of M1 Macrophages to Sustain Cell Viability and Pro-Inflammatory Activity. EBioMedicine 2018, 30, 303–316. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, Z.; Hamming, O.J.; Ank, N.; Paludan, S.R.; Nielsen, A.L.; Hartmann, R. Type III Interferon (IFN) Induces a Type I IFN-Like Response in a Restricted Subset of Cells through Signaling Pathways Involving Both the Jak-STAT Pathway and the Mitogen-Activated Protein Kinases. J. Virol. 2007, 81, 7749–7758. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guenterberg, K.D.; Grignol, V.P.; Raig, E.T.; Zimmerer, J.M.; Chan, A.N.; Blaskovits, F.M.; Young, G.S.; Nuovo, G.J.; Mundy, B.L.; Lesinski, G.B.; et al. Interleukin-29 Binds to Melanoma Cells Inducing Jak-STAT Signal Transduction and Apoptosis. Mol. Cancer Ther. 2010, 9, 510–520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dien, J.; Amin, H.M.; Chiu, N.; Wong, W.; Frantz, C.; Chiu, B.; Mackey, J.R.; Lai, R. Signal Transducers and Activators of Transcription-3 Up-Regulates Tissue Inhibitor of Metalloproteinase-1 Expression and Decreases Invasiveness of Breast Cancer. Am. J. Pathol. 2006, 169, 633–642. [Google Scholar] [CrossRef] [Scilit]
- Zhang, F.; Wang, Z.; Fan, Y.; Xu, Q.; Ji, W.; Tian, R.; Niu, R. Elevated STAT3 Signaling-Mediated Upregulation of MMP-2/9 Confers Enhanced Invasion Ability in Multidrug-Resistant Breast Cancer Cells. Int. J. Mol. Sci. 2015, 16, 24772–24790. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Gene Group | Gene | Sequence |
|---|---|---|
| Interferon-stimulated Genes | OAS-1 | F: ATCTCCTGCCAGACACACAG |
| R: GTGAAGCAGGTGGAGAACTC | ||
| ISG-15 | F: TCTGTGCCCCTGGAGGACTTGA | |
| R: TGCTGCTTCAGCTCTGATGCCA | ||
| MX-1 | F: GAATCCTGTACCCAATCATGTG | |
| R: TACCTTCTCCTCATATTGGCT | ||
| Matrix metalloproteinases | MMP-2 | F: 5′ GGGACCACGGAAGACTATGA 3′ |
| R: 5′ ATAGTGGACATGGCGGTCTC 3′ | ||
| MMP-9 | F: TGAGAACTAATCTCACTGACAAGCA | |
| R: GCTCGGCCACTTGAGTGTA | ||
| MMP-13 | F: CTCTTCTTCTCGGGAAACCA | |
| R: GCCTGGGGTAGTCTTTATCCA | ||
| Matrix metalloproteinases inhibitors | TIMP-1 | F: CAGGGCCTGTACCTGTGC |
| R: CCTGATGACGATTTGGGAGT | ||
| TIMP-2 | F: ATGAGATCAAGCAGATAAAGATGTTC | |
| R: GGAGGAAGGAGCCGTGTAG | ||
| TIMP-3 | F: TGCTGACAGGCCGCGT | |
| R: GCAGTTACAGCCCAGGTGA | ||
| Housekeeping gene | RPS19 | F: GTTCTCATCGTAGGGAGCAAG |
| R: CCTTCCTCAAAAAGTCTGGG |
| Target Protein | Host | Dilution | Manufacturer Catalog Number |
|---|---|---|---|
| IL-28RA | rabbit | 1:350 | Abexxa abx322648 |
| IL-10Rb | rabbit | 1:150 | Abexxa abx103170 |
| phospho-STAT1 | rabbit | 1:1000 | Biorbyt orb214616 |
| phospho-STAT3 | rabbit | 1:1000 | Biorbyt orb224010 |
| phospho-Akt | rabbit | 1:1000 | Cell Signaling Technology #9271 |
| Akt | rabbit | 1:1000 | Cell Signaling Technology #9272 |
| phospho-ERK1/2 | rabbit | 1:1000 | Cell Signaling Technology #4370 |
| ERK1/2 | rabbit | 1:1000 | Cell Signaling Technology #4695 |
| β-actin | mouse | 1:1000 | Santa Cruz Biotechnology sc-47778 |
| Lamin B | goat | 1:1000 | Santa Cruz Biotechnology sc-6216 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pingwara, R.; Kosmala, D.; Woźniak, N.; Orzechowski, A.; Mucha, J. IFN-λ Modulates the Migratory Capacity of Canine Mammary Tumor Cells via Regulation of the Expression of Matrix Metalloproteinases and Their Inhibitors. Cells 2021, 10, 999. https://doi.org/10.3390/cells10050999
Pingwara R, Kosmala D, Woźniak N, Orzechowski A, Mucha J. IFN-λ Modulates the Migratory Capacity of Canine Mammary Tumor Cells via Regulation of the Expression of Matrix Metalloproteinases and Their Inhibitors. Cells. 2021; 10(5):999. https://doi.org/10.3390/cells10050999
Chicago/Turabian StylePingwara, Rafał, Daria Kosmala, Natalia Woźniak, Arkadiusz Orzechowski, and Joanna Mucha. 2021. "IFN-λ Modulates the Migratory Capacity of Canine Mammary Tumor Cells via Regulation of the Expression of Matrix Metalloproteinases and Their Inhibitors" Cells 10, no. 5: 999. https://doi.org/10.3390/cells10050999
APA StylePingwara, R., Kosmala, D., Woźniak, N., Orzechowski, A., & Mucha, J. (2021). IFN-λ Modulates the Migratory Capacity of Canine Mammary Tumor Cells via Regulation of the Expression of Matrix Metalloproteinases and Their Inhibitors. Cells, 10(5), 999. https://doi.org/10.3390/cells10050999

