Salicylic Acid Accumulation Controlled by LSD1 Is Essential in Triggering Cell Death in Response to Abiotic Stress
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material and Growth Conditions
2.2. Ultraviolet Irradiation Application
2.3. Relative Electrolyte Leakage Measurement
2.4. Trypan Blue Staining
2.5. RNA Isolation, cDNA Synthesis and qPCR Analysis
2.6. Measurement of SA and Hydrogen Peroxide (H2O2) Content and Ascorbate Peroxidase (APX) Activity
3. Results
3.1. Mutation in ICS1 and Expression of Bacterial Nahg Results in Lower Accumulation of SA in Lsd1 Mutant Background
3.2. Lower Foliar SA Level Mitigates the Lsd1-Specific Cell Death Phenotype
3.3. Deregulated SA Synthesis or SA Decomposition Leads to Alterations in PR-Genes Expression
3.4. Deregulation in the SA Synthesis or Metabolism Results in Changes in the Antioxidant System
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Karpiński, S.; Szechyńska-Hebda, M.; Wituszyńska, W.; Burdiak, P. Light Acclimation, Retrograde Signalling, Cell Death and Immune Defences in Plants. Plant Cell Environ. 2013, 36, 736–744. [Google Scholar] [CrossRef]
- Mühlenbock, P.; Szechynska-Hebda, M.; Plaszczyca, M.; Baudo, M.; Mateo, A.; Mullineaux, P.M.; Parker, J.E.; Karpinska, B.; Karpinski, S. Chloroplast Signaling and LESION SIMULATING DISEASE1 Regulate Crosstalk between Light Acclimation and Immunity in Arabidopsis. Plant Cell 2008, 20, 2339–2356. [Google Scholar] [CrossRef]
- Mühlenbock, P.; Plaszczyca, M.; Plaszczyca, M.; Mellerowicz, E.; Karpinski, S. Lysigenous Aerenchyma Formation in Arabidopsis Is Controlled by LESION SIMULATING DISEASE1. Plant Cell 2007, 19, 3819–3830. [Google Scholar] [CrossRef]
- Wituszyńska, W.; Ślesak, I.; Vanderauwera, S.; Szechyńska-Hebda, M.; Kornaś, A.; Kelen, K.V.D.; Mühlenbock, P.; Karpińska, B.; Maćkowski, S.; Breusegem, F.V.; et al. LESION SIMULATING DISEASE1, ENHANCED DISEASE SUSCEPTIBILITY1, and PHYTOALEXIN DEFICIENT4 Conditionally Regulate Cellular Signaling Homeostasis, Photosynthesis, Water Use Efficiency, and Seed Yield in Arabidopsis. Plant Physiol. 2013, 161, 1795–1805. [Google Scholar] [CrossRef]
- Bernacki, M.J.; Czarnocka, W.; Rusaczonek, A.; Witoń, D.; Kęska, S.; Czyż, J.; Szechyńska-Hebda, M.; Karpiński, S. LSD1, EDS1 and PAD4-Dependent Conditional Correlation among Salicylic Acid, Hydrogen Peroxide, Water Use Efficiency, and Seed Yield in Arabidopsis Thaliana. Physiol. Plant. 2018. [Google Scholar] [CrossRef]
- Wituszynska, W.; Karpinski, S. Programmed Cell Death as a Response to High Light, UV and Drought Stress in Plants. In Abiotic Stress—Plant Responses and Applications in Agriculture; Vahdati, K., Ed.; InTech: London, UK, 2013; ISBN 978-953-51-1024-8. [Google Scholar]
- Fuchs, Y.; Steller, H. Live to Die Another Way: Modes of Programmed Cell Death and the Signals Emanating from Dying Cells. Nat. Rev. Mol. Cell Biol. 2015, 16, 329–344. [Google Scholar] [CrossRef]
- Elmore, S. Apoptosis: A Review of Programmed Cell Death. Toxicol. Pathol. 2007, 35, 495–516. [Google Scholar] [CrossRef] [PubMed]
- Sychta, K.; Słomka, A.; Kuta, E. Insights into Plant Programmed Cell Death Induced by Heavy Metals-Discovering a Terra Incognita. Cells 2021, 10, 65. [Google Scholar] [CrossRef]
- Czarnocka, W.; Karpiński, S. Friend or Foe? Reactive Oxygen Species Production, Scavenging and Signaling in Plant Response to Environmental Stresses. Free Radic. Biol. Med. 2018, 122, 4–20. [Google Scholar] [CrossRef]
- van Doorn, W.G.; Woltering, E.J. Many Ways to Exit? Cell Death Categories in Plants. Trends Plant Sci. 2005, 10, 117–122. [Google Scholar] [CrossRef] [PubMed]
- Spoel, S.H.; Dong, X. How Do Plants Achieve Immunity? Defence without Specialized Immune Cells. Nat. Rev. Immunol. 2012, 12, 89–100. [Google Scholar] [CrossRef] [PubMed]
- Szechyńska-Hebda, M.; Kruk, J.; Górecka, M.; Karpińska, B.; Karpiński, S. Evidence for Light Wavelength-Specific Photoelectrophysiological Signaling and Memory of Excess Light Episodes in Arabidopsis. Plant Cell 2010, 22, 2201–2218. [Google Scholar] [CrossRef] [PubMed]
- Górecka, M.; Lewandowska, M.; Dąbrowska-Bronk, J.; Białasek, M.; Barczak-Brzyżek, A.; Kulasek, M.; Mielecki, J.; Kozłowska-Makulska, A.; Gawroński, P.; Karpiński, S. Photosystem II 22kDa Protein Level—A Prerequisite for Excess Light-Inducible Memory, Cross-Tolerance to UV-C and Regulation of Electrical Signalling. Plant Cell Environ. 2020, 43, 649–661. [Google Scholar] [CrossRef]
- Dietrich, R.A.; Richberg, M.H.; Schmidt, R.; Dean, C.; Dangl, J.L. A Novel Zinc Finger Protein Is Encoded by the Arabidopsis LSD1 Gene and Functions as a Negative Regulator of Plant Cell Death. Cell 1997, 88, 685–694. [Google Scholar] [CrossRef]
- Czarnocka, W.; Van Der Kelen, K.; Willems, P.; Szechyńska-Hebda, M.; Shahnejat-Bushehri, S.; Balazadeh, S.; Rusaczonek, A.; Mueller-Roeber, B.; Van Breusegem, F.; Karpiński, S. The Dual Role of LESION SIMULATING DISEASE 1 as a Condition-Dependent Scaffold Protein and Transcription Regulator. Plant Cell Environ. 2017, 40, 2644–2662. [Google Scholar] [CrossRef] [PubMed]
- Rustérucci, C.; Aviv, D.H.; Holt, B.F.; Dangl, J.L.; Parker, J.E. The Disease Resistance Signaling Components EDS1 and PAD4 Are Essential Regulators of the Cell Death Pathway Controlled by LSD1 in Arabidopsis. Plant Cell 2001, 13, 2211–2224. [Google Scholar] [CrossRef]
- Chai, T.; Zhou, J.; Liu, J.; Xing, D. LSD1 and HY5 Antagonistically Regulate Red Light Induced-Programmed Cell Death in Arabidopsis. Front Plant Sci. 2015, 6. [Google Scholar] [CrossRef]
- Huang, X.; Li, Y.; Zhang, X.; Zuo, J.; Yang, S. The Arabidopsis LSD1 Gene Plays an Important Role in the Regulation of Low Temperature-Dependent Cell Death. New Phytol. 2010, 187, 301–312. [Google Scholar] [CrossRef] [PubMed]
- Feys, B.J.; Moisan, L.J.; Newman, M.-A.; Parker, J.E. Direct Interaction between the Arabidopsis Disease Resistance Signaling Proteins, EDS1 and PAD4. EMBO J. 2001, 20, 5400–5411. [Google Scholar] [CrossRef]
- Shah, J. The Salicylic Acid Loop in Plant Defense. Curr. Opin. Plant Biol. 2003, 6, 365–371. [Google Scholar] [CrossRef]
- Wiermer, M.; Feys, B.J.; Parker, J.E. Plant Immunity: The EDS1 Regulatory Node. Curr. Opin. Plant Biol. 2005, 8, 383–389. [Google Scholar] [CrossRef]
- Vlot, A.C.; Dempsey, D.A.; Klessig, D.F. Salicylic Acid, a Multifaceted Hormone to Combat Disease. Annu. Rev. Phytopathol. 2009, 47, 177–206. [Google Scholar] [CrossRef]
- Wildermuth, M.C.; Dewdney, J.; Wu, G.; Ausubel, F.M. Isochorismate Synthase Is Required to Synthesize Salicylic Acid for Plant Defence. Nature 2001, 414, 562–565. [Google Scholar] [CrossRef]
- Duan, C.; Yu, J.; Bai, J.; Zhu, Z.; Wang, X. Induced Defense Responses in Rice Plants against Small Brown Planthopper Infestation. Crop J. 2014, 2, 55–62. [Google Scholar] [CrossRef]
- Lefevere, H.; Bauters, L.; Gheysen, G. Salicylic Acid Biosynthesis in Plants. Front Plant Sci 2020, 11. [Google Scholar] [CrossRef]
- Abreu, M.E.; Munné-Bosch, S. Salicylic Acid Deficiency in NahG Transgenic Lines and Sid2 Mutants Increases Seed Yield in the Annual Plant Arabidopsis Thaliana. J. Exp. Bot. 2009, 60, 1261–1271. [Google Scholar] [CrossRef] [PubMed]
- Hao, Q.; Wang, W.; Han, X.; Wu, J.; Lyu, B.; Chen, F.; Caplan, A.; Li, C.; Wu, J.; Wang, W.; et al. Isochorismate-Based Salicylic Acid Biosynthesis Confers Basal Resistance to Fusarium Graminearum in Barley. Mol. Plant Pathol. 2018. [Google Scholar] [CrossRef]
- Catinot, J.; Buchala, A.; Abou-Mansour, E.; Métraux, J.-P. Salicylic Acid Production in Response to Biotic and Abiotic Stress Depends on Isochorismate in Nicotiana Benthamiana. FEBS Lett. 2008, 582, 473–478. [Google Scholar] [CrossRef]
- Mercado-Blanco, J.; van der Drift, K.M.G.M.; Olsson, P.E.; Thomas-Oates, J.E.; van Loon, L.C.; Bakker, P.A.H.M. Analysis of the PmsCEAB Gene Cluster Involved in Biosynthesis of Salicylic Acid and the Siderophore Pseudomonine in the Biocontrol Strain Pseudomonas Fluorescens WCS374. J. Bacteriol. 2001, 183, 1909–1920. [Google Scholar] [CrossRef]
- Torrens-Spence, M.P.; Bobokalonova, A.; Carballo, V.; Glinkerman, C.M.; Pluskal, T.; Shen, A.; Weng, J.-K. PBS3 and EPS1 Complete Salicylic Acid Biosynthesis from Isochorismate in Arabidopsis. Mol. Plant 2019, 12, 1577–1586. [Google Scholar] [CrossRef]
- Rekhter, D.; Lüdke, D.; Ding, Y.; Feussner, K.; Zienkiewicz, K.; Lipka, V.; Wiermer, M.; Zhang, Y.; Feussner, I. Isochorismate-Derived Biosynthesis of the Plant Stress Hormone Salicylic Acid. Science 2019, 365, 498–502. [Google Scholar] [CrossRef]
- Nawrath, C.; Métraux, J.P. Salicylic Acid Induction-Deficient Mutants of Arabidopsis Express PR-2 and PR-5 and Accumulate High Levels of Camalexin after Pathogen Inoculation. Plant Cell 1999, 11, 1393–1404. [Google Scholar] [CrossRef]
- Yokoo, S.; Inoue, S.; Suzuki, N.; Amakawa, N.; Matsui, H.; Nakagami, H.; Takahashi, A.; Arai, R.; Katou, S. Comparative Analysis of Plant Isochorismate Synthases Reveals Structural Mechanisms Underlying Their Distinct Biochemical Properties. Biosci. Rep. 2018, 38. [Google Scholar] [CrossRef]
- Garcion, C.; Lohmann, A.; Lamodière, E.; Catinot, J.; Buchala, A.; Doermann, P.; Métraux, J.-P. Characterization and Biological Function of the ISOCHORISMATE SYNTHASE2 Gene of Arabidopsis. Plant Physiol. 2008, 147, 1279–1287. [Google Scholar] [CrossRef]
- Morse, A.M.; Tschaplinski, T.J.; Dervinis, C.; Pijut, P.M.; Schmelz, E.A.; Day, W.; Davis, J.M. Salicylate and Catechol Levels Are Maintained in NahG Transgenic Poplar. Phytochemistry 2007, 68, 2043–2052. [Google Scholar] [CrossRef] [PubMed]
- Miura, K.; Okamoto, H.; Okuma, E.; Shiba, H.; Kamada, H.; Hasegawa, P.M.; Murata, Y. SIZ1 Deficiency Causes Reduced Stomatal Aperture and Enhanced Drought Tolerance via Controlling Salicylic Acid-Induced Accumulation of Reactive Oxygen Species in Arabidopsis. Plant J. 2013, 73, 91–104. [Google Scholar] [CrossRef] [PubMed]
- Gawroński, P.; Witoń, D.; Vashutina, K.; Bederska, M.; Betliński, B.; Rusaczonek, A.; Karpiński, S. Mitogen-Activated Protein Kinase 4 Is a Salicylic Acid-Independent Regulator of Growth but Not of Photosynthesis in Arabidopsis. Mol. Plant 2014, 7, 1151–1166. [Google Scholar] [CrossRef]
- Devadas, S.K.; Raina, R. Preexisting Systemic Acquired Resistance Suppresses Hypersensitive Response-Associated Cell Death in Arabidopsishrl1 Mutant. Plant Physiol. 2002, 128, 1234–1244. [Google Scholar] [CrossRef] [PubMed]
- Nawrath, C.; Heck, S.; Parinthawong, N.; Métraux, J.-P. EDS5, an Essential Component of Salicylic Acid–Dependent Signaling for Disease Resistance in Arabidopsis, Is a Member of the MATE Transporter Family. Plant Cell 2002, 14, 275–286. [Google Scholar] [CrossRef]
- Radojičić, A.; Li, X.; Zhang, Y. Salicylic Acid: A Double-Edged Sword for Programed Cell Death in Plants. Front. Plant Sci. 2018, 9. [Google Scholar] [CrossRef]
- Wituszyńska, W.; Szechyńska-Hebda, M.; Sobczak, M.; Rusaczonek, A.; Kozłowska-Makulska, A.; Witoń, D.; Karpiński, S. Lesion Simulating Disease 1 and Enhanced Disease Susceptibility 1 Differentially Regulate UV-C-Induced Photooxidative Stress Signalling and Programmed Cell Death in Arabidopsis Thaliana. Plant Cell Environ. 2015, 38, 315–330. [Google Scholar] [CrossRef]
- Mateo, A.; Mühlenbock, P.; Rustérucci, C.; Chang, C.C.-C.; Miszalski, Z.; Karpinska, B.; Parker, J.E.; Mullineaux, P.M.; Karpinski, S. LESION SIMULATING DISEASE 1 Is Required for Acclimation to Conditions That Promote Excess Excitation Energy. Plant Physiol. 2004, 136, 2818–2830. [Google Scholar] [CrossRef] [PubMed]
- Friedrich, L.; Vernooij, B.; Gaffney, T.; Morse, A.; Ryals, J. Characterization of Tobacco Plants Expressing a Bacterial Salicylate Hydroxylase Gene. Plant Mol. Biol. 1995, 29, 959–968. [Google Scholar] [CrossRef] [PubMed]
- Witoń, D.; Gawroński, P.; Czarnocka, W.; Ślesak, I.; Rusaczonek, A.; Sujkowska-Rybkowska, M.; Bernacki, M.J.; Dąbrowska-Bronk, J.; Tomsia, N.; Szechyńska-Hebda, M.; et al. Mitogen Activated Protein Kinase 4 (MPK4) Influences Growth in Populus tremula L. × tremuloides. Environ. Exp. Bot. 2016, 130, 189–205. [Google Scholar] [CrossRef]
- Rusaczonek, A.; Czarnocka, W.; Kacprzak, S.; Witoń, D.; Ślesak, I.; Szechyńska-Hebda, M.; Gawroński, P.; Karpiński, S. Role of Phytochromes A and B in the Regulation of Cell Death and Acclimatory Responses to UV Stress in Arabidopsis Thaliana. J. Exp. Bot. 2015, erv375. [Google Scholar] [CrossRef]
- Bernacki, M.J.; Czarnocka, W.; Witoń, D.; Rusaczonek, A.; Szechyńska-Hebda, M.; Ślesak, I.; Dąbrowska-Bronk, J.; Karpiński, S. ENHANCED DISEASE SUSCEPTIBILITY 1 (EDS1) Affects Development, Photosynthesis, and Hormonal Homeostasis in Hybrid Aspen (Populus tremula L. × P. tremuloides). J. Plant Physiol. 2018, 226, 91–102. [Google Scholar] [CrossRef]
- Bhar, A.; Chatterjee, M.; Gupta, S.; Das, S. Salicylic Acid Regulates Systemic Defense Signaling in Chickpea During Fusarium Oxysporum f. Sp. Ciceri Race 1 Infection. Plant Mol. Biol. Rep. 2018, 36, 162–175. [Google Scholar] [CrossRef]
- Delaney, T.P.; Uknes, S.; Vernooij, B.; Friedrich, L.; Weymann, K.; Negrotto, D.; Gaffney, T.; Gut-Rella, M.; Kessmann, H.; Ward, E.; et al. A Central Role of Salicylic Acid in Plant Disease Resistance. Science 1994, 266, 1247–1250. [Google Scholar] [CrossRef]
- Alvarez, M.E.; Pennell, R.I.; Meijer, P.J.; Ishikawa, A.; Dixon, R.A.; Lamb, C. Reactive Oxygen Intermediates Mediate a Systemic Signal Network in the Establishment of Plant Immunity. Cell 1998, 92, 773–784. [Google Scholar] [CrossRef]
- Czarnocka, W.; Fichman, Y.; Bernacki, M.; Różańska, E.; Sańko-Sawczenko, I.; Mittler, R.; Karpiński, S. FMO1 Is Involved in Excess Light Stress-Induced Signal Transduction and Cell Death Signaling. Cells 2020, 9, 2163. [Google Scholar] [CrossRef]
- Morris, K.; Mackerness, S.A.H.; Page, T.; John, C.F.; Murphy, A.M.; Carr, J.P.; Buchanan-Wollaston, V. Salicylic Acid Has a Role in Regulating Gene Expression during Leaf Senescence. Plant J. 2000, 23, 677–685. [Google Scholar] [CrossRef]
- Durner, J.; Klessig, D.F. Inhibition of Ascorbate Peroxidase by Salicylic Acid and 2,6-Dichloroisonicotinic Acid, Two Inducers of Plant Defense Responses. Proc. Natl. Acad. Sci. USA 1995, 92, 11312–11316. [Google Scholar] [CrossRef] [PubMed]
- Alvarez, M.E. Salicylic acid in the machinery of hypersensitive cell death and disease resistance. In Programmed Cell Death in Higher Plants; Lam, E., Fukuda, H., Greenberg, J., Eds.; Springer: Dordrecht, The Netherlands, 2000; pp. 185–198. ISBN 978-94-010-0934-8. [Google Scholar]
- Mateo, A.; Funck, D.; Mühlenbock, P.; Kular, B.; Mullineaux, P.M.; Karpinski, S. Controlled Levels of Salicylic Acid Are Required for Optimal Photosynthesis and Redox Homeostasis. J. Exp. Bot. 2006, 57, 1795–1807. [Google Scholar] [CrossRef]
- Karpinski, S.; Wingsle, G.; Karpinska, B.; Hällgren, J.-E. Redox Sensing of Photooxidative Stress and Acclimatory Mechanisms in Plants. In Regulation of Photosynthesis; Aro, E.-M., Andersson, B., Eds.; Advances in Photosynthesis and Respiration; Springer: Dordrecht, The Netherlands, 2001; pp. 469–486. ISBN 978-0-306-48148-2. [Google Scholar]
- Aviv, D.H.; Rustérucci, C.; Iii, B.F.H.; Dietrich, R.A.; Parker, J.E.; Dangl, J.L. Runaway Cell Death, but Not Basal Disease Resistance, in Lsd1 Is SA- and NIM1/NPR1-Dependent. Plant J. 2002, 29, 381–391. [Google Scholar] [CrossRef] [PubMed]
- Kalbina, I.; Li, S.; Kalbin, G.; Björn, L.O.; Strid, Å. Two Separate UV-B Radiation Wavelength Regions Control Expression of Different Molecular Markers in Arabidopsis Thaliana. Funct. Plant Biol. 2008, 35, 222–227. [Google Scholar] [CrossRef] [PubMed]
- Britt, A.B. Repair of DNA Damage Induced by Solar UV. Photosynth. Res. 2004, 81, 105–112. [Google Scholar] [CrossRef]
- Rusaczonek, A.; Czarnocka, W.; Willems, P.; Sujkowska-Rybkowska, M.; Van Breusegem, F.; Karpiński, S. Phototropin 1 and 2 Influence Photosynthesis, UV-C Induced Photooxidative Stress Responses, and Cell Death. Cells 2021, 10, 200. [Google Scholar] [CrossRef]
- Nawkar, G.M.; Maibam, P.; Park, J.H.; Sahi, V.P.; Lee, S.Y.; Kang, C.H. UV-Induced Cell Death in Plants. Int. J. Mol. Sci. 2013, 14, 1608–1628. [Google Scholar] [CrossRef]
- Dotto, M.; Casati, P. Developmental Reprogramming by UV-B Radiation in Plants. Plant Sci. 2017, 264, 96–101. [Google Scholar] [CrossRef]
- Morel, J.-B.; Dangl, J.L. The Hypersensitive Response and the Induction of Cell Death in Plants. Cell Death Differ. 1997, 4, 671–683. [Google Scholar] [CrossRef]
- Cui, H.; Gobbato, E.; Kracher, B.; Qiu, J.; Bautor, J.; Parker, J.E. A Core Function of EDS1 with PAD4 Is to Protect the Salicylic Acid Defense Sector in Arabidopsis Immunity. New Phytol. 2017, 213, 1802–1817. [Google Scholar] [CrossRef]
- Falk, A.; Feys, B.J.; Frost, L.N.; Jones, J.D.G.; Daniels, M.J.; Parker, J.E. EDS1, an Essential Component of R Gene-Mediated Disease Resistance in Arabidopsis Has Homology to Eukaryotic Lipases. Proc. Natl. Acad. Sci. USA 1999, 96, 3292–3297. [Google Scholar] [CrossRef] [PubMed]
- Zou, B.; Jia, Z.; Tian, S.; Wang, X.; Gou, Z.; Lü, B.; Dong, H. AtMYB44 Positively Modulates Disease Resistance to Pseudomonas Syringae through the Salicylic Acid Signalling Pathway in Arabidopsis. Funct. Plant Biol. 2013, 40, 304–313. [Google Scholar] [CrossRef] [PubMed]
- Bernacki, M.J.; Czarnocka, W.; Zaborowska, M.; Różańska, E.; Labudda, M.; Rusaczonek, A.; Witoń, D.; Karpiński, S. EDS1-Dependent Cell Death and the Antioxidant System in Arabidopsis Leaves Is Deregulated by the Mammalian Bax. Cells 2020, 9, 2454. [Google Scholar] [CrossRef]
- Reuber, T.L.; Plotnikova, J.M.; Dewdney, J.; Rogers, E.E.; Wood, W.; Ausubel, F.M. Correlation of Defense Gene Induction Defects with Powdery Mildew Susceptibility in Arabidopsis Enhanced Disease Susceptibility Mutants. Plant J. 1998, 16, 473–485. [Google Scholar] [CrossRef]
- Thibaud, M.-C.; Gineste, S.; Nussaume, L.; Robaglia, C. Sucrose Increases Pathogenesis-Related PR-2 Gene Expression in Arabidopsis Thaliana through an SA-Dependent but NPR1-Independent Signaling Pathway. Plant Physiol. Biochem. 2004, 42, 81–88. [Google Scholar] [CrossRef] [PubMed]
- Mullineaux, P.M.; Rausch, T. Glutathione, Photosynthesis and the Redox Regulation of Stress-Responsive Gene Expression. Photosynth Res. 2005, 86, 459–474. [Google Scholar] [CrossRef]
- Feys, B.J.; Wiermer, M.; Bhat, R.A.; Moisan, L.J.; Medina-Escobar, N.; Neu, C.; Cabral, A.; Parker, J.E. Arabidopsis SENESCENCE-ASSOCIATED GENE101 Stabilizes and Signals within an ENHANCED DISEASE SUSCEPTIBILITY1 Complex in Plant Innate Immunity. Plant Cell 2005, 17, 2601–2613. [Google Scholar] [CrossRef] [PubMed]
- Møller, I.M.; Sweetlove, L.J. ROS Signalling—Specificity Is Required. Trends Plant Sci. 2010, 15, 370–374. [Google Scholar] [CrossRef] [PubMed]
- Bailey-Serres, J.; Mittler, R. The Roles of Reactive Oxygen Species in Plant Cells. Plant Physiol. 2006, 141, 311. [Google Scholar] [CrossRef]
- Torres, M.A.; Jones, J.D.G.; Dangl, J.L. Pathogen-Induced, NADPH Oxidase–Derived Reactive Oxygen Intermediates Suppress Spread of Cell Death in Arabidopsis Thaliana. Nat. Genet. 2005, 37, 1130–1134. [Google Scholar] [CrossRef] [PubMed]
- Kim, C.; Apel, K. Singlet Oxygen-Mediated Signaling in Plants: Moving from Flu to Wild Type Reveals an Increasing Complexity. Photosynth Res. 2013, 116, 455–464. [Google Scholar] [CrossRef] [PubMed]
- Foyer, C.H.; Noctor, G. Redox Regulation in Photosynthetic Organisms: Signaling, Acclimation, and Practical Implications. Antioxid. Redox. Signal. 2009, 11, 861–905. [Google Scholar] [CrossRef]
- Mittler, R. Oxidative Stress, Antioxidants and Stress Tolerance. Trends Plant Sci. 2002, 7, 405–410. [Google Scholar] [CrossRef]
- Scherz-Shouval, R.; Elazar, Z. Regulation of Autophagy by ROS: Physiology and Pathology. Trends Biochem. Sci. 2011, 36, 30–38. [Google Scholar] [CrossRef] [PubMed]




| Forward | Forward Tm [°C] | Reverse | Reverse Tm [°C] | |
|---|---|---|---|---|
| nahG (PCR) | ACTCTGCCGCTACTCCCATA | 63.7 | CGAGCCCTAGGTACATCTGC | 63.7 | 
| sid2 (PCR) | TGTCTGCAGTGAAGCTTTGG | 64.2 | CGAAGAAATGAAGAGCTTGGA | 63.3 | 
| nahG (qPCR) | CACCGGGCGGATTTCAT | 67 | CCCGAATTGGGCGATACC | 61.1 | 
| 5-FCL (ref for qPCR) | GCAAACTCAATGAACATTTTGG | 63.1 | GATCGGTTCATCTGCTTGC | 63.5 | 
| PP2AA2 (ref for qPCR) | TAACGTGGCCAAAATGATGC | 65.6 | GTTCTCCACAACCGCTTGGT | 66.3 | 
| PR1 (qPCR) | TTCTTCCCTCGAAAGCTCAA | 63.9 | GCCTGGTTGTGAACCCTTAG | 63.4 | 
| PR2 (qPCR) | TCTCCCTTGCTCGTGAATCT | 63.9 | CGTGTCTCCCATGTAGCTGA | 64 | 
| PR5 (qPCR) | CGTACAGGCTGCAACTTTGA | 64 | CTTAGACCGCCACAGTCTCC | 63.8 | 
| Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. | 
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bernacki, M.J.; Rusaczonek, A.; Czarnocka, W.; Karpiński, S. Salicylic Acid Accumulation Controlled by LSD1 Is Essential in Triggering Cell Death in Response to Abiotic Stress. Cells 2021, 10, 962. https://doi.org/10.3390/cells10040962
Bernacki MJ, Rusaczonek A, Czarnocka W, Karpiński S. Salicylic Acid Accumulation Controlled by LSD1 Is Essential in Triggering Cell Death in Response to Abiotic Stress. Cells. 2021; 10(4):962. https://doi.org/10.3390/cells10040962
Chicago/Turabian StyleBernacki, Maciej Jerzy, Anna Rusaczonek, Weronika Czarnocka, and Stanisław Karpiński. 2021. "Salicylic Acid Accumulation Controlled by LSD1 Is Essential in Triggering Cell Death in Response to Abiotic Stress" Cells 10, no. 4: 962. https://doi.org/10.3390/cells10040962
APA StyleBernacki, M. J., Rusaczonek, A., Czarnocka, W., & Karpiński, S. (2021). Salicylic Acid Accumulation Controlled by LSD1 Is Essential in Triggering Cell Death in Response to Abiotic Stress. Cells, 10(4), 962. https://doi.org/10.3390/cells10040962
 
         
                                                




 
       