Screening of EMS-Induced Drought-Tolerant Sugarcane Mutants Employing Physiological, Molecular and Enzymatic Approaches
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Source and In Vitro Callus Regeneration
2.2. Measurement of Optimal EMS Concentration and Mutagenic Treatment
2.3. Measurement of Optimal In Vitro PEG-6000.Stimulated Osmotic Stress
2.4. Physiological Index Detection
2.4.1. Chlorophyll a
2.4.2. Leaf Chlorophyll Content
2.4.3. Photosynthetic Rate
2.5. DNA Isolation
2.6. SSR Marker PCR Amplification and CELL-1 Enzyme Digestion
3. Results
3.1. Effect of Various Concentrations of EMS on Sugarcane Calli Differentiation
3.2. Effect of Various Concentrations of PEG-6000-Stimulated Stress on Seedling Growth
3.3. Physiological Analysis
3.4. SSR Analysis
4. Discussion
5. Conclusions
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Gentile, A.; Ferreira, T.H.; Mattos, R.S.; Dias, L.I.; Hoshino, A.A.; Carneiro, M.S.; Souza, G.M.; Calsa, T.; Nogueira, R.M.; Endres, L.; et al. Effects of drought on the microtranscriptome of field-grown sugarcane plants. Planta 2013, 237, 783–798. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ferreira, T.H.S.; Tsunada, M.S.; Bassi, D.; Araújo, P.; Mattiello, L.; Guidelli, G.V.; Righetto, G.L.; Gonçalves, V.R.; Lakshmanan, P.; Menossi, M. Sugarcane Water Stress Tolerance Mechanisms and Its Implications on Developing Biotechnology Solutions. Front. Plant Sci. 2017, 8, 1077. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.-R.R.; Yang, L.-T.T. Sugarcane agriculture and sugar industry in China. Sugar Tech 2015, 17, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Guo, J.; Ling, H.; Wu, Q.; Xu, L.; Que, Y. The choice of reference genes for assessing gene expression in sugarcane under salinity and drought stresses. Sci. Rep. 2014, 4, 7042. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reis, R.R.; Andrade Dias Brito da Cunha, B.; Martins, P.K.; Martins, M.T.B.; Alekcevetch, J.C.; Chalfun-Júnior, A.Ô.; Andrade, A.C.; Ribeiro, A.P.; Qin, F.; Mizoi, J.; et al. Induced over-expression of AtDREB2A CA improves drought tolerance in sugarcane. Plant Sci. 2014, 221–222, 59–68. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ramesh, P. Effect of different levels of drought during the formative phase on growth parameters and its relationship with dry matter accumulation in sugarcane. J. Agron. Crop Sci. 2000, 185, 83–89. [Google Scholar] [CrossRef] [Scilit]
- Ribeiro, R.V.; MacHado, R.S.; MacHado, E.C.; MacHado, D.F.S.P.; Magalhães Filho, J.R.; Landell, M.G.A. Revealing drought-resistance and productive patterns in sugarcane genotypes by evaluating both physiological responses and stalk yield. Exp. Agric. 2013, 49, 212–224. [Google Scholar] [CrossRef] [Scilit]
- Sales, C.R.G.; Ribeiro, R.V.; Silveira, J.A.G.; Machado, E.C.; Martins, M.O.; Lagôa, A.M.M.A. Superoxide dismutase and ascorbate peroxidase improve the recovery of photosynthesis in sugarcane plants subjected to water deficit and low substrate temperature. Plant Physiol. Biochem. 2013, 73, 326–336. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, F.J.; Zhang, K.K.; Du, C.Z.; Li, J.; Xing, Y.X.; Yang, L.T.; Li, Y.R. Effect of Drought Stress on Anatomical Structure and Chloroplast Ultrastructure in Leaves of Sugarcane. Sugar Tech 2015, 17, 41–48. [Google Scholar] [CrossRef] [Scilit]
- Lopes, M.S.; Araus, J.L.; van Heerden, P.D.R.; Foyer, C.H. Enhancing drought tolerance in C4 crops. J. Exp. Bot. 2011, 62, 3135–3153. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tayyab, M.; Islam, W.; Khalil, F.; Ziqin, P.; Caifang, Z.; Arafat, Y.; Hui, L.; Rizwan, M.; Ahmad, K.; Waheed, S.; et al. Biochar: An efficient way to manage low water availability in plants. Appl. Ecol. Environ. Res. 2018, 16, 2565–2583. [Google Scholar] [CrossRef] [Scilit]
- Khalil, F.; Rauf, S.; Monneveux, P.; Anwar, S.; Iqbal, Z. Genetic analysis of proline concentration under osmotic stress in sunflower (Helianthus annuus L.). Breed. Sci. 2016, 66, 463–470. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rauf, S.; Al-Khayri, J.M.; Zaharieva, M.; Monneveux, P.; Khalil, F. Breeding strategies to enhance drought tolerance in crops. Adv. Plant Breed. Strateg. Agron. Abiot. Biot. Stress Traits 2016, 2, 397–445. [Google Scholar] [CrossRef] [Scilit]
- Masoabi, M.; Lloyd, J.; Kossmann, J.; van der Vyver, C. Ethyl Methanesulfonate Mutagenesis and In Vitro Polyethylene Glycol Selection for Drought Tolerance in Sugarcane (Saccharum spp.). Sugar Tech 2018, 20, 50–59. [Google Scholar] [CrossRef] [Scilit]
- Jankowicz-Cieslak, J.; Till, B.J. Chemical Mutagenesis of Seed and Vegetatively Propagated Plants Using EMS. Curr. Protoc. Plant Biol. 2016, 1, 617–635. [Google Scholar]
- WEI, C.L.; Chang-lian, W.E.I. Analysis and countermeasures of the degradation status of sugarcane variety ROC22 in Guangxi. J. South. Agric. 2012, 43, 2113–2117. [Google Scholar]
- Agarwal, P.; Jaiswal, V.; Kumar, S.; Balyan, H.S.; Gupta, P.K. Chromosome mapping of four novel mutants in bread wheat (Triticum aestivum L.). Acta Physiol. Plant. 2015, 37, 66. [Google Scholar] [CrossRef] [Scilit]
- Rastogi, J.; Siddhant, P.B.; Sharma, B.L. Somaclonal Variation: A new dimension for sugarcane improvement. GERF Bull. Biosci. 2015, 6, 5–10. [Google Scholar]
- Mallick, M.; Bharadwaj, C.; Srivastav, M.; Sharma, N.; Awasthi, O.P. Molecular characterization of Kinnow mandarin clones and mutants using cross genera SSR markers. Indian J. Biotechnol. 2017, 16, 244–249. [Google Scholar]
- Nybom, H.; Weising, K.; Rotter, B. DNA fingerprinting in botany: Past, present, future. Investig. Genet. 2014, 5, 1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ul Haq, S.; Kumar, P.; Singh, R.K.; Verma, K.S.; Bhatt, R.; Sharma, M.; Kachhwaha, S.; Kothari, S.L. Assessment of Functional EST-SSR Markers (Sugarcane) in Cross-Species Transferability, Genetic Diversity among Poaceae Plants, and Bulk Segregation Analysis. Genet. Res. Int. 2016, 2016, 7052323. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khanal, S.; Schwartz, B.M.; Kim, C.; Adhikari, J.; Rainville, L.K.; Auckland, S.A.; Paterson, A.H. Cross-taxon application of sugarcane EST-SSR to genetic diversity analysis of bermudagrass (Cynodon spp.). Genet. Resour. Crop Evol. 2017, 64, 2059–2070. [Google Scholar] [CrossRef] [Scilit]
- Szurman-Zubrzycka, M.; Chmielewska, B.; Gajewska, P.; Szarejko, I. Mutation detection by analysis of DNA heteroduplexes in TILLING populations of diploid species. In Biotechnologies for Plant Mutation Breeding: Protocols; Jankowicz-Cieslak, J., Tai, T., Kumlehn, J., Till, B., Eds.; Springer: Cham, Switzerland, 2016; pp. 281–303. ISBN 9783319450216. [Google Scholar]
- Murashige, T.; Skoog, F. A Revised Medium for Rapid Growth and Bio Assays with Tobacco Tissue Cultures. Physiol. Plant. 1962, 15, 473–497. [Google Scholar] [CrossRef] [Scilit]
- Van der Weele, C.M.; Spollen, W.G.; Sharp, R.E.; Baskin, T.I. Growth of Arabidopsis thaliana seedlings under water deficit studied by control of water potential in nutrient-agar media. J. Exp. Bot. 2000, 51, 1555–1562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maxwell, K.; Johnson, G.N. Chlorophyll fluorescence—A practical guide. J. Exp. Bot. 2000, 51, 659–668. [Google Scholar] [CrossRef] [PubMed]
- Silva, M.D.A.; Jifon, J.L.; Da Silva, J.A.G.; Sharma, V. Use of physiological parameters as fast tools to screen for drought tolerance in sugarcane. Braz. J. Plant Physiol. 2007, 19, 193–201. [Google Scholar] [CrossRef] [Scilit]
- Jamil, S.; Shahzad, R.; Talha, G.M.; Sakhawat, G.; Sajid-Ur-Rahman; Sultana, R.; Iqbal, M.Z. Optimization of Protocols for in Vitro Regeneration of Sugarcane (Saccharum officinarum). Int. J. Agron. 2017, 2017, 2089381. [Google Scholar] [CrossRef] [Scilit]
- Serrat, X.; Esteban, R.; Guibourt, N.; Moysset, L.; Nogués, S.; Lalanne, E. EMS mutagenesis in mature seed-derived rice calli as a new method for rapidly obtaining TILLING mutant populations. Plant Methods 2014, 10, 5. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ali, A.; Naz, S.; Alam, S.S.; Iqbal, J. In vitro induced mutation for screening of red rot (Colletotrichum falcatum) resistance in sugarcane (Saccharum officinarum). Pak. J. Bot. 2007, 39, 1979–1994. [Google Scholar]
- Kenganal, M.; Hanchinal, R.R.; Nadaf, H.L. Ethyl methanesulfonate (EMS) induced mutation and selection for salt tolerance in sugarcane in vitro. Indian J. Plant Physiol. 2008, 13, 405–410. [Google Scholar]
- Nikam, A.A.; Devarumath, R.M.; Shitole, M.G.; Ghole, V.S.; Tawar, P.N.; Suprasanna, P. Gamma radiation, in vitro selection for salt (NaCl) tolerance, and characterization of mutants in sugarcane (Saccharum officinarum L.). In Vitro Cell. Dev. Biol. Plant 2014, 50, 766–776. [Google Scholar] [CrossRef] [Scilit]
- Oloriz, M.I.; Gil, V.; Rojas, L.; Veitía, N.; Höfte, M.; Jiménez, E. Selection and characterisation of sugarcane mutants with improved resistance to brown rust obtained by induced mutation. Crop Pasture Sci. 2012, 62, 1037–1044. [Google Scholar] [CrossRef] [Scilit]
- Chaves, M.M.; Flexas, J.; Pinheiro, C. Photosynthesis under drought and salt stress: Regulation mechanisms from whole plant to cell. Ann. Bot. 2009, 103, 551–560. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koch, A.C.; Ramgareeb, S.; Rutherford, R.S.; Snyman, S.J.; Watt, M.P. An in vitro mutagenesis protocol for the production of sugarcane tolerant to the herbicide imazapyr. In Vitro Cell. Dev. Biol. Plant 2012, 48, 417–427. [Google Scholar] [CrossRef] [Scilit]
- De Almeida Silva, M.; Jifon, J.L.; Sharma, V.; da Silva, J.A.G.; Caputo, M.M.; Damaj, M.B.; Guimarães, E.R.; Ferro, M.I.T. Use of physiological parameters in screening drought tolerance in sugarcane genotypes. Sugar Tech 2011, 13, 191. [Google Scholar] [CrossRef] [Scilit]
- Da Graça, J.P.; Rodrigues, F.A.; Farias, J.R.B.; de Oliveira, M.C.N.; Hoffmann-Campo, C.B.; Zingaretti, S.M. Physiological parameters in sugarcane cultivars submitted to water deficit. Braz. J. Plant Physiol. 2010, 22, 189–197. [Google Scholar] [CrossRef] [Scilit]
- Mathobo, R.; Marais, D.; Steyn, J.M. The effect of drought stress on yield, leaf gaseous exchange and chlorophyll fluorescence of dry beans (Phaseolus vulgaris L.). Agric. Water Manag. 2017, 180, 118–125. [Google Scholar] [CrossRef] [Scilit]
- Dinh, T.H.; Watanabe, K.; Takaragawa, H.; Nakabaru, M.; Kawamitsu, Y. Photosynthetic response and nitrogen use efficiency of sugarcane under drought stress conditions with different nitrogen application levels. Plant Prod. Sci. 2017, 20, 412–422. [Google Scholar] [CrossRef] [Scilit]








| No. | SSR Name | Repeat Motif | Tm (°C) | F-Primer | R-Primer | Result |
|---|---|---|---|---|---|---|
| 1 | SMC336BS | (TG)23(AG)19 | 62 | ATTCTAGTGCCAATCCATCTCA | CATGCCAACTTCCAAACAGAC | 5 |
| 2 | SMC569CS | (TG)37 | 62 | GCGATGGTTCCTATGCAACTT | TTCGTGGCTGAGATTCACACTA | 0 |
| 3 | SMC31CUQ | (TC)10(AC)22 | 62 | CATGCCAACTTCCAATACAGACT | AGTGCCAATCCATCTCAGAGA | 5 |
| 4 | SMC334BS | (TG)36 | 60 | CAATTCTGACCGTGCAAAGAT | CGATGAGCTTGATTGCGAATG | 5 |
| 5 | Sep-17 | (CCT)9 | 60 | ACCCTGCTGGTCTCCTCC | ACGTTCGACGTCGTGTAGTG | 5 |
| 6 | Sep-23 | (AGA)9 | 60 | GTGTTCAGGCAGATGGTCCT | GTCGATGGCACCGATTTATT | 5 |
| 7 | Sep-59 | (CGG)9 | 60 | TTCCATTTACTCCTCCGTGC | CTCCCCCTCCTCGTACTTGT | 5 |
| 8 | Sep-6 | (GCA)5(ACA)13 | 60 | CAGCCCATTAACCAAGCAAT | GAAGCAGCTGTTGCTCACTG | 5 |
| 9 | Sep-70 | (GCG)8 | 60 | AACTCACCCAACAAAGCGAC | AGACGAAGAGCTCGTGGATG | |
| 10 | Sep-8 | (CT)17 | 60 | CTTGCTTCCCCTTTACTCCC | GAGGCGCCTTACTGTTCTTG | 5 |
| 11 | Sep-84 | (GGT)9 | 60 | AGAGACCGTAATGGTGACCG | ACCACCACCACCACCATACT | 5 |
| 12 | Sep-89 | (CGT)10 | 60 | AGCTCTGATTTTTGGGGGTT | GGAAGACAGTGGACGAGGTC | 5 |
| 13 | SMC286CS | (TG)43 | 58 | TCAAATGGGACCTTATTGGAG | TCCCTCGATCTCCGTTGTT | 5 |
| 14 | SMC119CG | (TTG)12 | 58 | TTCATCTCTAGCCTACCCCAA | AGCAGCCATTTACCCAGGA | 5 |
| 15 | mSSCIR43 | (GT)3(AT)2(GT)29 | 52 | ATTCAACGATTTTCACGAG | AACCTAGCAATTTACAAGAG | 0 |
| ROC22 | FN39 | ||||||
|---|---|---|---|---|---|---|---|
| Treatment Time (h) | Treatment Concentration (%) | Number of Germinated Calli | Relative Differentiation Rate (%) | Treatment Time (h) | Treatment Concentration (%) | Number of Germinated Calli | Relative Differentiation Rate (%) |
| 5 | 0 | 84 | 100 | 5 | 0 | 85 | 100 |
| 0.05 | 80 | 95.2 | 0.05 | 81 | 95.2 | ||
| 0.1 | 70 | 83.3 | 0.1 | 70 | 84.7 | ||
| 0.2 | 48 | 57.1 | 0.2 | 49 | 57.6 | ||
| 0.5 | 30 | 35.7 | 0.5 | 31 | 36.4 | ||
| 10 | 0 | 83 | 100 | 10 | 0 | 84 | 100 |
| 0.05 | 78 | 93.9 | 0.05 | 77 | 91.6 | ||
| 0.1 | 56 | 67.4 | 0.1 | 53 | 63.0 | ||
| 0.2 | 34 | 40.9 | 0.2 | 28 | 33.3 | ||
| 0.5 | 9 | 10.8 | 0.5 | 5 | 5.9 | ||
| 15 | 0 | 83 | 100 | 15 | 0 | 82 | 100 |
| 0.05 | 76 | 91.5 | 0.05 | 70 | 85.3 | ||
| 0.1 | 45 | 54.2 | 0.1 | 39 | 47.5 | ||
| 0.2 | 21 | 25.3 | 0.2 | 4 | 4.8 | ||
| 0.5 | 4 | 4.8 | 0.5 | 0 | 0 | ||
| 20 | 0 | 80 | 100 | 20 | 0 | 83 | 100 |
| 0.05 | 69 | 86.2 | 0.05 | 66 | 79.5 | ||
| 0.1 | 29 | 36.2 | 0.1 | 24 | 28.9 | ||
| 0.2 | 3 | 3.7 | 0.2 | 0 | 0 | ||
| 0.5 | 0 | 0 | 0.5 | 0 | 0 | ||
| 25 | 0 | 81 | 100 | 25 | 0 | 79 | 100 |
| 0.05 | 66 | 81.4 | 0.05 | 60 | 75.9 | ||
| 0.1 | 9 | 11.1 | 0.1 | 6 | 7.5 | ||
| 0.2 | 0 | 0 | 0.2 | 0 | 0 | ||
| 0.5 | 0 | 0 | 0.5 | 0 | 0 | ||
| Genotypes | Fv/Fm | Diff b/w Chl Content Before and After Trt | Photosynthetic Rate |
|---|---|---|---|
| ROC22 | 0.77 | 0.22 | 4.89 |
| MR22-1 | 0.75 | 0.15 | 3.88 |
| MR22-2 | 0.75 | 0.43 | 7.84 |
| MR22-3 | 0.72 | 0.16 | 5.05 |
| MR22-4 | 0.76 | −0.08 | 4.55 |
| MR22-5 | 0.74 | −0.22 | 2.45 |
| MR22-6 | 0.76 | 0.28 | 7.36 |
| MR22-7 | 0.78 | 0.27 | 0.95 |
| MR22-8 | 0.76 | 0.43 | 4.31 |
| MR22-9 | 0.78 | 0.13 | 2.16 |
| MR22-10 | 0.76 | −0.07 | 7.13 |
| MR22-11 | 0.77 | 0.26 | 0.52 |
| MR22-12 | 0.75 | 0.01 | 2.98 |
| MR22-13 | 0.76 | 0.61 | 4.05 |
| MR22-15 | 0.69 | −0.04 | 10.65 |
| MR22-17 | 0.75 | 0.19 | 2.39 |
| MR22-20 | 0.73 | −0.14 | 12.13 |
| MR22-25 | 0.74 | 0.04 | 7.70 |
| FN 39 | 0.77 | 0.39 | 3.38 |
| FN39-1 | 0.76 | 0.55 | 3.26 |
| FN39-2 | 0.74 | 0.52 | 2.85 |
| Genotypes | Average | 5% Sig Level | 1% Sig Level |
|---|---|---|---|
| ROC 22 | 0.77 | a | a |
| MR22-15 | 0.69 | bc | bc |
| MR22-20 | 0.73 | c | c |
| Genotypes | Average | 5% Sig Level | 1% Sig Level |
|---|---|---|---|
| ROC22 | 4.89 | a | a |
| MR22-2 | 7.8367 | b | a |
| MR22-7 | 0.9489 | b | b |
| MR22-9 | 2.1615 | b | a |
| MR22-11 | 0.5202 | b | b |
| MR22-15 | 12.1331 | b | bc |
| MR22-20 | 10.6471 | b | bc |
| Sample File Name | Size | Height | Sample File Name | Size | Height |
|---|---|---|---|---|---|
| Sep-23-15P | 141.38 | 1542 | Sep-23-20P | 145.41 | 4215 |
| Sep-23-15P | 168.83 | 841 | Sep-23-20P | 150.9 | 466 |
| Sep-23-15P | 174.83 | 123 | Sep-23-20P | 163.05 | 465 |
| Sep-23-15P | 182.96 | 142 | Sep-23-20N | 146.48 | 30783 |
| Sep-23-15P | 201.94 | 150 | Sep-23-20N | 150.9 | 9531 |
| Sep-23-15P | 208.33 | 119 | Sep-23-20N | 163.06 | 6201 |
| Sep-23-15N | 142.03 | 210 | |||
| Sep-23-15N | 146.62 | 92 | |||
| Sep-23-15N | 159.06 | 77 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khalil, F.; Naiyan, X.; Tayyab, M.; Pinghua, C. Screening of EMS-Induced Drought-Tolerant Sugarcane Mutants Employing Physiological, Molecular and Enzymatic Approaches. Agronomy 2018, 8, 226. https://doi.org/10.3390/agronomy8100226
Khalil F, Naiyan X, Tayyab M, Pinghua C. Screening of EMS-Induced Drought-Tolerant Sugarcane Mutants Employing Physiological, Molecular and Enzymatic Approaches. Agronomy. 2018; 8(10):226. https://doi.org/10.3390/agronomy8100226
Chicago/Turabian StyleKhalil, Farghama, Xiao Naiyan, Muhammad Tayyab, and Chen Pinghua. 2018. "Screening of EMS-Induced Drought-Tolerant Sugarcane Mutants Employing Physiological, Molecular and Enzymatic Approaches" Agronomy 8, no. 10: 226. https://doi.org/10.3390/agronomy8100226
APA StyleKhalil, F., Naiyan, X., Tayyab, M., & Pinghua, C. (2018). Screening of EMS-Induced Drought-Tolerant Sugarcane Mutants Employing Physiological, Molecular and Enzymatic Approaches. Agronomy, 8(10), 226. https://doi.org/10.3390/agronomy8100226

