Fabrication and Evaluation of Screen-Printed Electrodes on Chitosan Films for Cardiac Patch Applications with In Vitro and In Vivo Evaluation
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Preparation of Chitosan Films
2.3. Characterization of Chitosan Films
2.3.1. Swelling Ratio Determination
2.3.2. Mechanical Strength Test
2.4. Electrode Fabrication
2.5. Characterization of Electrode Films
2.5.1. Adhesion Test of SPE
2.5.2. Cyclic Voltammetry
2.6. Cell Culture and In Vitro Electrical Stimulation Assays
2.6.1. Isolation and Culture of Mesenchymal Stem Cells (MSCs)
2.6.2. Electrical Stimulation and Chemical Induction
2.6.3. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.7. In Vivo Evaluation of Screen-Printed Cardiac Patches for Myocardial Repair
2.7.1. Myocardial Infarction Model and Cardiac Patch Implantation
2.7.2. Histological Assessment
2.8. Statistics
3. Results
3.1. Characteristics of Chitosan Films
3.2. Adhesion Test of Screen-Printed Electrodes (SPEs)
3.3. Cyclic Voltammetry
3.4. Gene Expression of MSCs Induced by Electrical Stimulation
3.5. Cardiac Patch Implantation in the Injured Myocardium
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- van den Bos, E.J.; Mees, B.M.; de Waard, M.C.; de Crom, R.; Duncker, D.J. A novel model of cryoinjury-induced myocardial infarction in the mouse: A comparison with coronary artery ligation. Am. J. Physiol.-Heart Circ. Physiol. 2005, 289, H1291–H1300. [Google Scholar] [CrossRef]
- Heallen, T.R.; Kadow, Z.A.; Kim, J.H.; Wang, J.; Martin, J.F. Stimulating cardiogenesis as a treatment for heart failure. Circ. Res. 2019, 124, 1647–1657. [Google Scholar] [CrossRef] [PubMed]
- Cahill, T.J.; Choudhury, R.P.; Riley, P.R. Heart regeneration and repair after myocardial infarction: Translational opportunities for novel therapeutics. Nat. Rev. Drug Discov. 2017, 16, 699–717. [Google Scholar] [CrossRef]
- Liu, T.; Hao, Y.; Zhang, Z.; Zhou, H.; Peng, S.; Zhang, D.; Li, K.; Chen, Y.; Chen, M. Advanced cardiac patches for the treatment of myocardial infarction. Circulation 2024, 149, 2002–2020. [Google Scholar] [CrossRef] [PubMed]
- Beltran-Vargas, N.E.; Peña-Mercado, E.; Sánchez-Gómez, C.; Garcia-Lorenzana, M.; Ruiz, J.-C.; Arroyo-Maya, I.; Huerta-Yepez, S.; Campos-Terán, J. Sodium alginate/chitosan scaffolds for cardiac tissue engineering: The influence of its three-dimensional material preparation and the use of gold nanoparticles. Polymers 2022, 14, 3233. [Google Scholar] [CrossRef]
- Acosta, B.B.; Advincula, R.C.; Grande-Tovar, C.D. Chitosan-based scaffolds for the treatment of myocardial infarction: A systematic review. Molecules 2023, 28, 1920. [Google Scholar] [CrossRef]
- Tariq, U.; Gupta, M.; Pathak, S.; Patil, R.; Dohare, A.; Misra, S.K. Role of biomaterials in cardiac repair and regeneration: Therapeutic intervention for myocardial infarction. ACS Biomater. Sci. Eng. 2022, 8, 3271–3298. [Google Scholar] [CrossRef]
- Amiryaghoubi, N.; Fathi, M.; Javadzadeh, Y. Recent advances in polymer-based scaffolds for cardiac tissue engineering. Int. J. Polym. Mater. Polym. Biomater. 2024, 73, 1500–1524. [Google Scholar] [CrossRef]
- Oyekunle, D.T.; Nia, M.H.; Wilson, L.D. Recent progress on the application of chitosan, starch and chitosan–starch composites for meat preservation—A mini review. J. Compos. Sci. 2024, 8, 302. [Google Scholar] [CrossRef]
- Petroni, S.; Tagliaro, I.; Antonini, C.; D’Arienzo, M.; Orsini, S.F.; Mano, J.F.; Brancato, V.; Borges, J.; Cipolla, L. Chitosan-based biomaterials: Insights into chemistry; properties; devices, and their biomedical applications. Mar. Drugs 2023, 21, 147. [Google Scholar] [CrossRef] [PubMed]
- Mawazi, S.M.; Kumar, M.; Ahmad, N.; Ge, Y.; Mahmood, S. Recent applications of chitosan and its derivatives in antibacterial, anticancer, wound healing, and tissue engineering fields. Polymers 2024, 16, 1351. [Google Scholar] [CrossRef] [PubMed]
- Xu, B.; Li, Y.; Deng, B.; Liu, X.; Wang, L.; Zhu, Q.-L. Chitosan hydrogel improves mesenchymal stem cell transplant survival and cardiac function following myocardial infarction in rats. Exp. Ther. Med. 2017, 13, 588–594. [Google Scholar] [CrossRef]
- Chi, N.-H.; Yang, M.-C.; Chung, T.-W.; Chou, N.-K.; Wang, S.-S. Cardiac repair using chitosan-hyaluronan/silk fibroin patches in a rat heart model with myocardial infarction. Carbohydr. Polym. 2013, 92, 591–597. [Google Scholar] [CrossRef]
- Saravanan, S.; Sareen, N.; Abu-El-Rub, E.; Ashour, H.; Sequiera, G.L.; Ammar, H.I.; Gopinath, V.; Shamaa, A.A.; Sayed, S.S.E.; Moudgil, M. Graphene oxide-gold nanosheets containing chitosan scaffold improves ventricular contractility and function after implantation into infarcted heart. Sci. Rep. 2018, 8, 15069. [Google Scholar] [CrossRef]
- Ma, R.; Liang, J.; Huang, W.; Guo, L.; Cai, W.; Wang, L.; Paul, C.; Yang, H.-T.; Kim, H.W.; Wang, Y. Electrical stimulation enhances cardiac differentiation of human induced pluripotent stem cells for myocardial infarction therapy. Antioxid. Redox Signal. 2018, 28, 371–384. [Google Scholar] [CrossRef]
- Papadaki, M.; Bursac, N.; Langer, R.; Merok, J.; Vunjak-Novakovic, G.; Freed, L. Tissue engineering of functional cardiac muscle: Molecular, structural, and electrophysiological studies. Am. J. Physiol. Heart Circ. Physiol. 2001, 280, H168–H178. [Google Scholar] [CrossRef]
- Sesena-Rubfiaro, A.; Prajapati, N.J.; Paolino, L.; Lou, L.; Cotayo, D.; Pandey, P.; Shaver, M.; Hutcheson, J.D.; Agarwal, A.; He, J. Membrane remodeling of human-engineered cardiac tissue by chronic electric stimulation. ACS Biomater. Sci. Eng. 2023, 9, 1644–1655. [Google Scholar] [CrossRef]
- Zhang, Y.; Le Friec, A.; Zhang, Z.; Müller, C.A.; Du, T.; Dong, M.; Liu, Y.; Chen, M. Electroactive biomaterials synergizing with electrostimulation for cardiac tissue regeneration and function-monitoring. Mater. Today 2023, 70, 237–272. [Google Scholar] [CrossRef]
- Yin, Q.; Zhu, P.; Liu, W.; Gao, Z.; Zhao, L.; Wang, C.; Li, S.; Zhu, M.; Zhang, Q.; Zhang, X. A conductive bioengineered cardiac patch for myocardial infarction treatment by improving tissue electrical integrity. Adv. Healthc. Mater. 2023, 12, 2201856. [Google Scholar] [CrossRef]
- Lin, Y.-H.; Kang, P.-L.; Xin, W.; Yen, C.-S.; Hwang, L.-C.; Chen, C.-J.; Liu, J.-T.; Chang, S.J. Preparation and evaluation of chitosan biocompatible electronic skin. Comput. Ind. 2018, 100, 1–6. [Google Scholar] [CrossRef]
- Talarico, D.; Arduini, F.; Amine, A.; Cacciotti, I.; Moscone, D.; Palleschi, G. Screen-printed electrode modified with carbon black and chitosan: A novel platform for acetylcholinesterase biosensor development. Anal. Bioanal. Chem. 2016, 408, 7299–7309. [Google Scholar] [CrossRef]
- Gong, X.; Huang, K.; Wu, Y.-H.; Zhang, X.-S. Recent progress on screen-printed flexible sensors for human health monitoring. Sens. Actuators A Phys. 2022, 345, 113821. [Google Scholar] [CrossRef]
- Bounegru, A.V.; Bounegru, I. Chitosan-based electrochemical sensors for pharmaceuticals and clinical applications. Polymers 2023, 15, 3539. [Google Scholar] [CrossRef] [PubMed]
- Tape, S. Standard Test Methods for Measuring Adhesion by Tape Test1; ASTM International: West Conshohocken, PA, USA, 2011. [Google Scholar]
- Zhang, W.; Cao, J.; Jiang, W. Analysis of film-forming properties of chitosan with different molecular weights and its adhesion properties with different postharvest fruit surfaces. Food Chem. 2022, 395, 133605. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.L.; Zhao, Y. Effect of molecular weight, acid, and plasticizer on the physicochemical and antibacterial properties of β-chitosan based films. J. Food Sci. 2012, 77, E127–E136. [Google Scholar] [CrossRef]
- Bilican, I.; Pekdemir, S.; Onses, M.S.; Akyuz, L.; Altuner, E.M.; Koc-Bilican, B.; Zang, L.-S.; Mujtaba, M.; Mulerc, P.; Kaya, M. Chitosan loses innate beneficial properties after being dissolved in acetic acid: Supported by detailed molecular modeling. ACS Sustain. Chem. Eng. 2020, 8, 18083–18093. [Google Scholar] [CrossRef]
- Tang, X.; Wu, K.; Qi, X.; Kwon, H.-J.; Wang, R.; Li, Z.; Ye, H.; Hong, J.; Choi, H.H.; Kong, H. Screen printing of silver and carbon nanotube composite inks for flexible and reliable organic integrated devices. ACS Appl. Nano Mater. 2022, 5, 4801–4811. [Google Scholar] [CrossRef]
- Williams, N.X.; Noyce, S.; Cardenas, J.A.; Catenacci, M.; Wiley, B.J.; Franklin, A.D. Silver nanowire inks for direct-write electronic tattoo applications. Nanoscale 2019, 11, 14294–14302. [Google Scholar] [CrossRef]
- Park, J.-B.; Luo, X.; Lu, J.; Shin, C.D.; Yoon, C.S.; Amine, K.; Sun, Y.-K. Improvement of electrochemical properties of lithium–oxygen batteries using a silver electrode. J. Phys. Chem. C 2015, 119, 15036–15040. [Google Scholar] [CrossRef]
- Chen, J.; Zhan, Y.; Wang, Y.; Han, D.; Tao, B.; Luo, Z.; Ma, S.; Wang, Q.; Li, X.; Fan, L. Chitosan/silk fibroin modified nanofibrous patches with mesenchymal stem cells prevent heart remodeling post-myocardial infarction in rats. Acta Biomater. 2018, 80, 154–168. [Google Scholar] [CrossRef]
- Yilbas, A.E.; Hamilton, A.; Wang, Y.; Mach, H.; Lacroix, N.; Davis, D.R.; Chen, J.; Li, Q. Activation of GATA4 gene expression at the early stage of cardiac specification. Front. Chem. 2014, 2, 12. [Google Scholar] [CrossRef] [PubMed]
- Hernández, D.; Millard, R.; Sivakumaran, P.; Wong, R.C.; Crombie, D.E.; Hewitt, A.W.; Liang, H.; Hung, S.S.; Pébay, A.; Shepherd, R.K. Electrical stimulation promotes cardiac differentiation of human induced pluripotent stem cells. Stem Cells Int. 2016, 2015, 1718041. [Google Scholar] [CrossRef] [PubMed]
- Dai, Y.; Mu, J.; Zhou, F. The use of electrical stimulation to induce cardiac differentiation of stem cells for the treatment of myocardial infarction. Rev. Cardiovasc. Med. 2021, 22, 1167–1171. [Google Scholar] [CrossRef] [PubMed]
- Chan, Y.-C.; Ting, S.; Lee, Y.-K.; Ng, K.-M.; Zhang, J.; Chen, Z.; Siu, C.-W.; Oh, S.K.; Tse, H.-F. Electrical stimulation promotes maturation of cardiomyocytes derived from human embryonic stem cells. J. Cardiovasc. Transl. Res. 2013, 6, 989–999. [Google Scholar] [CrossRef]
- Ramesh, S.; Govarthanan, K.; Ostrovidov, S.; Zhang, H.; Hu, Q.; Camci-Unal, G.; Verma, R.S.; Ramalingam, M. Cardiac differentiation of mesenchymal stem cells: Impact of biological and chemical inducers. Stem Cell Rev. Rep. 2021, 17, 1343–1361. [Google Scholar] [CrossRef]









| Group Name | Treatment Description |
|---|---|
| SPE | MSCs cultured on chitosan–SPEs only |
| SPE-5Aza | MSCs + SPEs + 5-azacytidine |
| SPE-ES | MSCs + SPEs + electrical stimulation |
| SPE-ES-5Aza | MSCs + SPEs + 5-azacytidine + electrical stimulation |
| Sequences (5′-3′) | Accession No. | Product | |
|---|---|---|---|
| Arbp | Forward: GTACCATTGAAATCCTGAGCGATGTG Reverse: GATGCTGCCATTGTCAAACACCTG | NM_022402.2 | 130 bp |
| GATA4 | Forward: GTCCCAGACATTCAGTACTGTGTCCG Reverse: GTGACAGGAGATGGATAGCCTTGTGG | NM_144730.1 | 99 bp |
| β-MHC | Forward: CACAGATGCCGCCATGATGG Reverse: CGATCTGCTCTGCCTCGTCCAG | NM_017240.1 | 134 bp |
| Troponin I | Forward: CCATGATGCAGGCACTACTGGG Reverse: GGTTTTCCTTCTCAATGTCCTCCTTC | NM_017144.1 | 99 bp |
| M.W. | ΔL (mm) | Tensile Strain | Tensile Stress (kPa) | Young’s Modulus (kPa) |
|---|---|---|---|---|
| 70 kDa | 21.86 | 0.55 ± 0.11 | 56.27 ± 4.95 | 105.39 ± 23.99 |
| 300 kDa | 21.94 | 0.55 ± 0.05 | 83.65 ± 11.34 | 152.57 ± 18.53 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lin, Y.-H.; Chen, Y.-J.; Liu, J.-T.; Yen, C.-S.; Lin, Y.-Z.; Zhou, X.-W.; Chen, S.-Y.; Hu, J.-L.; Wu, C.-H.; Chen, C.-J.; et al. Fabrication and Evaluation of Screen-Printed Electrodes on Chitosan Films for Cardiac Patch Applications with In Vitro and In Vivo Evaluation. Polymers 2025, 17, 2088. https://doi.org/10.3390/polym17152088
Lin Y-H, Chen Y-J, Liu J-T, Yen C-S, Lin Y-Z, Zhou X-W, Chen S-Y, Hu J-L, Wu C-H, Chen C-J, et al. Fabrication and Evaluation of Screen-Printed Electrodes on Chitosan Films for Cardiac Patch Applications with In Vitro and In Vivo Evaluation. Polymers. 2025; 17(15):2088. https://doi.org/10.3390/polym17152088
Chicago/Turabian StyleLin, Yu-Hsin, Yong-Ji Chen, Jen-Tsai Liu, Ching-Shu Yen, Yi-Zhen Lin, Xiu-Wei Zhou, Shu-Ying Chen, Jhe-Lun Hu, Chi-Hsiang Wu, Ching-Jung Chen, and et al. 2025. "Fabrication and Evaluation of Screen-Printed Electrodes on Chitosan Films for Cardiac Patch Applications with In Vitro and In Vivo Evaluation" Polymers 17, no. 15: 2088. https://doi.org/10.3390/polym17152088
APA StyleLin, Y.-H., Chen, Y.-J., Liu, J.-T., Yen, C.-S., Lin, Y.-Z., Zhou, X.-W., Chen, S.-Y., Hu, J.-L., Wu, C.-H., Chen, C.-J., Kang, P.-L., & Chang, S.-J. (2025). Fabrication and Evaluation of Screen-Printed Electrodes on Chitosan Films for Cardiac Patch Applications with In Vitro and In Vivo Evaluation. Polymers, 17(15), 2088. https://doi.org/10.3390/polym17152088
