Mechanism of Fumonisin Self-Resistance: Fusarium verticillioides Contains Four Fumonisin B1-Insensitive-Ceramide Synthases
Abstract
1. Introduction
2. Results
2.1. Sphinganine-Analog Producing Fungal Species Are More Resistant to Fumonisin B1 Than Non-Producers
2.2. Generation and Characterization of a fum17-18 Deletion Strain in a fum1 Background
2.3. Testing Fumonisin Resistance of Ceramide Synthase Genes by Heterologous Expression in Yeast
3. Discussion
4. Materials and Methods
4.1. FB1-Sensitivity of Growth of Fusarium and Other Fungi
4.2. Generation of Δfum1, Δfum17-18 Mutants
4.3. Expression of Putative Self-Protection Genes in an FB1-Sensitive Baker’s Yeast Strain
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Stankeviciute, G.; Tang, P.; Ashley, B.; Chamberlain, J.D.; Hansen, M.E.B.; Coleman, A.; D’Emilia, R.; Fu, L.; Mohan, E.C.; Nguyen, H.; et al. Convergent Evolution of Bacterial Ceramide Synthesis. Nat. Chem. Biol. 2022, 18, 305–312. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hannun, Y.A.; Obeid, L.M. Sphingolipids and Their Metabolism in Physiology and Disease. Nat. Rev. Mol. Cell Biol. 2018, 19, 175–191. [Google Scholar] [CrossRef] [Scilit]
- Michaelson, L.V.; Napier, J.A.; Molino, D.; Faure, J.-D. Plant Sphingolipids: Their Importance in Cellular Organization and Adaption. Biochim. Biophys. Acta 2016, 1861, 1329–1335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fougère, L.; Mongrand, S.; Boutté, Y. The Function of Sphingolipids in Membrane Trafficking and Cell Signaling in Plants, in Comparison with Yeast and Animal Cells. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2024, 1869, 159463. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haslam, T.M.; Feussner, I. Diversity in Sphingolipid Metabolism across Land Plants. J. Exp. Bot. 2022, 73, 2785–2798. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Santos, T.C.B.; Dingjan, T.; Futerman, A.H. The Sphingolipid Anteome: Implications for Evolution of the Sphingolipid Metabolic Pathway. FEBS Lett. 2022, 596, 2345–2363. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.; Li, Z.; Cheng, Y.; Gao, C.; Guo, L.; Wang, T.; Xu, J. Sphinganine-Analog Mycotoxins (SAMs): Chemical Structures, Bioactivities, and Genetic Controls. J. Fungi 2020, 6, 312. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Berkey, R.; Bendigeri, D.; Xiao, S. Sphingolipids and Plant Defense/Disease: The “Death” Connection and Beyond. Front. Plant Sci. 2012, 3, 68. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luttgeharm, K.D.; Cahoon, E.B.; Markham, J.E. Substrate Specificity, Kinetic Properties and Inhibition by Fumonisin B1 of Ceramide Synthase Isoforms from Arabidopsis. Biochem. J. 2016, 473, 593–603. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Merrill, A.H.; Wang, E.; Vales, T.R.; Smith, E.R.; Schroeder, J.J.; Menaldino, D.S.; Alexander, C.; Crane, H.M.; Xia, J.; Liotta, D.C.; et al. Fumonisin Toxicity and Sphingolipid Biosynthesis. In Fumonisins in Food; Jackson, L.S., DeVries, J.W., Bullerman, L.B., Eds.; Advances in Experimental Medicine and Biology; Springer: Boston, MA, USA, 1996; pp. 297–306. ISBN 978-1-4899-1379-1. [Google Scholar]
- Merrill, A.H.; van Echten, G.; Wang, E.; Sandhoff, K. Fumonisin B1 Inhibits Sphingosine (Sphinganine) N-Acyltransferase and de Novo Sphingolipid Biosynthesis in Cultured Neurons in Situ. J. Biol. Chem. 1993, 268, 27299–27306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Proctor, R.H.; Brown, D.W.; Plattner, R.D.; Desjardins, A.E. Co-Expression of 15 Contiguous Genes Delineates a Fumonisin Biosynthetic Gene Cluster in Gibberella Moniliformis. Fungal Genet. Biol. 2003, 38, 237–249. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- EFSA Panel on Contaminants in the Food Chain (CONTAM); Schrenk, D.; Bignami, M.; Bodin, L.; Chipman, J.K.; Del Mazo, J.; Grasl-Kraupp, B.; Hogstrand, C.; Leblanc, J.-C.; Nielsen, E.; et al. Assessment of Information as Regards the Toxicity of Fumonisins for Pigs, Poultry and Horses. EFSA J. 2022, 20, e07534. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- International Agency for Research on Cancer (IARC). IARC Monographs on the Evaluation of Carcinogenic Risks to Humans; Fumonisin b1; IARC Press: Lyon, France, 2002; pp. 275–366. [Google Scholar]
- Wangia-Dixon, R.N.; Nishimwe, K. Molecular Toxicology and Carcinogenesis of Fumonisins: A Review. J. Environ. Sci. Health C Toxicol. Carcinog. 2021, 39, 44–67. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mirocha, C.J.; Chen, J.; Xie, W.; Xu, Y.; Abbas, H.K.; Hogge, L.R. Biosynthesis of Fumonisin and Aal Derivatives by Alternaria and Fusarium in Laboratory Culture. Adv. Exp. Med. Biol. 1996, 392, 213–224. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, H.-S.; Lohmar, J.M.; Busman, M.; Brown, D.W.; Naumann, T.A.; Divon, H.H.; Lysøe, E.; Uhlig, S.; Proctor, R.H. Identification and Distribution of Gene Clusters Required for Synthesis of Sphingolipid Metabolism Inhibitors in Diverse Species of the Filamentous Fungus Fusarium. BMC Genom. 2020, 21, 510. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Proctor, R.H.; Van Hove, F.; Susca, A.; Stea, G.; Busman, M.; van der Lee, T.; Waalwijk, C.; Moretti, A.; Ward, T.J. Birth, Death and Horizontal Transfer of the Fumonisin Biosynthetic Gene Cluster during the Evolutionary Diversification of Fusarium. Mol. Microbiol. 2013, 90, 290–306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Proctor, R.H.; Busman, M.; Seo, J.-A.; Lee, Y.W.; Plattner, R.D. A Fumonisin Biosynthetic Gene Cluster in Fusarium Oxysporum Strain O-1890 and the Genetic Basis for B versus C Fumonisin Production. Fungal Genet. Biol. 2008, 45, 1016–1026. [Google Scholar] [CrossRef] [Scilit]
- Desjardins, A.E.; Munkvold, G.P.; Plattner, R.D.; Proctor, R.H. FUM1—A Gene Required for Fumonisin Biosynthesis but Not for Maize Ear Rot and Ear Infection by Gibberella Moniliformis in Field Tests. Mol. Plant Microbe Interact. 2002, 15, 1157–1164. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Glenn, A.E.; Zitomer, N.C.; Zimeri, A.M.; Williams, L.D.; Riley, R.T.; Proctor, R.H. Transformation-Mediated Complementation of a FUM Gene Cluster Deletion in Fusarium Verticillioides Restores Both Fumonisin Production and Pathogenicity on Maize Seedlings. Mol. Plant Microbe Interact. 2008, 21, 87–97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Desjardins, A.E.; Plattner, R.D.; Stessman, R.J.; McCormick, S.P.; Millard, M.J. Identification and Heritability of Fumonisin Insensitivity in Zea Mays. Phytochemistry 2005, 66, 2474–2480. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, L.; Chen, X.; Gao, J.; Zhao, Y.; Liu, L.; Hou, Y.; Wang, L.; Huang, S. Effects of Disruption of Five FUM Genes on Fumonisin Biosynthesis and Pathogenicity in Fusarium Proliferatum. Toxins 2019, 11, 327. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, F.; Huang, L.; Wang, J.; Ma, C.; Tan, Y.; Wang, F.; Fan, Y.; Luo, M. Sphingolipid Synthesis Inhibitor Fumonisin B1 Causes Verticillium Wilt in Cotton. J. Integr. Plant Biol. 2022, 64, 836–842. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Akamatsu, H.; Itoh, Y.; Kodama, M.; Otani, H.; Kohmoto, K. AAL-Toxin-Deficient Mutants of Alternaria Alternata Tomato Pathotype by Restriction Enzyme-Mediated Integration. Phytopathology 1997, 87, 967–972. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Spassieva, S.D.; Markham, J.E.; Hille, J. The Plant Disease Resistance Gene Asc-1 Prevents Disruption of Sphingolipid Metabolism during AAL-Toxin-Induced Programmed Cell Death. Plant J. 2002, 32, 561–572. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Egusa, M.; Miwa, T.; Kaminaka, H.; Takano, Y.; Kodama, M. Nonhost Resistance of Arabidopsis Thaliana against Alternaria Alternata Involves Both Pre- and Postinvasive Defenses but Is Collapsed by AAL-Toxin in the Absence of LOH2. Phytopathology 2013, 103, 733–740. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sherif, M.; Kirsch, N.; Splivallo, R.; Pfohl, K.; Karlovsky, P. The Role of Mycotoxins in Interactions between Fusarium Graminearum and F. Verticillioides Growing in Saprophytic Cultures and Co-Infecting Maize Plants. Toxins 2023, 15, 575. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Keyser, Z.; Vismer, H.F.; Klaasen, J.A.; Snijman, P.W.; Marasas, W.F.O. The Antifungal Effect of Fumonisin B1 on Fusarium and Other Fungal Species. S. Afr. J. Sci. 1999, 95, 455–458. [Google Scholar] [PubMed]
- Dawidziuk, A.; Koczyk, G.; Popiel, D. Adaptation and Response to Mycotoxin Presence in Pathogen-Pathogen Interactions within the Fusarium Genus. World Mycotoxin J. 2016, 9, 565–575. [Google Scholar] [CrossRef] [Scilit]
- Janevska, S.; Ferling, I.; Jojić, K.; Rautschek, J.; Hoefgen, S.; Proctor, R.H.; Hillmann, F.; Valiante, V. Self-Protection against the Sphingolipid Biosynthesis Inhibitor Fumonisin B1 Is Conferred by a FUM Cluster-Encoded Ceramide Synthase. mBio 2020, 11, e00455-20. [Google Scholar] [CrossRef] [Scilit]
- Ma, L.-J.; van der Does, H.C.; Borkovich, K.A.; Coleman, J.J.; Daboussi, M.-J.; Di Pietro, A.; Dufresne, M.; Freitag, M.; Grabherr, M.; Henrissat, B.; et al. Comparative Genomics Reveals Mobile Pathogenicity Chromosomes in Fusarium. Nature 2010, 464, 367–373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cuomo, C.A.; Güldener, U.; Xu, J.-R.; Trail, F.; Turgeon, B.G.; Di Pietro, A.; Walton, J.D.; Ma, L.-J.; Baker, S.E.; Rep, M.; et al. The Fusarium Graminearum Genome Reveals a Link between Localized Polymorphism and Pathogen Specialization. Science 2007, 317, 1400–1402. [Google Scholar] [CrossRef] [Scilit]
- Krska, T.; Twaruschek, K.; Valente, N.; Mitterbauer, R.; Moll, D.; Wiesenberger, G.; Berthiller, F.; Adam, G. Development of a Fumonisin-Sensitive Saccharomyces Cerevisiae Indicator Strain and Utilization for Activity Testing of Candidate Detoxification Genes. Appl. Environ. Microbiol. 2023, 89, e0121123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Caldas, E.D.; Jones, A.D.; Ward, B.; Winter, C.K.; Gilchrist, D.G. Structural Characterization of Three New AAL Toxins Produced by Alternaria alternata f. Sp. Lycopersici. J. Agric. Food Chem. 1994, 42, 327–333. [Google Scholar] [CrossRef] [Scilit]
- Frisvad, J.C.; Larsen, T.O.; Thrane, U.; Meijer, M.; Varga, J.; Samson, R.A.; Nielsen, K.F. Fumonisin and Ochratoxin Production in Industrial Aspergillus Niger Strains. PLoS ONE 2011, 6, e23496. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Galagan, J.E.; Calvo, S.E.; Cuomo, C.; Ma, L.-J.; Wortman, J.R.; Batzoglou, S.; Lee, S.-I.; Baştürkmen, M.; Spevak, C.C.; Clutterbuck, J.; et al. Sequencing of Aspergillus Nidulans and Comparative Analysis with A. Fumigatus and A. Oryzae. Nature 2005, 438, 1105–1115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Proctor, R.H.; Desjardins, A.E.; Plattner, R.D.; Hohn, T.M. A Polyketide Synthase Gene Required for Biosynthesis of Fumonisin Mycotoxins in Gibberella Fujikuroi Mating Population A. Fungal Genet. Biol. 1999, 27, 100–112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- D’mello, N.P.; Childress, A.M.; Franklin, D.S.; Kale, S.P.; Pinswasdi, C.; Jazwinski, S.M. Cloning and Characterization of LAG1, a Longevity-Assurance Gene in Yeast. J. Biol. Chem. 1994, 269, 15451–15459. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, J.C.; Kirchman, P.A.; Zagulski, M.; Hunt, J.; Jazwinski, S.M. Homologs of the Yeast Longevity Gene LAG1 in Caenorhabditis Elegans and Human. Genome Res. 1998, 8, 1259–1272. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sultana, S.; Kitajima, M.; Kobayashi, H.; Nakagawa, H.; Shimizu, M.; Kageyama, K.; Suga, H. A Natural Variation of Fumonisin Gene Cluster Associated with Fumonisin Production Difference in Fusarium Fujikuroi. Toxins 2019, 11, 200. [Google Scholar] [CrossRef] [Scilit]
- Kheder, A.; Akagi, Y.; Tsuge, T.; Kodama, M. Functional Analysis of the Ceramide Synthase Gene ALT7, a Homologue of the Plant Disease Resistant Gene Asc1, in a Plant Pathogenic Fungus Alternaria alternata. Plant Pathol. Microbiol. 2012. [Google Scholar] [CrossRef]
- Mogensen, J.M.; Frisvad, J.C.; Thrane, U.; Nielsen, K.F. Production of Fumonisin B2 and B4 by Aspergillus Niger on Grapes and Raisins. J. Agric. Food Chem. 2010, 58, 954–958. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Susca, A.; Moretti, A.; Stea, G.; Villani, A.; Haidukowski, M.; Logrieco, A.; Munkvold, G. Comparison of Species Composition and Fumonisin Production in Aspergillus Section Nigri Populations in Maize Kernels from USA and Italy. Int. J. Food Microbiol. 2014, 188, 75–82. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Susca, A.; Proctor, R.H.; Butchko, R.A.E.; Haidukowski, M.; Stea, G.; Logrieco, A.; Moretti, A. Variation in the Fumonisin Biosynthetic Gene Cluster in Fumonisin-Producing and Nonproducing Black Aspergilli. Fungal Genet. Biol. 2014, 73, 39–52. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, Y.; Liu, N.; Tang, Y. Recent Developments in Self-Resistance Gene Directed Natural Product Discovery. Nat. Prod. Rep. 2020, 37, 879–892. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- O’Neill, E.C.; Schorn, M.; Larson, C.B.; Millán-Aguiñaga, N. Targeted Antibiotic Discovery through Biosynthesis-Associated Resistance Determinants: Target Directed Genome Mining. Crit. Rev. Microbiol. 2019, 45, 255–277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stahlecker, J.; Mingyar, E.; Ziemert, N.; Mungan, M.D. SYN-View: A Phylogeny-Based Synteny Exploration Tool for the Identification of Gene Clusters Linked to Antibiotic Resistance. Molecules 2020, 26, 144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, Y.; Liu, Q.; Zang, X.; Yuan, S.; Bat-Erdene, U.; Nguyen, C.; Gan, J.; Zhou, J.; Jacobsen, S.E.; Tang, Y. Resistance-Gene-Directed Discovery of a Natural-Product Herbicide with a New Mode of Action. Nature 2018, 559, 415–418. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Twaruschek, K.; Spörhase, P.; Michlmayr, H.; Wiesenberger, G.; Adam, G. New Plasmids for Fusarium Transformation Allowing Positive-Negative Selection and Efficient Cre-loxP Mediated Marker Recycling. Front. Microbiol. 2018, 9, 1954. [Google Scholar] [CrossRef] [Scilit]




| Species | Strain Designation (Other Collection) | Genotype |
|---|---|---|
| Fusarium verticillioides | FGSC 7600; (FRC M-3125, NRRL 20956) | wt 1 |
| Fusarium graminearum | PH-1 (NRRL 31084) | wt |
| Alternaria alternata f.sp. lycopersici | AS27-12 | wt |
| Alternaria alternata (mali) | MA 304 (CBS 106.24, ATCC 13963) | wt |
| Alternaria alternata | MA 308 (CBS 150.24) | wt |
| Aspergillus niger | ATCC 11414 | wt |
| Aspergillus nidulans | FGSC A4 (ATCC 38163) | wt |
| F. verticillioides | GfA2364 | fum1::hygB |
| F. verticillioides | KTFD1 KTFD4 | fum1::hygB fum17-18Δ::HSVtk-nptII (this study) |
| Name | Sequence |
|---|---|
| Δfum1 confirmation | |
| GfA2364_fum1test_fw | AGAAGCCTTGATGCTGCCTA |
| GfA2364_fum1test_rv | GAGTGATGTCCCATGGCAGA |
| hyg-FW | GCTTTCAGCTTCGATGTAGGAGG |
| hyg-RV | CTACACAGCCATCGGTCCAGAC |
| Δfum17,18 disruption | |
| Fw_Fum327KO | ACTAGTCACGACAGTAAGAAGCAA |
| Rv_Fum327KO | GACTTGACGGGGATCGGTTC |
| Fw_Fum328KO | GGATTTGGAGACAAGTACGA |
| Rv_Fum328KO | GTCGACATCCTTCTCGAAGGCCAG |
| P#926 | TGCTCCAACTCAGGCGATGCTG |
| P#940 | CCGTCTAGCGCTGTTGATTGTATT |
| FUM1718_upstream_PCRtest | GCCTTCAAAGTTCATCATGGC |
| FUM1718_downstr_PCRtest | TAAGCGTGTCGTAACCTGTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Krska, T.; Twaruschek, K.; Wiesenberger, G.; Berthiller, F.; Adam, G. Mechanism of Fumonisin Self-Resistance: Fusarium verticillioides Contains Four Fumonisin B1-Insensitive-Ceramide Synthases. Toxins 2024, 16, 235. https://doi.org/10.3390/toxins16060235
Krska T, Twaruschek K, Wiesenberger G, Berthiller F, Adam G. Mechanism of Fumonisin Self-Resistance: Fusarium verticillioides Contains Four Fumonisin B1-Insensitive-Ceramide Synthases. Toxins. 2024; 16(6):235. https://doi.org/10.3390/toxins16060235
Chicago/Turabian StyleKrska, Tamara, Krisztian Twaruschek, Gerlinde Wiesenberger, Franz Berthiller, and Gerhard Adam. 2024. "Mechanism of Fumonisin Self-Resistance: Fusarium verticillioides Contains Four Fumonisin B1-Insensitive-Ceramide Synthases" Toxins 16, no. 6: 235. https://doi.org/10.3390/toxins16060235
APA StyleKrska, T., Twaruschek, K., Wiesenberger, G., Berthiller, F., & Adam, G. (2024). Mechanism of Fumonisin Self-Resistance: Fusarium verticillioides Contains Four Fumonisin B1-Insensitive-Ceramide Synthases. Toxins, 16(6), 235. https://doi.org/10.3390/toxins16060235

