Production of Highly Active Recombinant Dermonecrotic Toxin of Bordetella Pertussis
Abstract
1. Introduction
2. Results
2.1. Cloning, Expression, and Purification of Recombinant DNT
2.2. Recombinant DNT Binds and Penetrates Target Cells, Deamidates Rho, and Triggers Remodeling of Actin Cytoskeleton
2.3. Recombinant DNT Has Strong Dermonecrotic Effect in an Infant Mouse Model
2.4. DNT is a Monomeric Protein with V-Shaped Structure Consiting of Two Extended Arms Linked by a Central Segment
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains and Growth Conditions
4.2. Plasmid Constructs
4.3. Expression and Purification of Recombinant DNT
4.4. Determination of LPS Levels and Protein Concentrations
4.5. Cell Lines
4.6. Air-Liquid Interface (ALI) Cultures of VA10 Cells
4.7. Analysis of the Expression of Genes Encoding Calcium Channels Cav3.1, Cav3.2 and Cav3.3 in Different Cell Types
4.8. Determination of DNT Binding to Target Cells
4.9. Immunofluorescent Staining of A549 and MC-3T3-E1 Cells and Fluorescent Microscopy
4.10. Western Blot Analysis of Deamidation of Gln63 of RhoA
4.11. Blocking of Recombinant DNT Entry into Cells by ProTx-I
4.12. Dermonecrotic Activity of Recombinant DNT on Mice
4.13. Structural Analysis of rDNT Particles by Single Particle Image Analysis
Author Contributions
Funding
Conflicts of Interest
References
- Mattoo, S.; Cherry, J.D. Molecular pathogenesis, epidemiology, and clinical manifestations of respiratory infections due to Bordetella pertussis and other Bordetella subspecies. Clin. Microbiol. Rev. 2005, 18, 326–382. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yeung, K.H.T.; Duclos, P.; Nelson, E.A.S.; Hutubessy, R.C.W. An update of the global burden of pertussis in children younger than 5 years: A modelling study. Lancet Infect. Dis. 2017, 17, 974–980. [Google Scholar] [CrossRef] [Scilit]
- World Health Organization. Pertussis Vaccines: Who Position Paper—September 2015. Wkly. Epidemiol. Rec. 2015, 90, 433–458. [Google Scholar]
- Octavia, S.; Sintchenko, V.; Gilbert, G.L.; Lawrence, A.; Keil, A.D.; Hogg, G.; Lan, R. Newly emerging clones of Bordetella pertussis carrying prn2 and ptxp3 alleles implicated in australian pertussis epidemic in 2008–2010. J. Infect. Dis. 2012, 205, 1220–1224. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Winter, K.; Harriman, K.; Zipprich, J.; Schechter, R.; Talarico, J.; Watt, J.; Chavez, G. California pertussis epidemic, 2010. J. Pediatr. 2012, 161, 1091–1096. [Google Scholar] [CrossRef] [Scilit]
- Melvin, J.A.; Scheller, E.V.; Miller, J.F.; Cotter, P.A. Bordetella pertussis pathogenesis: Current and future challenges. Nat. Rev. Microbiol. 2014, 12, 274–288. [Google Scholar] [CrossRef] [Scilit]
- Walker, K.E.; Weiss, A.A. Characterization of the dermonecrotic toxin in members of the genus Bordetella. Infect. Immun. 1994, 62, 3817–3828. [Google Scholar] [CrossRef] [Scilit]
- Horiguchi, Y. Swine atrophic rhinitis caused by Pasteurella multocida toxin and Bordetella dermonecrotic toxin. Curr. Top. Microbiol. Immunol. 2012, 361, 113–129. [Google Scholar]
- Horiguchi, Y.; Nakai, T.; Kume, K. Purification and characterization of Bordetella bronchiseptica dermonecrotic toxin. Microb. Pathog. 1989, 6, 361–368. [Google Scholar] [CrossRef] [Scilit]
- Magyar, T.; Glavits, R.; Pullinger, G.D.; Lax, A.J. The pathological effect of the Bordetella dermonecrotic toxin in mice. Acta Vet. Hung. 2000, 48, 397–406. [Google Scholar] [CrossRef] [Scilit]
- Brockmeier, S.L.; Register, K.B.; Magyar, T.; Lax, A.J.; Pullinger, G.D.; Kunkle, R.A. Role of the dermonecrotic toxin of Bordetella bronchiseptica in the pathogenesis of respiratory disease in swine. Infect. Immun. 2002, 70, 481–490. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hanada, M.; Shimoda, K.; Tomita, S.; Nakase, Y.; Nishiyama, Y. Production of lesions similar to naturally occurring swine atrophic rhinitis by cell-free sonicated extract of Bordetella bronchiseptica. Jpn. J. Vet. Sci. 1979, 41, 1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fetter, A.W.; Switzer, W.P.; Capen, C.C. Electron microscopic evaluation of bone cells in pigs with experimentally induced Bordetella rhinitis (turbinate osteoporosis). Am. J. Vet. Res. 1975, 36, 15–22. [Google Scholar] [PubMed]
- Silveira, D.; Edington, N.; Smith, I.M. Ultrastructural changes in the nasal turbinate bones of pigs in early infection with Bordetella bronchiseptica. Res. Vet. Sci. 1982, 33, 37–42. [Google Scholar] [CrossRef] [Scilit]
- Horiguchi, Y.; Nakai, T.; Kume, K. Effects of Bordetella bronchiseptica dermonecrotic toxin on the structure and function of osteoblastic clone MC3T3-E1 cells. Infect. Immun. 1991, 59, 1112–1116. [Google Scholar] [CrossRef] [Scilit]
- Horiguchi, Y.; Okada, T.; Sugimoto, N.; Morikawa, Y.; Katahira, J.; Matsuda, M. Effects of Bordetella bronchiseptica dermonecrotizing toxin on bone formation in calvaria of neonatal rats. FEMS Immunol. Med. Microbiol. 1995, 12, 29–32. [Google Scholar] [CrossRef]
- Horiguchi, Y.; Inoue, N.; Masuda, M.; Kashimoto, T.; Katahira, J.; Sugimoto, N.; Matsuda, M. Bordetella bronchiseptica dermonecrotizing toxin induces reorganization of actin stress fibers through deamidation of Gln-63 of the GTP-binding protein Rho. Proc. Natl. Acad. Sci. USA 1997, 94, 11623–11626. [Google Scholar] [CrossRef] [Scilit]
- Pullinger, G.D.; Adams, T.E.; Mullan, P.B.; Garrod, T.I.; Lax, A.J. Cloning, expression, and molecular characterization of the dermonecrotic toxin gene of Bordetella spp. Infect. Immun. 1996, 64, 4163–4171. [Google Scholar] [CrossRef] [Scilit]
- Matsuzawa, T.; Kashimoto, T.; Katahira, J.; Horiguchi, Y. Identification of a receptor-binding domain of Bordetella dermonecrotic toxin. Infect. Immun. 2002, 70, 3427–3432. [Google Scholar] [CrossRef] [Scilit]
- Fukui-Miyazaki, A.; Ohnishi, S.; Kamitani, S.; Abe, H.; Horiguchi, Y. Bordetella dermonecrotic toxin binds to target cells via the N-terminal 30 amino acids. Microbiol. Immunol. 2011, 55, 154–159. [Google Scholar] [CrossRef] [Scilit]
- Schmidt, G.; Goehring, U.M.; Schirmer, J.; Lerm, M.; Aktories, K. Identification of the C-terminal part of Bordetella dermonecrotic toxin as a transglutaminase for Rho GTPases. J. Biol. Chem. 1999, 274, 31875–31881. [Google Scholar] [CrossRef] [Scilit]
- Kashimoto, T.; Katahira, J.; Cornejo, W.R.; Masuda, M.; Fukuoh, A.; Matsuzawa, T.; Ohnishi, T.; Horiguchi, Y. Identification of functional domains of Bordetella dermonecrotizing toxin. Infect. Immun. 1999, 67, 3727–3732. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Matsuzawa, T.; Fukui, A.; Kashimoto, T.; Nagao, K.; Oka, K.; Miyake, M.; Horiguchi, Y. Bordetella dermonecrotic toxin undergoes proteolytic processing to be translocated from a dynamin-related endosome into the cytoplasm in an acidification-independent manner. J. Biol. Chem. 2004, 279, 2866–2872. [Google Scholar] [CrossRef] [Scilit]
- Horiguchi, Y.; Senda, T.; Sugimoto, N.; Katahira, J.; Matsuda, M. Bordetella bronchiseptica dermonecrotizing toxin stimulates assembly of actin stress fibers and focal adhesions by modifying the small GTP-binding protein Rho. J. Cell Sci. 1995, 108, 3243–3251. [Google Scholar]
- Horiguchi, Y.; Sugimoto, N.; Matsuda, M. Stimulation of DNA synthesis in osteoblast-like MC3T3-E1 cells by Bordetella bronchiseptica dermonecrotic toxin. Infect. Immun. 1993, 61, 3611–3615. [Google Scholar] [CrossRef] [Scilit]
- Horiguchi, Y.; Sugimoto, N.; Matsuda, M. Bordetella bronchiseptica dermonecrotizing toxin stimulates protein synthesis in an osteoblastic clone, MC3T3-E1 cells. FEMS Microbiol. Lett. 1994, 120, 19–22. [Google Scholar] [CrossRef]
- Teruya, S.; Hiramatsu, Y.; Nakamura, K.; Fukui-Miyazaki, A.; Tsukamoto, K.; Shinoda, N.; Motooka, D.; Nakamura, S.; Ishigaki, K.; Shinzawa, N.; et al. Bordetella dermonecrotic toxin is a neurotropic virulence factor that uses Cav3.1 as the cell surface receptor. mBio 2020, 11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Endoh, M.; Amitani, M.; Nakase, Y. Purification and characterization of heat-labile toxin from Bordetella bronchiseptica. Microbiol. Immunol. 1986, 30, 659–673. [Google Scholar] [CrossRef] [Scilit]
- Kume, K.; Nakai, T.; Samejima, Y.; Sugimoto, C. Properties of dermonecrotic toxin prepared from sonic extracts Bordetella bronchiseptica. Infect. Immun. 1986, 52, 370–377. [Google Scholar] [CrossRef] [Scilit]
- Nakase, Y.; Endoh, M. Bordetella heat-labile toxin: Further purification, characterization and mode of action. Dev. Biol. Stand. 1985, 61, 93–102. [Google Scholar]
- Stanek, O.; Masin, J.; Osicka, R.; Jurnecka, D.; Osickova, A.; Sebo, P. Rapid purification of endotoxin-free RTX toxins. Toxins 2019, 11, 336. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buetow, L.; Flatau, G.; Chiu, K.; Boquet, P.; Ghosh, P. Structure of the Rho-activating domain of Escherichia coli cytotoxic necrotizing factor 1. Nat. Struct. Biol. 2001, 8, 584–588. [Google Scholar] [CrossRef] [Scilit]
- Lesne, E.; Coutte, L.; Solans, L.; Slupek, S.; Debrie, A.S.; Dhennin, V.; Froguel, P.; Hot, D.; Locht, C.; Antoine, R.; et al. Distinct virulence ranges for infection of mice by Bordetella pertussis revealed by engineering of the sensor-kinase BvgS. PLoS ONE 2018, 13, e0204861. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Warfel, J.M.; Beren, J.; Kelly, V.K.; Lee, G.; Merkel, T.J. Nonhuman primate model of pertussis. Infect. Immun. 2012, 80, 1530–1536. [Google Scholar] [CrossRef] [Scilit]
- Khan, F.; He, M.; Taussig, M.J. Double-hexahistidine tag with high-affinity binding for protein immobilization, purification, and detection on Ni-nitrilotriacetic acid surfaces. Anal. Chem. 2006, 78, 3072–3079. [Google Scholar] [CrossRef] [Scilit]
- Karttunen, J.; Sanderson, S.; Shastri, N. Detection of rare antigen-presenting cells by the lacZ T-cell activation assay suggests an expression cloning strategy for T-cell antigens. Proc. Natl. Acad. Sci. USA 1992, 89, 6020–6024. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Zhang, J.; Jiang, D.; Zhang, D.; Qian, Z.; Liu, C.; Tao, J. Inhibition of T-type Ca(2)(+) channels by endostatin attenuates human glioblastoma cell proliferation and migration. Br. J. Pharmacol. 2012, 166, 1247–1260. [Google Scholar] [CrossRef] [Scilit]
- Mogal, A.; Abdulkadir, S.A. Effects of histone deacetylase inhibitor (HDACi); trichostatin-A (TSA) on the expression of housekeeping genes. Mol. Cell. Probes 2006, 20, 81–86. [Google Scholar] [CrossRef] [Scilit]
- Watanabe, M.; Ueda, T.; Shibata, Y.; Kumamoto, N.; Shimada, S.; Ugawa, S. Expression and regulation of Cav3.2 T-type calcium channels during inflammatory hyperalgesia in mouse dorsal root ganglion neurons. PLoS ONE 2015, 10, e0127572. [Google Scholar] [CrossRef] [Scilit]
- De la Rosa-Trevin, J.M.; Oton, J.; Marabini, R.; Zaldivar, A.; Vargas, J.; Carazo, J.M.; Sorzano, C.O. Xmipp 3.0: An improved software suite for image processing in electron microscopy. J. Struct. Biol. 2013, 184, 321–328. [Google Scholar] [CrossRef] [Scilit]
- Scheres, S.H. Relion: Implementation of a bayesian approach to cryo-EM structure determination. J. Struct. Biol. 2012, 180, 519–530. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Gene 1 | Oligonucleotide Sequence (5′→3′) | Amplification Size (bp) | Accession Number | Ref. |
|---|---|---|---|---|
| hCacna1g | F: GCTCTTTGGAGACCTGGAGTGT | 197 | NM_198382 | [37] |
| R: TAGGCGAGATGACCGTGTTG | ||||
| hCacna1h | F: TTGGGTTCCGTCGGTTCT | 193 | NM_001005407 | [37] |
| R: ATGCCCGTAGCCATCTTCA | ||||
| hCacna1i | F: ATCGGTTATGCTTGGATTGTCA | 203 | NM_021096 | [37] |
| R: TGCTCCCGTTGCTTGGTCTC | ||||
| hGAPDH | F: CCCATGTTCGTCATGGGTGT | 145 | NM_002046 | [38] |
| R: TGGTCATGAGTCCTTCACGATA | ||||
| mCacna1g | F: GGAGCTGGAGCTAGAGATGA | 371 | NM_009783 | [39] |
| R: CAGACAAGATGGAGCCTGACT | ||||
| mCacna1h | F: TCTCTGAGCCTCTCACGGAT | 300 | NM_021415 | [39] |
| R: GATGTGGCTGACCTCCTCAT | ||||
| mCacna1i | F: CTGGAGACCTGGATGAATGCT | 326 | NM_001044308 | [39] |
| R: CAAGAGGGTGCAGTTGACACT | ||||
| mGAPDH | F: CATGGCCTTCCGTGTTCCTA | 421 | NM_008084 | [38] |
| R: GCGGCACGTCAGATCCA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Stanek, O.; Linhartova, I.; Holubova, J.; Bumba, L.; Gardian, Z.; Malandra, A.; Bockova, B.; Teruya, S.; Horiguchi, Y.; Osicka, R.; et al. Production of Highly Active Recombinant Dermonecrotic Toxin of Bordetella Pertussis. Toxins 2020, 12, 596. https://doi.org/10.3390/toxins12090596
Stanek O, Linhartova I, Holubova J, Bumba L, Gardian Z, Malandra A, Bockova B, Teruya S, Horiguchi Y, Osicka R, et al. Production of Highly Active Recombinant Dermonecrotic Toxin of Bordetella Pertussis. Toxins. 2020; 12(9):596. https://doi.org/10.3390/toxins12090596
Chicago/Turabian StyleStanek, Ondrej, Irena Linhartova, Jana Holubova, Ladislav Bumba, Zdenko Gardian, Anna Malandra, Barbora Bockova, Shihono Teruya, Yasuhiko Horiguchi, Radim Osicka, and et al. 2020. "Production of Highly Active Recombinant Dermonecrotic Toxin of Bordetella Pertussis" Toxins 12, no. 9: 596. https://doi.org/10.3390/toxins12090596
APA StyleStanek, O., Linhartova, I., Holubova, J., Bumba, L., Gardian, Z., Malandra, A., Bockova, B., Teruya, S., Horiguchi, Y., Osicka, R., & Sebo, P. (2020). Production of Highly Active Recombinant Dermonecrotic Toxin of Bordetella Pertussis. Toxins, 12(9), 596. https://doi.org/10.3390/toxins12090596

