Maternal High Fructose Intake Increases the Vulnerability to Post-Weaning High-Fat Diet-Induced Programmed Hypertension in Male Offspring
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Model
2.2. Detection of l-Arginine, l-Citrulline, and Dimethylarginines by Performing HPLC
2.3. Quantitative Real-Time Polymerase Chain Reaction
2.4. Western Blotting
2.5. Immunohistochemistry
2.6. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Johnson, R.J.; Segal, M.S.; Sautin, Y.; Nakagawa, T.; Feig, D.I.; Kang, D.H.; Gersch, M.S.; Benner, S.; Sánchez-Lozada, L.G. Potential role of sugar (fructose) in the epidemic of hypertension, obesity and the metabolic syndrome, diabetes, kidney disease, and cardiovascular disease. Am. J. Clin. Nutr. 2007, 86, 899–906. [Google Scholar] [PubMed]
- Hanson, M.; Gluckman, P. Developmental origins of noncommunicable disease: Population and public health implications. Am. J. Clin. Nutr. 2011, 94, 1754S–1758S. [Google Scholar] [CrossRef] [PubMed]
- Kett, M.M.; Denton, K.M. Renal programming: Cause for concern? Am. J. Physiol. Regul. Integr. Comp. Physiol. 2011, 300, R791–R803. [Google Scholar] [CrossRef] [PubMed]
- Tain, Y.L.; Leu, S.; Wu, K.L.; Lee, W.C.; Chan, J.Y. Melatonin prevents maternal fructose intake-induced programmed hypertension in the offspring: Roles of nitric oxide and arachidonic acid metabolites. J. Pineal Res. 2014, 57, 80–89. [Google Scholar] [CrossRef] [PubMed]
- Tain, Y.L.; Wu, K.L.; Lee, W.C.; Leu, S.; Chan, J.Y. Maternal fructose-intake-induced renal programming in adult male offspring. J. Nutr. Biochem. 2015, 26, 642–650. [Google Scholar] [CrossRef] [PubMed]
- Tran, L.T.; Yuen, V.G.; McNeill, J.H. The fructose-fed rat: A review on the mechanisms of fructose-induced insulin resistance and hypertension. Mol. Cell Biochem. 2009, 332, 145–159. [Google Scholar] [CrossRef] [PubMed]
- Hall, W.L. Dietary saturated and unsaturated fats as determinants of blood pressure and vascular function. Nutr. Res. Rev. 2009, 22, 18–38. [Google Scholar] [CrossRef] [PubMed]
- Cervantes-Rodríguez, M.; Martínez-Gómez, M.; Cuevas, E.; Nicolás, L.; Castelán, F.; Nathanielsz, P.W.; Zambrano, E.; Rodríguez-Antolín, J. Sugared water consumption by adult offspring of mothers fed a protein-restricted diet during pregnancy results in increased offspring adiposity: The second hit effect. Br. J. Nutr. 2014, 111, 616–624. [Google Scholar] [CrossRef] [PubMed]
- Tain, Y.L.; Sheen, J.M.; Yu, H.R.; Chen, C.C.; Tiao, M.M.; Hsu, C.N.; Lin, Y.J.; Kuo, K.C.; Huang, L.T. Maternal melatonin therapy rescues prenatal dexamethasone and postnatal high-fat diet induced programmed hypertension in male rat offspring. Front. Physiol. 2015, 6, 377. [Google Scholar] [CrossRef] [PubMed]
- Tain, Y.L.; Hsu, C.N. Interplay between oxidative stress and nutrient sensing signaling in the developmental origins of cardiovascular disease. Int. J. Mol. Sci. 2017, 18, 841. [Google Scholar] [CrossRef] [PubMed]
- Tain, Y.L.; Lee, W.C.; Wu, K.L.H.; Leu, S.; Chan, J.Y.H. Targeting arachidonic acid pathway to prevent programmed hypertension in maternal fructose-fed male adult rat offspring. J. Nutr. Biochem. 2016, 38, 86–92. [Google Scholar] [CrossRef] [PubMed]
- Tain, Y.L.; Chan, J.Y.; Hsu, C.N. Maternal fructose intake affects transcriptome changes and programmed hypertension in offspring in later life. Nutrients 2016, 8, 757. [Google Scholar] [CrossRef] [PubMed]
- Efeyan, A.; Comb, W.C.; Sabatini, D.M. Nutrient-sensing mechanisms and pathways. Nature 2015, 517, 302–310. [Google Scholar] [CrossRef] [PubMed]
- Imig, J.D. Targeting epoxides for organ damage in hypertension. J. Cardiovasc. Pharmacol. 2010, 56, 329–335. [Google Scholar] [CrossRef] [PubMed]
- Morisseau, C.; Hammock, B.D. Epoxide hydrolases: Mechanisms, inhibitor designs, and biological roles. Annu. Rev. Pharmacol. Toxicol. 2005, 45, 311–333. [Google Scholar] [CrossRef] [PubMed]
- Reckelhoff, J.F. Gender differences in the regulation of blood pressure. Hypertension 2001, 37, 1199–1208. [Google Scholar] [CrossRef] [PubMed]
- Tain, Y.L.; Huang, L.T. Restoration of asymmetric dimethylarginine-nitric oxide balance to prevent the development of hypertension. Int. J. Mol. Sci. 2014, 15, 11773–11782. [Google Scholar] [CrossRef] [PubMed]
- Tain, Y.L.; Lee, W.C.; Leu, S.; Wu, K.; Chan, J. High salt exacerbates programmed hypertension in maternal fructose-fed male offspring. Nutr. Metab. Cardiovasc. Dis. 2015, 25, 1146–1151. [Google Scholar] [CrossRef] [PubMed]
- Williams, L.; Seki, Y.; Vuguin, P.M.; Charron, M.J. Animal models of in utero exposure to a high fat diet: A review. Biochim. Biophys. Acta 2014, 1842, 507–519. [Google Scholar] [CrossRef] [PubMed]
- Tain, Y.L.; Lin, Y.J.; Sheen, J.M.; Yu, H.R.; Tiao, M.M.; Chen, C.C.; Tsai, C.C.; Huang, L.T.; Hsu, C.N. High fat diets sex-specifically affect the renal transcriptome and program obesity, kidney injury, and hypertension in the offspring. Nutrients 2017, 9, 357. [Google Scholar] [CrossRef] [PubMed]
- Tain, Y.L.; Lin, Y.J.; Sheen, J.M.; Lin, I.C.; Yu, H.R.; Huang, L.T.; Hsu, C.N. Resveratrol prevents the combined maternal plus postweaning high-fat-diets-induced hypertension in male offspring. J. Nutr. Biochem. 2017, 48, 120–127. [Google Scholar] [CrossRef] [PubMed]
- Tang, X.; Chen, X.F.; Chen, H.Z.; Liu, D.P. Mitochondrial Sirtuins in cardiometabolic diseases. Clin. Sci. 2017, 131, 2063–2078. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Zhang, M.; Liang, B.; Xu, J.; Xie, Z.; Liu, C.; Viollet, B.; Yan, D.; Zou, M.H. AMPK alpha 2 deletion causes aberrant expression and activation of NAD(P)H oxidase and consequent endothelial dysfunction in vivo: Role of 26S proteasomes. Circ. Res. 2010, 106, 1117–1128. [Google Scholar] [CrossRef] [PubMed]
- Tain, Y.L.; Hsu, C.N.; Chan, J.Y. PPARs link early life nutritional insults to later programmed hypertension and metabolic syndrome. Int. J. Mol. Sci. 2015, 17, 20. [Google Scholar] [CrossRef] [PubMed]
- Tain, Y.L.; Hsu, C.N.; Chan, J.Y.; Huang, L.T. Renal transcriptome analysis of programmed hypertension induced by maternal nutritional insults. Int. J. Mol. Sci. 2015, 16, 17826–17837. [Google Scholar] [CrossRef] [PubMed]
- Usuda, D.; Kanda, T. Peroxisome proliferator-activated receptors for hypertension. World J. Cardiol. 2014, 6, 744–754. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Q.; Zhang, J.; Wang, H. PGC-1α overexpression suppresses blood pressure elevation in DOCA-salt hypertensive mice. Biosci. Rep. 2015, 35, e00217. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J. Teaching the basics of autophagy and mitophagy to redox biologists—Mechanisms and experimental approaches. Redox Biol. 2015, 4, 242–259. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward | Reverse |
---|---|---|
Sirt1 | 5 tggagcaggttgcaggaatcca 3 | 5 tggcttcatgatggcaagtggc 3 |
Sirt4 | 5 ccctttggaccatgaaaaga 3 | 5 cggatgaaatcaatgtgctg 3 |
Prkaa2 | 5 agctcgcagtggcttatcat 3 | 5 ggggctgtctgctatgagag3 |
Prkab2 | 5 cagggccttatggtcaagaa 3 | 5 cagcgcatagagatggttca 3 |
Prkag2 | 5 gtgtgggagaagctctgagg 3 | 5 agaccacacccagaagatgc 3 |
Ppara | 5 agaagttgcaggaggggatt 3 | 5 ttcttgatgacctgcacgag 3 |
Pparrb | 5 gatcagcgtgcatgtgttct 3 | 5 cagcagtccgtctttgttga 3 |
Pparg | 5 ctttatggagcctaagtttgagt 3 | 5 gttgtcttggatgtcctcg 3 |
Ppargc1a | 5 cccattgagggctgtgatct 3 | 5 tcagtgaaatgccggagtca 3 |
Nrf2 | 5 cccattgagggctgtgatct 3 | 5 tcagtgaaatgccggagtca 3 |
Ulk1 | 5 gagtacccgcaccagaatgt 3 | 5 gctgtgtagggtttccgtgt 3 |
Atg5 | 5 ttggcctactgttcgatcttctt 3 | 5 ggacagtgcagaaggtcctttt 3 |
Ephx2 | 5 cacagcctcggctttgaga 3 | 5 tcacatacccatggctgacatc 3 |
Rn18s | 5 gccgcggtaattccagctcca 3 | 5 cccgcccgctcccaagatc 3 |
Antibody | Host | Source | Product Number | Dilution |
---|---|---|---|---|
pAMPKα2 | Rabbit | Santa Cruz Biotechnology | SC-33524 | 1:1000 |
PPARα | Rabbit | Abcam plc. | ab8934 | 1:1000 |
PPARβ | Mouse | Santa Cruz Biotechnology | SC-74517 | 1:1000 |
PGC-1α | Rabbit | Santa Cruz Biotechnology | SC-13067 | 1:1000 |
SEH | Rabbit | Santa Cruz Biotechnology | SC-25797 | 1:1000 |
Groups | ND/ND | HFR/ND | HFR/HFR | HFR/HFA |
---|---|---|---|---|
Mortality | 0% | 0% | 0% | 0% |
Body weight (g) | 407 ± 8 | 398 ± 10 | 355 ± 18 a,b | 407 ± 13 |
Left kidney weight (g) | 1.96 ± 0.09 | 1.68 ± 0.05 a | 2.00 ± 0.14 | 1.57 ± 0.1 a |
Left kidney weight/100 g body weight | 0.38 ± 0.01 | 0.42 ± 0.01 | 0.58 ± 0.05 a,b | 0.39 ± 0.02 c |
Systolic blood pressure (mm Hg) | 140 ± 2 | 154 ± 4 a | 155 ± 2 a | 167 ± 5 a,b,c |
Diastolic blood pressure (mm Hg) | 82 ± 2 | 80 ± 2 | 90 ± 3 a,b | 96 ± 4 a,b |
Mean arterial pressure (mm Hg) | 101 ± 1 | 104 ± 1 | 112 ± 2 a,b | 119 ± 4 a,b,c |
Creatinine (μM) | 19.9 ± 0.6 | 16.2 ± 0.6 | 16.1 ± 1.7 | 18.3 ± 1.3 |
Groups | ND/ND | HFR/ND | HFR/HFR | HFR/HFA |
---|---|---|---|---|
l-Arginine (µM) | 288.3 ± 6.7 | 226.4 ± 9.1 | 135.1 ± 2.3 a,b | 150.3 ± 4.0 a,b |
l-Citrulline (µM) | 57.2 ± 1.1 | 48.5 ± 1.5 | 43.2 ± 1.2 | 56.6 ± 1.6 |
ADMA (µM) | 0.97 ± 0.02 | 1.06 ± 0.04 | 0.81 ± 0.01 | 0.86 ± 0.01 |
SDMA (µM) | 0.61 ± 0.01 | 0.58 ± 0.01 | 0.5 ± 0.01 | 0.52 ± 0.01 |
l-Arginine to ADMA ratio (µM/µM) | 226 ± 3 | 229 ± 11 | 167 ± 1 a,b | 175 ± 4 a,b |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tain, Y.-L.; Lee, W.-C.; Wu, K.L.H.; Leu, S.; Chan, J.Y.H. Maternal High Fructose Intake Increases the Vulnerability to Post-Weaning High-Fat Diet-Induced Programmed Hypertension in Male Offspring. Nutrients 2018, 10, 56. https://doi.org/10.3390/nu10010056
Tain Y-L, Lee W-C, Wu KLH, Leu S, Chan JYH. Maternal High Fructose Intake Increases the Vulnerability to Post-Weaning High-Fat Diet-Induced Programmed Hypertension in Male Offspring. Nutrients. 2018; 10(1):56. https://doi.org/10.3390/nu10010056
Chicago/Turabian StyleTain, You-Lin, Wei-Chia Lee, Kay L. H. Wu, Steve Leu, and Julie Y. H. Chan. 2018. "Maternal High Fructose Intake Increases the Vulnerability to Post-Weaning High-Fat Diet-Induced Programmed Hypertension in Male Offspring" Nutrients 10, no. 1: 56. https://doi.org/10.3390/nu10010056