Benzodiazepines Drive Alteration of Chromatin at the Integrated HIV-1 LTR
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Transfections
2.2. Flow Cytometry and Primary Cell Analysis
- Gag: 5′ GGTGCGAGAGCGTCAGTATTAAG 3′, 5′ AGCTCCCTGCTTGCCCATA 3′
- GAPDH: 5′ GCTCACTGGCATGGCCTTCCGTGT 3′, 5′ TGGAGGAGTGGGTGTCGCTGTTGA 3′
2.3. Nuclei Isolation and Chip Assay
2.4. Statistical Analysis
3. Results
3.1. RUNX1 Inhibition Drives Chromatin Changes at the HIV-1 LTR
3.2. Screening of Benzodiazepines (BDZs) for Improved Potency
3.3. Epigenetic Changes Driven by Alprazolam at the HIV-1 LTR
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Chun, T.W.; Stuyver, L.; Mizell, S.B.; Ehler, L.A.; Mican, J.A.; Baseler, M.; Lloyd, A.L.; Nowak, M.A.; Fauci, A.S. Presence of an inducible HIV-1 latent reservoir during highly active antiretroviral therapy. Proc. Natl. Acad. Sci. USA 1997, 94, 13193–13197. [Google Scholar] [CrossRef] [PubMed]
- Finzi, D.; Hermankova, M.; Pierson, T.; Carruth, L.M.; Buck, C.; Chaisson, R.E.; Quinn, T.C.; Chadwick, K.; Margolick, J.; Brookmeyer, R.; et al. Identification of a reservoir for HIV-1 in patients on highly active antiretroviral therapy. Science 1997, 278, 1295–1300. [Google Scholar] [CrossRef] [PubMed]
- Chun, T.W.; Engel, D.; Berrey, M.M.; Shea, T.; Corey, L.; Fauci, A.S. Early establishment of a pool of latently infected, resting CD4(+) T cells during primary HIV-1 infection. Proc. Natl. Acad. Sci. USA 1998, 95, 8869–8873. [Google Scholar] [CrossRef] [PubMed]
- Wong, J.K.; Hezareh, M.; Gunthard, H.F.; Havlir, D.V.; Ignacio, C.C.; Spina, C.A.; Richman, D.D. Recovery of replication-competent HIV despite prolonged suppression of plasma viremia. Science 1997, 278, 1291–1295. [Google Scholar] [CrossRef]
- Finzi, D.; Blankson, J.; Siliciano, J.D.; Margolick, J.B.; Chadwick, K.; Pierson, T.; Smith, K.; Lisziewicz, J.; Lori, F.; Flexner, C.; et al. Latent infection of CD4+ T cells provides a mechanism for lifelong persistence of HIV-1, even in patients on effective combination therapy. Nat. Med. 1999, 5, 512–517. [Google Scholar] [CrossRef]
- Fernandez Guerrero, M.L.; Rivas, P.; Molina, M.; Garcia, R.; de Gorgolas, M. Long-term follow-up of asymptomatic HIV-infected patients who discontinued antiretroviral therapy. Clin. Infect. Dis. 2005, 41, 390–394. [Google Scholar] [CrossRef][Green Version]
- Kim, Y.; Anderson, J.L.; Lewin, S.R. Getting the “Kill” into “Shock and Kill”: Strategies to Eliminate Latent HIV. Cell Host Microbe 2018, 23, 14–26. [Google Scholar] [CrossRef]
- Zerbato, J.M.; Purves, H.V.; Lewin, S.R.; Rasmussen, T.A. Between a shock and a hard place: Challenges and developments in HIV latency reversal. Curr. Opin. Virol. 2019, 38, 1–9. [Google Scholar] [CrossRef]
- Shan, L.; Deng, K.; Shroff, N.S.; Durand, C.M.; Rabi, S.A.; Yang, H.C.; Zhang, H.; Margolick, J.B.; Blankson, J.N.; Siliciano, R.F. Stimulation of HIV-1-specific cytolytic T lymphocytes facilitates elimination of latent viral reservoir after virus reactivation. Immunity 2012, 36, 491–501. [Google Scholar] [CrossRef]
- Margolis, D.M.; Garcia, J.V.; Hazuda, D.J.; Haynes, B.F. Latency reversal and viral clearance to cure HIV-1. Science 2016, 353, aaf6517. [Google Scholar] [CrossRef]
- Martinez-Bonet, M.; Clemente, M.I.; Serramia, M.J.; Moreno, S.; Munoz, E.; Munoz-Fernandez, M.A. Immunological and pharmacological strategies to reactivate HIV-1 from latently infected cells: A possibility for HIV-1 paediatric patients? J. Virus Erad. 2015, 1, 148–152. [Google Scholar] [PubMed]
- Leth, S.; Schleimann, M.H.; Nissen, S.K.; Hojen, J.F.; Olesen, R.; Graversen, M.E.; Jorgensen, S.; Kjaer, A.S.; Denton, P.W.; Mork, A.; et al. Combined effect of Vacc-4x, recombinant human granulocyte macrophage colony-stimulating factor vaccination, and romidepsin on the HIV-1 reservoir (REDUC): A single-arm, phase 1B/2A trial. Lancet HIV 2016, 3, e463–e472. [Google Scholar] [CrossRef]
- Rasmussen, T.A.; Tolstrup, M.; Brinkmann, C.R.; Olesen, R.; Erikstrup, C.; Solomon, A.; Winckelmann, A.; Palmer, S.; Dinarello, C.; Buzon, M.; et al. Panobinostat, a histone deacetylase inhibitor, for latent-virus reactivation in HIV-infected patients on suppressive antiretroviral therapy: A phase 1/2, single group, clinical trial. Lancet HIV 2014, 1, e13–e21. [Google Scholar] [CrossRef]
- Spivak, A.M.; Andrade, A.; Eisele, E.; Hoh, R.; Bacchetti, P.; Bumpus, N.N.; Emad, F.; Buckheit, R.; McCance-Katz, E.F.; Lai, J.; et al. A pilot study assessing the safety and latency-reversing activity of disulfiram in HIV-1-infected adults on antiretroviral therapy. Clin. Infect. Dis. 2014, 58, 883–890. [Google Scholar] [CrossRef] [PubMed]
- Spina, C.A.; Anderson, J.; Archin, N.M.; Bosque, A.; Chan, J.; Famiglietti, M.; Greene, W.C.; Kashuba, A.; Lewin, S.R.; Margolis, D.M.; et al. An in-depth comparison of latent HIV-1 reactivation in multiple cell model systems and resting CD4+ T cells from aviremic patients. PLoS Pathog. 2013, 9, e1003834. [Google Scholar] [CrossRef] [PubMed]
- Klase, Z.; Yedavalli, V.S.; Houzet, L.; Perkins, M.; Maldarelli, F.; Brenchley, J.; Strebel, K.; Liu, P.; Jeang, K.T. Activation of HIV-1 from Latent Infection via Synergy of RUNX1 Inhibitor Ro5-3335 and SAHA. PLoS Pathog. 2014, 10, e1003997. [Google Scholar] [CrossRef]
- Cunningham, L.; Finckbeiner, S.; Hyde, R.K.; Southall, N.; Marugan, J.; Yedavalli, V.R.; Dehdashti, S.J.; Reinhold, W.C.; Alemu, L.; Zhao, L.; et al. Identification of benzodiazepine Ro5-3335 as an inhibitor of CBF leukemia through quantitative high throughput screen against RUNX1-CBFbeta interaction. Proc. Natl. Acad. Sci. USA 2012, 109, 14592–14597. [Google Scholar] [CrossRef]
- Levanon, D.; Eisenstein, M.; Groner, Y. Site-directed mutagenesis supports a three-dimensional model of the runt domain. J. Mol. Biol. 1998, 277, 509–512. [Google Scholar] [CrossRef][Green Version]
- Ogawa, E.; Inuzuka, M.; Maruyama, M.; Satake, M.; Naito-Fujimoto, M.; Ito, Y.; Shigesada, K. Molecular cloning and characterization of PEBP2 beta, the heterodimeric partner of a novel Drosophila runt-related DNA binding protein PEBP2 alpha. Virology 1993, 194, 314–331. [Google Scholar] [CrossRef]
- Lichtinger, M.; Hoogenkamp, M.; Krysinska, H.; Ingram, R.; Bonifer, C. Chromatin regulation by RUNX1. Blood Cells Mol. Dis. 2010, 44, 287–290. [Google Scholar] [CrossRef]
- Huang, G.; Shigesada, K.; Ito, K.; Wee, H.J.; Yokomizo, T.; Ito, Y. Dimerization with PEBP2beta protects RUNX1/AML1 from ubiquitin-proteasome-mediated degradation. EMBO J. 2001, 20, 723–733. [Google Scholar] [CrossRef] [PubMed]
- Coffman, J.A. Runx transcription factors and the developmental balance between cell proliferation and differentiation. Cell Biol. Int. 2003, 27, 315–324. [Google Scholar] [CrossRef]
- Li, X.; Decker, M.; Westendorf, J.J. TEThered to Runx: Novel binding partners for runx factors. Blood Cells Mol. Dis. 2010, 45, 82–85. [Google Scholar] [CrossRef] [PubMed]
- Wong, W.F.; Kohu, K.; Chiba, T.; Sato, T.; Satake, M. Interplay of transcription factors in T-cell differentiation and function: The role of Runx. Immunology 2011, 132, 157–164. [Google Scholar] [CrossRef] [PubMed]
- Wee, H.J.; Voon, D.C.; Bae, S.C.; Ito, Y. PEBP2-beta/CBF-beta-dependent phosphorylation of RUNX1 and p300 by HIPK2: Implications for leukemogenesis. Blood 2008, 112, 3777–3787. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Huang, G.; Zhao, X.; Hatlen, M.A.; Vu, L.; Liu, F.; Nimer, S.D. Post-translational modifications of Runx1 regulate its activity in the cell. Blood Cells Mol. Dis. 2009, 43, 30–34. [Google Scholar] [CrossRef]
- Durst, K.L.; Hiebert, S.W. Role of RUNX family members in transcriptional repression and gene silencing. Oncogene 2004, 23, 4220–4224. [Google Scholar] [CrossRef]
- Ogawa, S.; Satake, M.; Ikuta, K. Physical and functional interactions between STAT5 and Runx transcription factors. J. Biochem. 2008, 143, 695–709. [Google Scholar] [CrossRef]
- Bosque, A.; Nilson, K.A.; Macedo, A.B.; Spivak, A.M.; Archin, N.M.; van Wagoner, R.M.; Martins, L.J.; Novis, C.L.; Szaniawski, M.A.; Ireland, C.M.; et al. Benzotriazoles Reactivate Latent HIV-1 through Inactivation of STAT5 SUMOylation. Cell Rep. 2017, 18, 1324–1334. [Google Scholar] [CrossRef]
- Nelson, B.H.; Willerford, D.M. Biology of the interleukin-2 receptor. Adv. Immunol. 1998, 70, 1–81. [Google Scholar] [CrossRef]
- Kibler, K.V.; Jeang, K.T. CREB/ATF-dependent repression of cyclin a by human T-cell leukemia virus type 1 Tax protein. J. Virol. 2001, 75, 2161–2173. [Google Scholar] [CrossRef] [PubMed]
- Heintzman, N.D.; Stuart, R.K.; Hon, G.; Fu, Y.; Ching, C.W.; Hawkins, R.D.; Barrera, L.O.; van Calcar, S.; Qu, C.; Ching, K.A.; et al. Distinct and predictive chromatin signatures of transcriptional promoters and enhancers in the human genome. Nat. Genet. 2007, 39, 311–318. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Zang, C.; Rosenfeld, J.A.; Schones, D.E.; Barski, A.; Cuddapah, S.; Cui, K.; Roh, T.Y.; Peng, W.; Zhang, M.Q.; et al. Combinatorial patterns of histone acetylations and methylations in the human genome. Nat. Genet. 2008, 40, 897–903. [Google Scholar] [CrossRef] [PubMed]
- Sardo, L.; Lin, A.; Khakhina, S.; Beckman, L.; Ricon, L.; Elbezanti, W.; Jaison, T.; Vishwasrao, H.; Shroff, H.; Janetopoulos, C.; et al. Real-time visualization of chromatin modification in isolated nuclei. J. Cell Sci. 2017, 130, 2926–2940. [Google Scholar] [CrossRef] [PubMed]
- Illendula, A.; Gilmour, J.; Grembecka, J.; Tirumala, V.S.S.; Boulton, A.; Kuntimaddi, A.; Schmidt, C.; Wang, L.; Pulikkan, J.A.; Zong, H.; et al. Small Molecule Inhibitor of CBFbeta-RUNX Binding for RUNX Transcription Factor Driven Cancers. EBioMedicine 2016, 8, 117–131. [Google Scholar] [CrossRef] [PubMed]
- Selliah, N.; Zhang, M.; DeSimone, D.; Kim, H.; Brunner, M.; Ittenbach, R.F.; Rui, H.; Cron, R.Q.; Finkel, T.H. The gammac-cytokine regulated transcription factor, STAT5, increases HIV-1 production in primary CD4 T cells. Virology 2006, 344, 283–291. [Google Scholar] [CrossRef][Green Version]
- Hsu, M.C.; Schutt, A.D.; Holly, M.; Slice, L.W.; Sherman, M.I.; Richman, D.D.; Potash, M.J.; Volsky, D.J. Inhibition of HIV replication in acute and chronic infections in vitro by a Tat antagonist. Science 1991, 254, 1799–1802. [Google Scholar] [CrossRef]
- Haubrich, R.H.; Flexner, C.; Lederman, M.M.; Hirsch, M.; Pettinelli, C.P.; Ginsberg, R.; Lietman, P.; Hamzeh, F.M.; Spector, S.A.; Richman, D.D. A randomized trial of the activity and safety of Ro 24-7429 (Tat antagonist) versus nucleoside for human immunodeficiency virus infection. The AIDS Clinical Trials Group 213 Team. J. Infect. Dis. 1995, 172, 1246–1252. [Google Scholar] [CrossRef]
- PDR. Physicians’ Desk Reference, 71st ed.; PDR Network: Montvale, NJ, USA, 2017; p. 2000. [Google Scholar]
- Enna, S.J. Goodman & Gilman’s The Pharmacological Basis of Therapeutics, 12th ed.; Brunton, L.L., Ed.; McGraw-Hill Education: New York, NY, USA, 2011. [Google Scholar]
- Klotz, U. Effects and side effects of benzodiazepines. Anasth. Intensivther. Notfallmedizin 1988, 23, 122–126. [Google Scholar] [CrossRef]
- Pfizer. XANAX. Pharmacokinetics. Absorption. 2011. Available online: http://labeling.pfizer.com/ShowLabeling.aspx?id=547 (accessed on 2 April 2019).
- ROCHE. Lexotan, Bromazepam. Pharmacokinetics, Absorption. 2009. Available online: https://gp2u.com.au/static/pdf/L/LEXOTAN-PI.pdf (accessed on 2 April 2019).
- SANOFI. Frisium, Clobazam. Pharmacokinetic Properties, Distribution. 2017. Available online: https://www.medicines.org.uk/emc/medicine/8298/SPC/Frisium+Tablets+10+mg (accessed on 2 April 2019).
- SHEET, N.Z.D. Rivotril, Clonazepam. Pharmacokinetic properties. Absorption. 2017. Available online: http://medsafe.govt.nz/profs/Datasheet/r/Rivotriltabdropinj.pdf (accessed on 2 April 2019).
- Norman, T.R.; Fulton, A.; Burrows, G.D.; Maguire, K.P. Pharmacokinetics of N-desmethyldiazepam after a single oral dose of clorazepate: The effect of smoking. Eur. J. Clin. Pharmacol. 1981, 21, 229–233. [Google Scholar] [CrossRef]
- Dhillon, S.; Oxley, J.; Richens, A. Bioavailability of diazepam after intravenous, oral and rectal administration in adult epileptic patients. Br. J. Clin. Pharmacol. 1982, 13, 427–432. [Google Scholar] [CrossRef]
- Gustavson, L.E.; Carrigan, P.J. The clinical pharmacokinetics of single doses of estazolam. Am. J. Med. 1990, 88, S2–S5. [Google Scholar] [CrossRef]
- Wickstrom, E.; Amrein, R.; Haefelfinger, P.; Hartmann, D. Pharmacokinetic and clinical observations on prolonged administration of flunitrazepam. Eur. J. Clin. Pharmacol. 1980, 17, 189–196. [Google Scholar] [CrossRef] [PubMed]
- Pfitzner, E.; Jahne, R.; Wissler, M.; Stoecklin, E.; Groner, B. p300/CREB-binding protein enhances the prolactin-mediated transcriptional induction through direct interaction with the transactivation domain of Stat5, but does not participate in the Stat5-mediated suppression of the glucocorticoid response. Mol. Endocrinol. 1998, 12, 1582–1593. [Google Scholar] [CrossRef]
- Tie, F.; Banerjee, R.; Stratton, C.A.; Prasad-Sinha, J.; Stepanik, V.; Zlobin, A.; Diaz, M.O.; Scacheri, P.C.; Harte, P.J. CBP-mediated acetylation of histone H3 lysine 27 antagonizes Drosophila Polycomb silencing. Development 2009, 136, 3131–3141. [Google Scholar] [CrossRef]
- Deng, L.; de la Fuente, C.; Fu, P.; Wang, L.; Donnelly, R.; Wade, J.D.; Lambert, P.; Li, H.; Lee, C.G.; Kashanchi, F. Acetylation of HIV-1 Tat by CBP/P300 increases transcription of integrated HIV-1 genome and enhances binding to core histones. Virology 2000, 277, 278–295. [Google Scholar] [CrossRef]
- Barbetti, V.; Gozzini, A.; Cheloni, G.; Marzi, I.; Fabiani, E.; Santini, V.; Dello Sbarba, P.; Rovida, E. Time- and residue-specific differences in histone acetylation induced by VPA and SAHA in AML1/ETO-positive leukemia cells. Epigenetics 2013, 8, 210–219. [Google Scholar] [CrossRef]
- Yu, M.; Mazor, T.; Huang, H.; Huang, H.T.; Kathrein, K.L.; Woo, A.J.; Chouinard, C.R.; Labadorf, A.; Akie, T.E.; Moran, T.B.; et al. Direct recruitment of polycomb repressive complex 1 to chromatin by core binding transcription factors. Mol. Cell 2012, 45, 330–343. [Google Scholar] [CrossRef]
- Kim, H.G.; Kim, K.C.; Roh, T.Y.; Park, J.; Jung, K.M.; Lee, J.S.; Choi, S.Y.; Kim, S.S.; Choi, B.S. Gene silencing in HIV-1 latency by polycomb repressive group. Virol. J. 2011, 8, 179. [Google Scholar] [CrossRef]
- Blackledge, N.P.; Farcas, A.M.; Kondo, T.; King, H.W.; McGouran, J.F.; Hanssen, L.L.; Ito, S.; Cooper, S.; Kondo, K.; Koseki, Y.; et al. Variant PRC1 complex-dependent H2A ubiquitylation drives PRC2 recruitment and polycomb domain formation. Cell 2014, 157, 1445–1459. [Google Scholar] [CrossRef]
- Friedman, J.; Cho, W.K.; Chu, C.K.; Keedy, K.S.; Archin, N.M.; Margolis, D.M.; Karn, J. Epigenetic silencing of HIV-1 by the histone H3 lysine 27 methyltransferase enhancer of Zeste 2. J. Virol. 2011, 85, 9078–9089. [Google Scholar] [CrossRef]
- Tripathy, M.K.; McManamy, M.E.; Burch, B.D.; Archin, N.M.; Margolis, D.M. H3K27 Demethylation at the Proviral Promoter Sensitizes Latent HIV to the Effects of Vorinostat in Ex Vivo Cultures of Resting CD4+ T Cells. J. Virol. 2015, 89, 8392–8405. [Google Scholar] [CrossRef] [PubMed]
- Filippakopoulos, P.; Picaud, S.; Fedorov, O.; Keller, M.; Wrobel, M.; Morgenstern, O.; Bracher, F.; Knapp, S. Benzodiazepines and benzotriazepines as protein interaction inhibitors targeting bromodomains of the BET family. Bioorg. Med. Chem. 2012, 20, 1878–1886. [Google Scholar] [CrossRef] [PubMed]
- Bisgrove, D.A.; Mahmoudi, T.; Henklein, P.; Verdin, E. Conserved P-TEFb-interacting domain of BRD4 inhibits HIV transcription. Proc. Natl. Acad. Sci. USA 2007, 104, 13690–13695. [Google Scholar] [CrossRef] [PubMed]
- Chaidos, A.; Caputo, V.; Karadimitris, A. Inhibition of bromodomain and extra-terminal proteins (BET) as a potential therapeutic approach in haematological malignancies: Emerging preclinical and clinical evidence. Ther. Adv. Hematol. 2015, 6, 128–141. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Guo, J.; Wu, Y.; Zhou, Q. The BET bromodomain inhibitor JQ1 activates HIV latency through antagonizing Brd4 inhibition of Tat-transactivation. Nucleic Acids Res. 2013, 41, 277–287. [Google Scholar] [CrossRef]
BDZ (Trade Name) | Common Clinical Uses | Peak Plasma Concentration (Dose Given) | Maximum Dose for Adults [39]. |
---|---|---|---|
Alprazolam (XANAX) | Anxiolytic | 0.0259 to 0.119 μM a (0.5 – 3.0 mg) | 10 mg/day |
Bromazepam (LECTOPAM) | Anxiolytic | 0.44 μM b (12 mg) | --- |
Clobazam (ONFI) | Anxiolytic, anticonvulsant | 0.73 to 2.3 μM c (20 mg) | 40 mg/day |
Clonazepam (KLONOPIN) | Anxiolytic, anticonvulsant | 0.17 μM d (2 mg) | 20 mg/day |
Clorazepate (TRANEXENE) | Anxiolytic | 1.3 μM e (20 mg) | 90 mg/day |
Diazepam (VALIUM) | Anxiolytic | 1.16 μM f (10 mg) | 40 mg/day |
Estazolam (PROSOM) | Hypnotic | 0.335 μM g (2 mg) | 2 mg/day |
Flunitrazepam (ROHYPNOL) | Hypnotic | 0.047 μM h (2 mg) | --- |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Elbezanti, W.; Lin, A.; Schirling, A.; Jackson, A.; Marshall, M.; Duyne, R.V.; Maldarelli, F.; Sardo, L.; Klase, Z. Benzodiazepines Drive Alteration of Chromatin at the Integrated HIV-1 LTR. Viruses 2020, 12, 191. https://doi.org/10.3390/v12020191
Elbezanti W, Lin A, Schirling A, Jackson A, Marshall M, Duyne RV, Maldarelli F, Sardo L, Klase Z. Benzodiazepines Drive Alteration of Chromatin at the Integrated HIV-1 LTR. Viruses. 2020; 12(2):191. https://doi.org/10.3390/v12020191
Chicago/Turabian StyleElbezanti, Weam, Angel Lin, Alexis Schirling, Alexandria Jackson, Matthew Marshall, Rachel Van Duyne, Frank Maldarelli, Luca Sardo, and Zachary Klase. 2020. "Benzodiazepines Drive Alteration of Chromatin at the Integrated HIV-1 LTR" Viruses 12, no. 2: 191. https://doi.org/10.3390/v12020191
APA StyleElbezanti, W., Lin, A., Schirling, A., Jackson, A., Marshall, M., Duyne, R. V., Maldarelli, F., Sardo, L., & Klase, Z. (2020). Benzodiazepines Drive Alteration of Chromatin at the Integrated HIV-1 LTR. Viruses, 12(2), 191. https://doi.org/10.3390/v12020191