Nanoscale Structure Determination of Murray Valley Encephalitis and Powassan Virus Non-Coding RNAs
Abstract
1. Introduction
2. Materials and Methods
2.1. RNA Preparation and Purification
- MVEV 5TR 1-96nt5’GGAGACGUUCAUCUGCGUGAGCUUCCGAUCUCAGUAUUGUUUGGAAGGAUCAUUGAUUAACGCGGUUUGAACAGUUUUUUGGAGCUUUUGAUUUCAAU3’
- MVEV 3TR 10914-110145’GGCCUGGGAAAAGACUAGGAGAUCUUCUGCUCUAUUCCAACAUCAGUCACAAGGCACCGAGCGCCGAACACUGUGACUGAUGGGGGAGAAGACCACAGGAUCUU3’
- POWV 5TR 1-1115’GGAGAUUUUCUUGCACGUGUGUGCGGGUGCUUUAGUCAGUGUCCGCAGCGUUCUGUUGAACGUGAGUGUGUUGAGAAAAAGACAGCUUAGGAGAACAAGAGCUGGGAGUGGUUU3’
- POWV 3TR 10735-108395’GGCCCCCAGGAAACUGGGGGGGCGGUUCUUGUUCUCCCUGAGCCACCACCAUCCAGGCACAGAUAGCCUGACAAGGAGAUGGUGUGUGACUCGGAAAAACACCCGCUU3’
2.2. Analytical Ultracentrifugation (AUC)
2.3. Small-Angle X-ray Scattering (SAXS)
2.4. Atomic Structures Calculations
3. Results
3.1. Purification of In-Vitro Transcribed RNA
3.2. Homogeneity Studies of RNA
3.3. Low-Resolution Structural Studies of RNAs
3.4. Computational Modeling of RNA Structures
3.5. Combination of Computational Modeling and Experimental Low-Resolution SAXS Structures
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Fernández-Sanlés, A.; Ríos-Marco, P.; Romero-López, C.; Berzal-Herranz, A. Functional Information Stored in the Conserved Structural RNA Domains of Flavivirus Genomes. Front. Microbiol. 2017, 8, 546. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.Y.; Chen, W.N.; Poon, K.M.; Zheng, B.J.; Lin, X.; Wang, Y.X.; Wen, Y.M. Interaction between SARS-CoV helicase and a multifunctional cellular protein (Ddx5) revealed by yeast and mammalian cell two-hybrid systems. Arch. Virol. 2009, 154, 507–512. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, S.; Ge, X.; Wang, X.; Liu, A.; Guo, X.; Zhou, L.; Yu, K.; Yang, H. The DEAD-box RNA helicase 5 positively regulates the replication of porcine reproductive and respiratory syndrome virus by interacting with viral Nsp9 in vitro. Virus Res. 2015, 195, 217–224. [Google Scholar] [CrossRef] [Scilit]
- Li, C.; Ge, L.L.; Li, P.P.; Wang, Y.; Dai, J.J.; Sun, M.X.; Huang, L.; Shen, Z.Q.; Hu, X.C.; Ishag, H.; et al. Cellular DDX3 regulates Japanese encephalitis virus replication by interacting with viral un-translated regions. Virology 2014, 449, 70–81. [Google Scholar] [CrossRef] [Scilit]
- Selvey, L.A.; Dailey, L.; Lindsay, M.; Armstrong, P.; Tobin, S.; Koehler, A.P.; Markey, P.G.; Smith, D.W. The changing epidemiology of Murray Valley encephalitis in Australia: The 2011 outbreak and a review of the literature. PLoS Negl. Trop. Dis. 2014, 8, e2656. [Google Scholar] [CrossRef] [Scilit]
- Mackenzie, J.S.; Lindsay, M.D.; Coelen, R.J.; Broom, A.K.; Hall, R.A.; Smith, D.W. Arboviruses causing human disease in the Australasian zoogeographic region. Arch. Virol. 1994, 136, 447–467. [Google Scholar] [CrossRef] [Scilit]
- Floridis, J.; McGuinness, S.L.; Kurucz, N.; Burrow, J.N.; Baird, R.; Francis, J.R. Murray Valley Encephalitis Virus: An Ongoing Cause of Encephalitis in Australia’s North. Trop. Med. Infect. Dis. 2018, 3, 49. [Google Scholar] [CrossRef] [Scilit]
- Bennett, N. Murray Valley encephalitis: Indeed a “mysterious disease“. Vic. Inf. Dis. Bull. 2008, 11, 94–107. [Google Scholar]
- Niven, D.J.; Afra, K.; Iftinca, M.; Tellier, R.; Fonseca, K.; Kramer, A.; Safronetz, D.; Holloway, K.; Drebot, M.; Johnson, A.S. Fatal Infection with Murray Valley Encephalitis Virus Imported from Australia to Canada, 2011. Emerg. Infect. Dis. 2017, 23, 280–283. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Knox, J.; Cowan, R.U.; Doyle, J.S.; Ligtermoet, M.K.; Archer, J.S.; Burrow, J.N.; Tong, S.Y.; Currie, B.J.; Mackenzie, J.S.; Smith, D.W.; et al. Murray Valley encephalitis: A review of clinical features, diagnosis and treatment. Med. J. Aust. 2012, 196, 322–326. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kazimírová, M.; Thangamani, S.; Bartíková, P.; Hermance, M.; Holíková, V.; Štibrániová, I.; Nuttall, P.A. Tick-borne viruses and biological processes at the tick-host-virus interface. Front. Cell. Infect. Microbiol. 2017, 7, 339. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fatmi, S.S.; Zehra, R.; Carpenter, D.O. Powassan virus—A new reemerging tick-borne disease. Front. Public Health 2017, 5, 342. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McLean, D.M.; McQueen, E.J.; Petite, H.E.; MacPherson, L.W.; Scholten, T.H.; Ronald, K. Powassan virus: Field investigations in northern Ontario, 1959 to 1961. Can. Med. Assoc. J. 1962, 86, 971. [Google Scholar] [PubMed]
- Anderson, J.F.; Armstrong, P.M. Prevalence and genetic characterization of Powassan virus strains infecting Ixodes scapularis in Connecticut. Am. J. Trop. Med. Hyg. 2012, 87, 754–759. [Google Scholar] [CrossRef] [Scilit]
- Chambers, T.J.; Hahn, C.S.; Galler, R.; Rice, C.M. Flavivirus Genome Organization, Expression, and Replication. Annu. Rev. Microbiol. 1990, 44, 649–688. [Google Scholar] [CrossRef]
- Brinton, M.A. Replication cycle and molecular biology of the West Nile virus. Viruses 2013, 6, 13–53. [Google Scholar] [CrossRef] [Scilit]
- Brinton, M.A.; Basu, M. Functions of the 3’ and 5’ genome RNA regions of members of the genus Flavivirus. Virus Res. 2015, 206, 108–119. [Google Scholar] [CrossRef] [Scilit]
- Brinton, M.A.; Fernandez, A.V.; Dispoto, J.H. The 3’-nucleotides of flavivirus genomic RNA form a conserved secondary structure. Virology 1986, 153, 113–121. [Google Scholar] [CrossRef] [Scilit]
- Ariumi, Y. Multiple functions of DDX3 RNA helicase in gene regulation, tumorigenesis, and viral infection. Front. Genet. 2014, 5, 423. [Google Scholar] [CrossRef] [Scilit]
- Li, C.; Ge, L.L.; Li, P.P.; Wang, Y.; Sun, M.X.; Huang, L.; Ishag, H.; Di, D.D.; Shen, Z.Q.; Fan, W.X.; et al. The DEAD-box RNA helicase DDX5 acts as a positive regulator of Japanese encephalitis virus replication by binding to viral 3’ UTR. Antivir. Res. 2013, 100, 487–499. [Google Scholar] [CrossRef] [Scilit]
- Tingting, P.; Caiyun, F.; Zhigang, Y.; Pengyuan, Y.; Zhenghong, Y. Subproteomic analysis of the cellular proteins associated with the 3′ untranslated region of the hepatitis C virus genome in human liver cells. Biochem. Biophys. Res. Commun. 2006, 347, 683–691. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deo, S.; Patel, T.R.; Chojnowski, G.; Koul, A.; Dzananovic, E.; McEleney, K.; Bujnicki, J.M.; McKenna, S.A. Characterization of the termini of the West Nile virus genome and their interactions with the small isoform of the 2’ 5’-oligoadenylate synthetase family. J. Struct. Biol. 2015, 190, 236–249. [Google Scholar] [CrossRef] [Scilit]
- Alvarez, D.E.; Lodeiro, M.F.; Luduena, S.J.; Pietrasanta, L.I.; Gamarnik, A.V. Long-range RNA-RNA interactions circularize the dengue virus genome. J. Virol. 2005, 79, 6631–6643. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Villordo, S.M.; Gamarnik, A.V. Genome cyclization as strategy for flavivirus RNA replication. Virus Res. 2009, 139, 230–239. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Westaway, E.G. Flavivirus replication strategy. Adv. Virus Res. 1987, 33, 45–90. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deo, S.; Patel, T.R.; Dzananovic, E.; Booy, E.P.; Zeid, K.; McEleney, K.; Harding, S.E.; McKenna, S.A. Activation of 2’ 5’-oligoadenylate synthetase by stem loops at the 5’-end of the West Nile virus genome. PLoS ONE 2014, 9, e92545. [Google Scholar] [CrossRef] [Scilit]
- Meier-Stephenson, V.; Mrozowich, T.; Pham, M.; Patel, T.R. DEAD-box helicases: The Yin and Yang roles in viral infections. Biotechnol. Genet. Eng. Rev. 2018, 34, 3–32. [Google Scholar] [CrossRef] [Scilit]
- Ward, A.M.; Bidet, K.; Yinglin, A.; Ler, S.G.; Hogue, K.; Blackstock, W.; Gunaratne, J.; Garcia-Blanco, M.A. Quantitative mass spectrometry of DENV-2 RNA-interacting proteins reveals that the DEAD-box RNA helicase DDX6 binds the DB1 and DB2 3’ UTR structures. RNA Biol. 2011, 8, 1173–1186. [Google Scholar] [CrossRef] [Scilit]
- Valiente-Echeverria, F.; Hermoso, M.A.; Soto-Rifo, R. RNA helicase DDX3: At the crossroad of viral replication and antiviral immunity. Rev. Med. Virol. 2015, 25, 286–299. [Google Scholar] [CrossRef] [Scilit]
- Dzananovic, A.; Chojnowski, G.; Deo, S.; Booy, E.P.; Padilla-Meier, P.; McEleney, K.; Bujnicki, J.M.; Patel, T.R.; McKenna, S.A. Impact of the structural integrity of the three-way junction of adenovirus VAI RNA on PKR inhibition. PLoS ONE 2017, 12, e0186849. [Google Scholar] [CrossRef] [Scilit]
- Dzananovic, E.; Patel, T.R.; Chojnowski, G.; Boniecki, M.J.; Deo, S.; McEleney, K.; Harding, S.E.; Bujnicki, J.M.; McKenna, S.A. Solution conformation of adenovirus virus associated RNA-I and its interaction with PKR. J. Struct. Biol. 2014, 185, 48–57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dzananovic, E.; Patel, T.R.; Deo, S.; McEleney, K.; Stetefeld, J.; McKenna, S.A. Recognition of viral RNA stem-loops by the tandem double-stranded RNA binding domains of PKR. RNA 2013, 19, 333–344. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.-L.; Lee, T.; Elber, R.; Pollack, L. Conformations of an RNA Helix-Junction-Helix Construct Revealed by SAXS Refinement of MD Simulations. Biophys. J. 2019, 116, 19–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.; Pollack, L. SAXS studies of RNA: Structures, dynamics, and interactions with partners. Wiley Interdiscip. Rev. RNA 2016, 7, 512–526. [Google Scholar] [CrossRef] [Scilit]
- Demeler, B.; Gorbet, G.E. Analytical Ultracentrifugation Data Analysis with UltraScan-III. In Analytical Ultracentrifugation: Instrumentation, Software, and Applications; Uchiyama, S., Arisaka, F., Stafford, W.F., Laue, T., Eds.; Springer: Tokyo, Japan, 2016; pp. 119–143. [Google Scholar] [CrossRef] [Scilit]
- Brookes, E.; Cao, W.; Demeler, B. A two-dimensional spectrum analysis for sedimentation velocity experiments of mixtures with heterogeneity in molecular weight and shape. Eur. Biophys. J. 2010, 39, 405–414. [Google Scholar] [CrossRef] [Scilit]
- Demeler, B.; van Holde, K.E. Sedimentation velocity analysis of highly heterogeneous systems. Anal. Biochem. 2004, 335, 279–288. [Google Scholar] [CrossRef] [Scilit]
- Brookes, E.; Demeler, B. Parsimonious Regularization Using Genetic Algorithms Applied to the Analysis of Analytical Ultracentrifugation Experiments; Association for Computing Machinery: New York, NY, USA, 2007; pp. 361–368. [Google Scholar] [CrossRef] [Scilit]
- Demeler, B.; Brookes, E. Monte Carlo analysis of sedimentation experiments. Colloid Polym. Sci. 2008, 286, 129–137. [Google Scholar] [CrossRef] [Scilit]
- Meier, M.; Moya, A.; Krahn, N.; McDougall, M.; McRae, E.K.; Booy, E.P.; Patel, T.R.; McKenna, S.A.; Stetefeld, J. Structure and hydrodynamics of a DNA G-quadruplex with a cytosine bulge. Nucleic Acids Res. 2018, 46, 5319–5331. [Google Scholar] [CrossRef] [Scilit]
- Konarev, P.V.; Volkov, V.V.; Sokolova, A.V.; Koch, M.H.J.; Svergun, D.I. PRIMUS: A Windows PC-based system for small-angle scattering data analysis. J. Appl. Crystallogr. 2003, 36, 1277–1282. [Google Scholar] [CrossRef] [Scilit]
- Rambo, R. ScÅtter, A JAVA-Based Application for Basic Analysis of SAXS Datasets; Diamond Light Source: Didxot, UK, 2017. [Google Scholar]
- Majdi Yazdi, M.; Saran, S.; Mrozowich, T.; Lehnert, C.; Patel, T.R.; Sanders, D.A.R.; Palmer, D.R.J. Asparagine-84, a regulatory allosteric site residue, helps maintain the quaternary structure of Campylobacter jejuni dihydrodipicolinate synthase. J. Struct. Biol. 2019, 209, 107409. [Google Scholar] [CrossRef] [Scilit]
- Guinier, A.; Fourner, G. Small Angle Scattering of X-rays; Wiley: New York, NY, USA, 1955. [Google Scholar]
- Durand, D.; Vives, C.; Cannella, D.; Perez, J.; Pebay-Peyroula, E.; Vachette, P.; Fieschi, F. NADPH oxidase activator p67(phox) behaves in solution as a multidomain protein with semi-flexible linkers. J. Struct. Biol. 2010, 169, 45–53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patel, T.R.; Chojnowski, G.; Koul, A.; McKenna, S.A.; Bujnicki, J.M. Structural studies of RNA-protein complexes: A hybrid approach involving hydrodynamics, scattering, and computational methods. Methods 2017, 118, 146–162. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Svergun, D. Determination of the regularization parameter in indirect-transform methods using perceptual criteria. J. Appl. Crystallogr. 1992, 25, 495–503. [Google Scholar] [CrossRef] [Scilit]
- Svergun, D.I. Restoring low resolution structure of biological macromolecules from solution scattering using simulated annealing. Biophys. J. 1999, 76, 2879–2886. [Google Scholar] [CrossRef] [Scilit]
- Reuten, R.; Patel, T.R.; McDougall, M.; Rama, N.; Nikodemus, D.; Gibert, B.; Delcros, J.-G.; Prein, C.; Meier, M.; Metzger, S.; et al. Structural decoding of netrin-4 reveals a regulatory function towards mature basement membranes. Nat. Commun. 2016, 7, 13515. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Volkov, V.V.; Svergun, D.I. Uniqueness of ab initio shape determination in small-angle scattering. J. Appl. Crystallogr. 2003, 36, 860–864. [Google Scholar] [CrossRef] [Scilit]
- Patel, T.R.; Bernards, C.; Meier, M.; McEleney, K.; Winzor, D.J.; Koch, M.; Stetefeld, J. Structural elucidation of full-length nidogen and the laminin-nidogen complex in solution. Matrix Biol. 2014, 33, 60–67. [Google Scholar] [CrossRef] [Scilit]
- Parisien, M.; Major, F. The MC-Fold and MC-Sym pipeline infers RNA structure from sequence data. Nature 2008, 452, 51–55. [Google Scholar] [CrossRef] [Scilit]
- Svergun, D.; Barberato, C.; Koch, M.H.J. CRYSOL—A program to evaluate x-ray solution scattering of biological macromolecules from atomic coordinates. J. Appl. Crystallogr. 1995, 28, 768–773. [Google Scholar] [CrossRef] [Scilit]
- Kozin, M.B.; Svergun, D.I. Automated matching of high- and low-resolution structural models. J. Appl. Crystallogr. 2001, 34, 33–41. [Google Scholar] [CrossRef] [Scilit]
- Darty, K.; Denise, A.; Ponty, Y. VARNA: Interactive drawing and editing of the RNA secondary structure. Bioinformatics 2009, 25, 1974–1975. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patel, T.R.; Winzor, D.J.; Scott, D.J. Analytical ultracentrifugation: A versatile tool for the characterisation of macromolecular complexes in solution. Methods 2016, 95, 55–61. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brosey, C.A.; Tainer, J.A. Evolving SAXS versatility: Solution X-ray scattering for macromolecular architecture, functional landscapes, and integrative structural biology. Curr. Opin. Struct. Biol. 2019, 58, 197–213. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Perez, J.; Vachette, P. A Successful Combination: Coupling SE-HPLC with SAXS. Adv. Exp. Med. Biol. 2017, 1009, 183–199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Svergun, D.I.; Koch, M.H.J. Small-angle scattering studies of biological macromolecules in solution. Rep. Prog. Phys. 2003, 66, 1735–1782. [Google Scholar] [CrossRef] [Scilit]
- Demeler, B. UltraScan A Comprehensive Data Analysis Software Package for Analytical Ultracentrifugation Experiments. In Modern Analytical Ultracentrifugation: Techniques and Methods; Scott, D.J., Harding, S.E., Rowe, A.J., Eds.; Royal Society of Chemistry: London, UK, 2005; pp. 210–229. [Google Scholar]
- Unzai, S. Analytical ultracentrifugation in structural biology. Biophys. Rev. 2018, 10, 229–233. [Google Scholar] [CrossRef] [Scilit]
- Uchiyama, S.; Noda, M.; Krayukhina, E. Sedimentation velocity analytical ultracentrifugation for characterization of therapeutic antibodies. Biophys. Rev. 2018, 10, 259–269. [Google Scholar] [CrossRef] [Scilit]
- Kim, D.N.; Thiel, B.C.; Morozwich, T.; Hennelly, S.P.; Hofacket, I.L.; Patel, T.R.; Sanbonmatsu, K.Y. Zinc-finger protein CNBP alters the 3-D structure of lncRNA Braveheart in solution. Nat. Commun. 2020, 11, 148. [Google Scholar] [CrossRef] [Scilit]
- Patel, T.R.; Meier, M.; Li, J.; Morris, G.; Rowe, A.J.; Stetefeld, J. T-shaped arrangement of the recombinant agrin G3-IgG Fc protein. Protein Sci. 2011, 20, 931–940. [Google Scholar] [CrossRef] [Scilit]
- Krahn, N.; Meier, M.; To, V.; Booy, E.P.; McEleney, K.; O’Neil, J.D.; McKenna, S.A.; Patel, T.R.; Stetefeld, J. Nanoscale Assembly of High-Mobility Group AT-Hook 2 Protein with DNA Replication Fork. Biophys. J. 2017, 113, 2609–2620. [Google Scholar] [CrossRef] [Scilit]
- Ochsenreiter, R.; Hofacker, I.L.; Wolfinger, M.T. Functional RNA Structures in the 3’UTR of Tick-Borne, Insect-Specific and No-Known-Vector Flaviviruses. Viruses 2019, 11, 298. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, X.; Liu, Y.; Zhang, Q.; Zhang, B.; Xia, H.; Yuan, Z. Homologous RNA secondary structure duplications in 3’ untranslated region influence subgenomic RNA production and replication of dengue virus. Virology 2018, 524, 114–126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kasprzak, W.K.; Shapiro, B.A. MPGAfold in dengue secondary structure prediction. Methods Mol. Biol. 2014, 1138, 199–224. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Zhang, Y.; Liu, Z.Y.; Cheng, M.L.; Ma, J.; Wang, Y.; Qin, C.F.; Fang, X. Long non-coding subgenomic flavivirus RNAs have extended 3D structures and are flexible in solution. EMBO Rep. 2019, 20, e47016. [Google Scholar] [CrossRef] [Scilit]
- Zettl, T.; Mathew, R.S.; Shi, X.; Doniach, S.; Herschlag, D.; Harbury, P.A.B.; Lipfert, J. Gold nanocrystal labels provide a sequence-to-3D structure map in SAXS reconstructions. Sci. Adv. 2018, 4, eaar4418. [Google Scholar] [CrossRef] [Scilit]
- Barrows, N.J.; Campos, R.K.; Liao, K.C.; Prasanth, K.R.; Soto-Acosta, R.; Yeh, S.C.; Schott-Lerner, G.; Pompon, J.; Sessions, O.M.; Bradrick, S.S.; et al. Biochemistry and Molecular Biology of Flaviviruses. Chem. Rev. 2018, 118, 4448–4482. [Google Scholar] [CrossRef] [Scilit]
- Meyer, A.; Freier, M.; Schmidt, T.; Rostowski, K.; Zwoch, J.; Lilie, H.; Behrens, S.E.; Friedrich, S. An RNA Thermometer Activity of the West Nile Virus Genomic 3’-Terminal Stem-Loop Element Modulates Viral Replication Efficiency during Host Switching. Viruses 2020, 12, 104. [Google Scholar] [CrossRef] [Scilit]







| Sample | MVEV 5’TR | MVEV 3’TR | PowV 5’TR | PowV 3’TR |
|---|---|---|---|---|
| Mw (kDa, sequence) | 31.38 | 31.57 | 36.92 | 37.80 |
| Sedimentation coefficient (S)∇ | 4.27 (4.08, 4.46) | 4.30 (4.20, 4.41) | 4.50 (4.42, 4.55) | 4.53 (4.52, 4.53) |
| I(0)# | 0.0098 ± 4.7 × 105 | 0.019 ± 1.4 × 105 | 0.019 ± 6.7 × 105 | 0.034 ± 8.2 × 105 |
| q.Rg range | 0.38 – 1.26 | 0.59 – 1.26 | 0.34 – 1.26 | 0.47 – 1.29 |
| Rg (Å)# | 29.01 ± 0.22 | 45.72 ± 0.48 | 34.65 ± 0.19 | 35.84 ± 0.13 |
| I(0)#∆ | 0.098 ± 3.8 × 105 | 0.018 ± 8.1 × 105 | 0.019 ± 4.2 × 105 | 0.034 ± 8.9 × 105 |
| Rg (Å)∆ | 30.16 ± 0.11 | 46.16 ± 0.18 | 34.48 ± 0.06 | 38.39 ± 0.08 |
| Dmax (Å) ∆ | 100 | 150 | 105 | 130 |
| χ2* | ~0.78 | ~0.83 | ~0.78 | ~0.80 |
| NSD * | 0.71 ± 0.01 | 0.80 ± 0.02 | 0.85 ± 0.02 | 0.72 ± 0.01 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mrozowich, T.; Henrickson, A.; Demeler, B.; Patel, T.R. Nanoscale Structure Determination of Murray Valley Encephalitis and Powassan Virus Non-Coding RNAs. Viruses 2020, 12, 190. https://doi.org/10.3390/v12020190
Mrozowich T, Henrickson A, Demeler B, Patel TR. Nanoscale Structure Determination of Murray Valley Encephalitis and Powassan Virus Non-Coding RNAs. Viruses. 2020; 12(2):190. https://doi.org/10.3390/v12020190
Chicago/Turabian StyleMrozowich, Tyler, Amy Henrickson, Borries Demeler, and Trushar R Patel. 2020. "Nanoscale Structure Determination of Murray Valley Encephalitis and Powassan Virus Non-Coding RNAs" Viruses 12, no. 2: 190. https://doi.org/10.3390/v12020190
APA StyleMrozowich, T., Henrickson, A., Demeler, B., & Patel, T. R. (2020). Nanoscale Structure Determination of Murray Valley Encephalitis and Powassan Virus Non-Coding RNAs. Viruses, 12(2), 190. https://doi.org/10.3390/v12020190

