Peste des Petits Ruminants Virus-Like Particles Induce a Potent Humoral and Cellular Immune Response in Goats
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Viruses
2.2. Construction of Bacmid Transfer Plasmid
2.3. Generation of Recombinant Baculoviruses
2.4. Immunofluorescence Assay (IFA)
2.5. Construction and Purification of Virus-Like Particles
2.6. Detection of Protein by Western Blot Analyses
2.7. Electron and Immuno-Electron Microscopy
2.8. Immunization of Mice and Goats and Sera Collection
2.9. ELISA for Antibody Subtype Detection
2.10. Virus Neutralization Test (VNT)
2.11. IFN-γ and IL-4 Enzyme-Linked Immunospot Assays (ELISpot)
2.12. Flow Cytometry Assays for Intracellular Cytokine Staining (ICS)
2.13. Flow Cytometry Assays for B Cells and DCs
2.14. ELISA for PPRV-Specific Antibody and Cytokine in Goat Sera
2.15. Data Analysis
3. Results
3.1. Generation and Characterization of PPRV VLPs
3.2. Characterization of the Humoral Immune Response to PPRV VLPs in Mice
3.3. Characterization of the Cellular Immune Response to PPRV VLPs in Mice
3.4. Characterization of the Humoral Immune Response to PPRV VLPs in Goats
3.5. Characterization of the Cytokine Response to PPRV VLPs in Goats
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Kumar, N.; Maherchandani, S.; Kashyap, S.K.; Singh, S.V.; Sharma, S.; Chaubey, K.K.; Ly, H. Peste des petits ruminants virus infection of small ruminants: A comprehensive review. Viruses 2014, 6, 2287–2327. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gibbs, E.P.; Taylor, W.P.; Lawman, M.J.; Bryant, J. Classification of peste des petits ruminants virus as the fourth member of the genus Morbillivirus. Intervirology 1979, 11, 268–274. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dhar, P.; Sreenivasa, B.P.; Barrett, T.; Corteyn, M.; Singh, R.P.; Bandyopadhyay, S.K. Recent epidemiology of peste des petits ruminants virus (PPRV). Vet. Microbiol. 2002, 88, 153–159. [Google Scholar] [CrossRef] [Scilit]
- Couacy-Hymann, E.; Roger, F.; Hurard, C.; Guillou, J.P.; Libeau, G.; Diallo, A. Rapid and sensitive detection of peste des petits ruminants virus by a polymerase chain reaction assay. J. Virol. Methods 2002, 100, 17–25. [Google Scholar] [CrossRef] [Scilit]
- Woo, P.C.; Lau, S.K.; Wong, B.H.; Fan, R.Y.; Wong, A.Y.; Zhang, A.J.; Wu, Y.; Choi, G.K.; Li, K.S.; Hui, J.; et al. Feline morbillivirus, a previously undescribed paramyxovirus associated with tubulointerstitial nephritis in domestic cats. Proc. Natl. Acad. Sci. USA 2012, 109, 5435–5440. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bourdin, P.; Laurent-Vautier, A. Note on the structure of the small ruminant pest virus. Rev. Elev. Med. Vet. Pays. Trop. 1967, 20, 383–385. [Google Scholar] [CrossRef] [Scilit]
- Bailey, D.; Banyard, A.; Dash, P.; Ozkul, A.; Barrett, T. Full genome sequence of peste des petits ruminants virus, a member of the Morbillivirus genus. Virus Res. 2005, 110, 119–124. [Google Scholar] [CrossRef] [Scilit]
- Rahaman, A.; Srinivasan, N.; Shamala, N.; Shaila, M.S. The fusion core complex of the peste des petits ruminants virus is a six-helix bundle assembly. Biochemistry 2003, 42, 922–931. [Google Scholar] [CrossRef] [Scilit]
- Haffar, A.; Libeau, G.; Moussa, A.; Cécile, M.; Diallo, A. The matrix protein gene sequence analysis reveals close relationship between peste des petits ruminants virus (PPRV) and dolphin morbillivirus. Virus Res. 1999, 64, 69–75. [Google Scholar] [CrossRef] [Scilit]
- Sinnathamby, G.; Renukaradhya, G.J.; Rajasekhar, M.; Nayak, R.; Shaila, M.S. Immune responses in goats to recombinant hemagglutinin-neuraminidase glycoprotein of Peste des petits ruminants virus: Identification of a T cell determinant. Vaccine 2001, 19, 4816–4823. [Google Scholar] [CrossRef] [Scilit]
- Dechamma, H.J.; Dighe, V.; Kumar, C.A.; Singh, R.P.; Jagadish, M.; Kumar, S. Identification of T-helper and linear B epitope in the hypervariable region of nucleocapsid protein of PPRV and its use in the development of specific antibodies to detect viral antigen. Vet. Microbiol. 2006, 118, 201–211. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rahman, M.M.; Shaila, M.S.; Gopinathan, K.P. Baculovirus display of fusion protein of Peste des petits ruminants virus and hemagglutination protein of Rinderpest virus and immunogenicity of the displayed proteins in mouse model. Virology 2003, 317, 36–49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Diallo, A.; Minet, C.; Le Goff, C.; Berhe, G.; Albina, E.; Libeau, G.; Barrett, T. The threat of peste des petits ruminants: Progress in vaccine development for disease control. Vaccine 2007, 25, 5591–5597. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Renukaradhya, G.J.; Sinnathamby, G.; Seth, S.; Rajasekhar, M.; Shaila, M.S. Mapping of B-cell epitopic sites and delineation of functional domains on the hemagglutinin-neuraminidase protein of peste des petits ruminants virus. Virus Res. 2002, 90, 171–185. [Google Scholar] [CrossRef] [Scilit]
- Mitra-Kaushik, S.; Nayak, R.; Shaila, M.S. Identification of a cytotoxic T-cell epitope on the recombinant nucleocapsid proteins of Rinderpest and Peste des petits ruminants viruses presented as assembled nucleocapsids. Virology 2001, 279, 210–220. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sinnathamby, G.; Seth, S.; Nayak, R.; Shaila, M.S. Cytotoxic T cell epitope in cattle from the attachment glycoproteins of rinderpest and peste des petits ruminants viruses. Viral Immunol. 2004, 17, 401–410. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wani, S.A.; Sahu, A.R.; Saxena, S.; Rajak, K.K.; Saminathan, M.; Sahoo, A.P.; Kanchan, S.; Pandey, A.; Mishra, B.; Muthuchelvan, D. Expression kinetics of ISG15, IRF3, IFNgamma, IL10, IL2 and IL4 genes vis-a-vis virus shedding, tissue tropism and antibody dynamics in PPRV vaccinated, challenged, infected sheep and goats. Microb. Pathog. 2018, 117, 206–218. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Banyard, A.C.; Wang, Z.; Parida, S. Peste des petits ruminants virus, eastern Asia. Emerg. Infect. Dis. 2014, 20, 2176–2178. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, F.; Li, J.; Li, L.; Liu, Y.; Wu, X.; Wang, Z. Peste des petits ruminants in China since its first outbreak in 2007: A 10-year review. Transbound Emerg. Dis. 2018, 65, 638–648. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Wang, M.; Wang, S.; Liu, Z.; Shen, N.; Si, W.; Sun, G.; Drewe, J.A.; Cai, X. Peste des petits ruminants virus in Heilongjiang province, China, 2014. Emerg. Infect. Dis. 2015, 21, 677–680. [Google Scholar] [CrossRef] [Scilit]
- Saravanan, P.; Sen, A.; Balamurugan, V.; Rajak, K.K.; Bhanuprakash, V.; Palaniswami, K.S.; Nachimuthu, K.; Thangavelu, A.; Dhinakarraj, G.; Hegde, R.; et al. Comparative efficacy of peste des petits ruminants (PPR) vaccines. Biologicals 2010, 38, 479–485. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sen, A.; Saravanan, P.; Balamurugan, V.; Rajak, K.K.; Sudhakar, S.B.; Bhanuprakash, V.; Parida, S.; Singh, R.K. Vaccines against peste des petits ruminants virus. Expert Rev. Vaccines 2010, 9, 785–796. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rojas, J.M.; Moreno, H.; Valcárcel, F.; Peña, L.; Sevilla, N.; Martín, V. Vaccination with recombinant adenoviruses expressing the peste des petits ruminants virus F or H proteins overcomes viral immunosuppression and induces protective immunity against PPRV challenge in sheep. PLoS ONE 2014, 9, e101226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zeltins, A. Construction and characterization of virus-like particles: A review. Mol. Biotechnol. 2013, 53, 92–107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, F.; Ge, S.; Li, L.; Wu, X.; Liu, Z.; Wang, Z. Virus-like particles: Potential veterinary vaccine immunogens. Res. Vet. Sci. 2012, 93, 553–559. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, W.; Jin, H.; Sui, X.; Zhao, Z.; Yang, C.; Wang, W.; Li, J.; Li, G. Self-assembly and release of peste des petits ruminants virus-like particles in an insect cell-baculovirus system and their immunogenicity in mice and goats. PLoS ONE 2014, 9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, F.; Wu, X.; Li, L.; Liu, Z.; Wang, Z. Formation of peste des petits ruminants spikeless virus-like particles by co-expression of M and N proteins in insect cells. Res. Vet. Sci. 2014, 96, 213–216. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, C.; Yan, F.; Zheng, X.; Wang, H.; Jin, H.; Wang, C.; Zhao, Y.; Feng, N.; Wang, T.; Gao, Y. Porcine epidemic diarrhea virus virus-like particles produced in insect cells induce specific immune responses in mice. Virus Genes 2017, 53, 548–554. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qi, Y.; Kang, H.; Zheng, X.; Wang, H.; Gao, Y.; Yang, S.; Xia, X. Incorporation of membrane-anchored flagellin or Escherichia coli heat-labile enterotoxin B subunit enhances the immunogenicity of rabies virus-like particles in mice and dogs. Front. Microbiol. 2015, 6, 169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kang, H.; Qi, Y.; Wang, H.; Zheng, X.; Gao, Y.; Li, N.; Yang, S.; Xia, X. Chimeric rabies virus-like particles containing membrane-anchored GM-CSF enhances the immune response against rabies virus. Viruses 2015, 7, 1134–1152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, F.; Wu, X.; Zou, Y.; Li, L.; Wang, Z. Peste des petits ruminants virus-like particles induce both complete virus-specific antibodies and virus neutralizing antibodies in mice. J. Virol. Methods 2015, 213, 45–49. [Google Scholar]
- Wang, Y.; Liu, G.; Chen, Z.; Li, C.; Shi, L.; Li, W.; Huang, H.; Tao, C.; Cheng, C.; Xu, B.; et al. Recombinant adenovirus expressing F and H fusion proteins of peste des petits ruminants virus induces both humoral and cell-mediated immune responses in goats. Vet. Immunol. Immunopathol. 2013, 154, 1–7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chackerian, B. Virus-like particles: Flexible platforms for vaccine development. Expert. Rev. Vaccines 2007, 6, 381–390. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fehr, T.; Skrastina, D.; Pumpens, P.; Zinkernagel, R.M. T cell-independent type I antibody response against B cell epitopes expressed repetitively on recombinant virus particles. Proc. Natl. Acad. Sci. USA 1998, 95, 9477–9481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bright, R.A.; Carter, D.M.; Daniluk, S.; Toapanta, F.R.; Ahmad, A.; Gavrilov, V.; Massare, M.; Pushko, P.; Mytle, N.; Rowe, T.; et al. Influenza virus-like particles elicit broader immune responses than whole virion inactivated influenza virus or recombinant hemagglutinin. Vaccine 2007, 25, 3871–3878. [Google Scholar] [CrossRef] [Scilit]
- Quan, F.S.; Huang, C.; Compans, R.W.; Kang, S.M. Virus-like particle vaccine induces protective immunity against homologous and heterologous strains of influenza virus. J. Virol. 2007, 81, 3514–3524. [Google Scholar] [CrossRef] [Scilit]
- Thyagarajan, R.; Arunkumar, N.; Song, W. Polyvalent antigens stabilize B cell antigen receptor surface signaling microdomains. J. Immunol. 2003, 170, 6099–6106. [Google Scholar] [CrossRef] [Scilit]
- Chackerian, B.; Durfee, M.R.; Schiller, J.T. Virus-like display of a neo-self antigen reverses B cell anergy in a B cell receptor transgenic mouse model. J. Immunol. 2008, 180, 5816–5825. [Google Scholar] [CrossRef] [Scilit]
- Sedlik, C.; Dridi, A.; Deriaud, E.; Saron, M.F.; Rueda, P.; Sarraseca, J.; Casal, J.I.; Leclerc, C. Intranasal delivery of recombinant parvovirus-like particles elicits cytotoxic T-cell and neutralizing antibody responses. J. Virol. 1999, 73, 2739–2744. [Google Scholar]
- Visciano, M.L.; Tagliamonte, M.; Tornesello, M.L.; Buonaguro, F.M.; Buonaguro, L. Effects of adjuvants on IgG subclasses elicited by virus-like particles. J. Transl. Med. 2012, 10, 4. [Google Scholar] [CrossRef] [Scilit]
- Gray, E.S.; Madiga, M.C.; Moore, P.L.; Mlisana, K.; Karim, S.S.A.; Binley, J.M.; Shaw, G.M.; Mascola, J.R.; Morris, L. Broad neutralization of human immunodeficiency virus type 1 mediated by plasma antibodies against the gp41 membrane proximal external region. J. Virol. 2009, 83, 11265–11274. [Google Scholar] [CrossRef] [Scilit]
- Schoenborn, J.R.; Wilson, C.B. Wilson Regulation of interferon-gamma during innate and adaptive immune responses. Adv. Immunol. 2007, 96, 41–101. [Google Scholar] [PubMed]
- Oriss, T.B.; McCarthy, S.A.; Morel, B.F.; Campana, M.A.; Morel, P.A. Crossregulation between T helper cell (Th)1 and Th2: Inhibition of Th2 proliferation by IFN-gamma involves interference with IL-1. J. Immunol. 1997, 158, 3666–3672. [Google Scholar] [PubMed]
- Fang, T.C.; Yashiro-Ohtani, Y.; Del Bianco, C.; Knoblock, D.M.; Blacklow, S.C.; Pear, W.S. Notch directly regulates Gata3 expression during T helper 2 cell differentiation. Immunity 2007, 27, 100–110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ohishi, K.; Inui, K.; Yamanouchi, K.; Barrett, T. Cell-mediated immune responses in cattle vaccinated with a vaccinia virus recombinant expressing the nucleocapsid protein of rinderpest virus. J. Gen. Virol. 1999, 80, 1627–1634. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lenz, P.; Day, P.M.; Pang, Y.Y.S.; Frye, S.A.; Jensen, P.N.; Lowy, D.R.; Schiller, J.T. Papillomavirus-like particles induce acute activation of dendritic cells. J. Immunol. 2001, 166, 5346–5355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lenz, P.; Thompson, C.D.; Day, P.M.; Bacot, S.M.; Lowy, D.R.; Schiller, J.T. Interaction of papillomavirus virus-like particles with human myeloid antigen-presenting cells. Clin. Immunol. 2003, 106, 231–237. [Google Scholar] [CrossRef] [Scilit]
- Schirmbeck, R.; Böhm, W.; Reimann, J. Virus-like particles induce MHC class I-restricted T-cell responses. Lessons learned from the hepatitis B small surface antigen. Intervirology 1996, 39, 111–119. [Google Scholar] [CrossRef] [Scilit]
- Win, S.J.; Ward, V.K.; Dunbar, P.R.; Young, S.L.; Baird, M.A. Cross-presentation of epitopes on virus-like particles via the MHC I receptor recycling pathway. Immunol. Cell Biol. 2011, 89, 681–688. [Google Scholar] [CrossRef] [Scilit]







| Primer | Sequence (5'-3') | Restriction Enzyme Site |
|---|---|---|
| MF | ACAGCTAGCCGGTCCGATGACCGAGATCTACGAT | NheI+RsrII |
| MR | GCATGCGCGGCCGCTTACAGGATCTTGAACAG | SphI+NotI |
| FF | ACAGCTAGCCGGTCCGATGACACGGGTCGCAACC | NheI+Rsr II |
| FR | GCATGCGCGGCCGCCTACAGTGATCTCACGTA | SphI+NotI |
| HF | ACAGCTAGCCGGTCCGATGTCCGCACAAAGGGAA | NheI+RsrII |
| HR | GGTACCGCGGCCGCTCAGACTGGATTACATGT | KpnI+NotI |
| M13F | GTTTTCCCAGTCACGAC | |
| M13R | CAGGAAACAGCTATGAC | |
| P10F | GGGGTATCGACAGAGTGC | |
| P10R | CGGACCTTTAATTCAACCC |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yan, F.; Banadyga, L.; Zhao, Y.; Zhao, Z.; Schiffman, Z.; Huang, P.; Li, E.; Wang, C.; Gao, Y.; Feng, N.; et al. Peste des Petits Ruminants Virus-Like Particles Induce a Potent Humoral and Cellular Immune Response in Goats. Viruses 2019, 11, 918. https://doi.org/10.3390/v11100918
Yan F, Banadyga L, Zhao Y, Zhao Z, Schiffman Z, Huang P, Li E, Wang C, Gao Y, Feng N, et al. Peste des Petits Ruminants Virus-Like Particles Induce a Potent Humoral and Cellular Immune Response in Goats. Viruses. 2019; 11(10):918. https://doi.org/10.3390/v11100918
Chicago/Turabian StyleYan, Feihu, Logan Banadyga, Yongkun Zhao, Ziqi Zhao, Zachary Schiffman, Pei Huang, Entao Li, Cuiling Wang, Yuwei Gao, Na Feng, and et al. 2019. "Peste des Petits Ruminants Virus-Like Particles Induce a Potent Humoral and Cellular Immune Response in Goats" Viruses 11, no. 10: 918. https://doi.org/10.3390/v11100918
APA StyleYan, F., Banadyga, L., Zhao, Y., Zhao, Z., Schiffman, Z., Huang, P., Li, E., Wang, C., Gao, Y., Feng, N., Wang, T., Wang, H., Xia, X., Wang, C., Yang, S., & Qiu, X. (2019). Peste des Petits Ruminants Virus-Like Particles Induce a Potent Humoral and Cellular Immune Response in Goats. Viruses, 11(10), 918. https://doi.org/10.3390/v11100918

